Starting /dee2/code/volunteer_pipeline.sh SRR5011899 current disk space = 1543152082944 free memory = 1602812640 SRR5011899 SRAfilesize 3c956a2c904870144f5edd29d9293af6 SRR5011899.sra SRR5011899.sra file validated SRR5011899 is paired end SRR5011899 is conventional basespace SRR5011899 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011899_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.7725 3.0 3.0 3.0 2.0 3.0 2 2.879 3.0 3.0 3.0 3.0 3.0 3 2.911 3.0 3.0 3.0 3.0 3.0 4 5.982 6.0 6.0 6.0 6.0 6.0 5 5.9505 6.0 6.0 6.0 6.0 6.0 6 5.9645 6.0 6.0 6.0 6.0 6.0 7 5.94225 6.0 6.0 6.0 6.0 6.0 8 5.94475 6.0 6.0 6.0 6.0 6.0 9 7.92275 8.0 8.0 8.0 8.0 8.0 10-11 7.9197500000000005 8.0 8.0 8.0 8.0 8.0 12-13 7.911 8.0 8.0 8.0 8.0 8.0 14-15 9.725 10.0 10.0 10.0 9.0 10.0 16-17 9.717125 10.0 10.0 10.0 9.0 10.0 18-19 9.6475 10.0 10.0 10.0 9.0 10.0 20-21 9.630749999999999 10.0 10.0 10.0 9.0 10.0 22-23 9.59825 10.0 10.0 10.0 9.0 10.0 24-25 9.53125 10.0 9.0 10.0 9.0 10.0 26-27 9.441875 10.0 9.0 10.0 8.0 10.0 28-29 9.440249999999999 10.0 9.0 10.0 8.0 10.0 30-31 9.485125 10.0 9.0 10.0 8.5 10.0 32-33 9.499875 10.0 9.0 10.0 8.5 10.0 34-35 9.407875 10.0 9.0 10.0 8.0 10.0 36-37 9.34225 10.0 9.0 10.0 8.0 10.0 38-39 9.248750000000001 10.0 9.0 10.0 7.5 10.0 40-41 9.155125 10.0 9.0 10.0 7.0 10.0 42-43 9.07 10.0 9.0 10.0 7.0 10.0 44-45 8.978125 10.0 9.0 10.0 6.0 10.0 46-47 9.001625 10.0 9.0 10.0 6.0 10.0 48-49 8.900375 10.0 9.0 10.0 5.5 10.0 50-51 8.715375 10.0 8.0 10.0 4.5 10.0 52-53 8.53425 10.0 8.0 10.0 4.0 10.0 54-55 8.365625 10.0 7.5 10.0 4.0 10.0 56-57 8.175625 9.5 6.0 10.0 4.0 10.0 58-59 7.92875 9.0 6.0 10.0 4.0 10.0 60-61 7.647875 8.5 5.0 10.0 4.0 10.0 62-63 7.35675 8.0 4.5 10.0 4.0 10.0 64-65 7.12025 8.0 4.0 10.0 4.0 10.0 66-67 6.7932500000000005 6.5 4.0 9.5 4.0 10.0 68-69 6.429625 6.0 4.0 9.0 4.0 10.0 70-71 6.087651593726283 6.0 4.0 8.0 4.0 10.0 72-73 5.7743790128524 5.0 4.0 8.0 4.0 9.5 74-75 5.471766873302711 5.0 4.0 6.5 4.0 8.5 76-77 4.359563052833895 4.0 3.0 5.5 1.5 8.0 78-79 4.893802358116524 4.0 4.0 6.0 3.5 8.0 80-81 4.730348057550575 4.0 4.0 5.5 4.0 6.5 82-83 4.543853466096577 4.0 4.0 5.0 4.0 6.0 84-85 4.336470647250895 4.0 4.0 5.0 3.5 6.0 86-87 4.197349583047197 4.0 4.0 4.5 3.0 5.5 88-89 4.082329622445997 4.0 4.0 4.0 3.0 5.0 90-91 3.9964975938430403 4.0 4.0 4.0 3.0 5.0 92-93 3.9379246734657363 4.0 4.0 4.0 3.0 5.0 94-95 3.850058587648632 4.0 4.0 4.0 3.0 5.0 96-97 3.824739870624812 4.0 4.0 4.0 3.0 4.0 98-99 3.8280013460407276 4.0 4.0 4.0 3.0 4.0 100-101 3.4051411357336994 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 1.0 4 23.0 5 268.0 6 981.0 7 2067.0 8 650.0 9 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.5 12.5 10.325 50.675000000000004 2 23.775 19.525000000000002 35.3 21.4 3 24.224999999999998 24.725 23.525 27.525 4 27.175 28.975 18.2 25.650000000000002 5 27.500000000000004 31.775 20.549999999999997 20.175 6 20.599999999999998 36.025 22.275 21.099999999999998 7 19.525000000000002 17.025000000000002 39.25 24.2 8 21.925 21.175 28.65 28.249999999999996 9 20.45 21.2 30.925000000000004 27.425 10-11 24.224999999999998 29.45 21.6125 24.712500000000002 12-13 22.1 23.7125 27.5125 26.674999999999997 14-15 22.85 24.95 26.8375 25.362499999999997 16-17 24.224999999999998 26.237500000000004 24.575 24.962500000000002 18-19 23.4375 25.2625 24.887500000000003 26.4125 20-21 23.7125 25.7875 25.112499999999997 25.387500000000003 22-23 23.7875 25.374999999999996 25.412499999999998 25.424999999999997 24-25 24.075 25.6125 25.5 24.8125 26-27 23.3125 25.7375 25.775 25.174999999999997 28-29 23.5 25.587500000000002 25.674999999999997 25.2375 30-31 22.825 25.387500000000003 26.0125 25.775 32-33 23.175 26.450000000000003 24.6125 25.7625 34-35 23.3125 26.200000000000003 25.324999999999996 25.162499999999998 36-37 23.7 25.074999999999996 25.8125 25.412499999999998 38-39 23.0125 26.474999999999998 25.15 25.362499999999997 40-41 22.9875 25.575 25.7375 25.7 42-43 23.974999999999998 25.275 25.424999999999997 25.324999999999996 44-45 23.575 25.8625 25.7125 24.85 46-47 23.375 26.237500000000004 24.6625 25.724999999999998 48-49 23.724999999999998 25.0625 25.75 25.4625 50-51 23.5625 25.5125 26.35 24.575 52-53 24.099999999999998 25.224999999999998 24.9875 25.687500000000004 54-55 23.4875 25.7875 25.7625 24.962500000000002 56-57 23.974999999999998 25.525 25.0625 25.4375 58-59 24.1375 26.724999999999998 24.212500000000002 24.925 60-61 23.0125 25.624999999999996 26.075 25.2875 62-63 23.0625 26.1625 25.474999999999998 25.3 64-65 23.6125 25.6 25.412499999999998 25.374999999999996 66-67 23.1625 25.1875 25.8 25.85 68-69 23.9375 24.925 25.025 26.1125 70-71 24.45618005783981 25.688419464353075 24.594492644285175 25.26090783352194 72-73 24.501094373632032 26.058967426290717 24.30796961503798 25.131968585039267 74-75 24.130205587770163 25.632577754348972 25.395361096468104 24.841855561412757 76-77 24.464614948234292 25.343922847823002 26.16650120550277 24.024960998439937 78-79 23.726114649681527 25.911986103068905 25.043427909669948 25.318471337579616 80-81 24.00059005753061 26.818114766189705 25.16595368048385 24.015341495795838 82-83 24.543396226415094 25.328301886792453 24.87547169811321 25.252830188679244 84-85 24.094146794673275 25.162589036853518 26.169092598327655 24.574171570145555 86-87 23.948579590541183 25.488017774956358 26.186319631804476 24.377083002697987 88-89 24.123879380603096 25.786471067644662 26.356968215158926 23.732681336593316 90-91 22.683866644329033 25.180097168704975 26.11827776847043 26.01775841849556 92-93 23.778276636159557 26.765670868589194 25.246071490243484 24.209981005007773 94-95 23.186063218390803 25.646551724137932 27.173132183908045 23.99425287356322 96-97 23.941033774958015 25.769733159171487 25.30322821421907 24.986004851651426 98-99 22.721985265606826 26.172935246219463 25.979061651803026 25.126017836370686 100-101 23.206106870229007 26.455834242093783 25.29989094874591 25.0381679389313 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 1.5 28 2.5 29 6.5 30 7.0 31 9.5 32 14.5 33 18.0 34 24.0 35 37.0 36 53.5 37 72.0 38 90.5 39 102.5 40 126.5 41 165.0 42 179.0 43 182.5 44 213.0 45 230.0 46 229.0 47 218.5 48 193.5 49 170.5 50 163.0 51 157.5 52 145.5 53 142.5 54 129.0 55 106.5 56 96.5 57 97.0 58 103.5 59 94.0 60 80.5 61 84.0 62 77.0 63 63.0 64 54.5 65 42.5 66 39.0 67 45.5 68 38.0 69 31.5 70 29.5 71 27.5 72 28.0 73 24.5 74 20.0 75 14.0 76 11.0 77 8.5 78 5.0 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 47.0 71 51.0 72 37.0 73 48.0 74 46.0 75 224.0 76 43.0 77 34.0 78 32.0 79 29.0 80 39.0 81 39.0 82 37.0 83 43.0 84 44.0 85 39.0 86 35.0 87 48.0 88 35.0 89 43.0 90 45.0 91 46.0 92 41.0 93 64.0 94 54.0 95 53.0 96 49.0 97 51.0 98 50.0 99 36.0 100 451.0 101 2067.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011899 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011899_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.3495 3.0 2.0 3.0 0.0 3.0 2 2.61825 3.0 2.0 3.0 0.0 3.0 3 3.0405 3.0 3.0 3.0 2.0 3.0 4 5.966 6.0 6.0 6.0 6.0 6.0 5 5.94975 6.0 6.0 6.0 6.0 6.0 6 5.96725 6.0 6.0 6.0 6.0 6.0 7 5.97 6.0 6.0 6.0 6.0 6.0 8 6.1235 6.0 6.0 6.0 6.0 6.0 9 7.89975 8.0 8.0 8.0 8.0 8.0 10-11 7.90475 8.0 8.0 8.0 8.0 8.0 12-13 7.976 8.0 8.0 8.0 8.0 8.0 14-15 9.691875 10.0 10.0 10.0 9.0 10.0 16-17 9.677 10.0 10.0 10.0 9.0 10.0 18-19 9.639625 10.0 10.0 10.0 9.0 10.0 20-21 9.58975 10.0 9.5 10.0 9.0 10.0 22-23 9.555875 10.0 9.0 10.0 9.0 10.0 24-25 9.477625 10.0 9.0 10.0 8.5 10.0 26-27 9.4835 10.0 9.0 10.0 8.5 10.0 28-29 9.564875 10.0 10.0 10.0 9.0 10.0 30-31 9.552125 10.0 10.0 10.0 9.0 10.0 32-33 9.476624999999999 10.0 9.0 10.0 8.0 10.0 34-35 9.4145 10.0 9.0 10.0 8.0 10.0 36-37 9.34825 10.0 9.0 10.0 8.0 10.0 38-39 9.300625 10.0 9.0 10.0 8.0 10.0 40-41 9.220875 10.0 9.0 10.0 7.0 10.0 42-43 9.107 10.0 9.0 10.0 7.0 10.0 44-45 8.998750000000001 10.0 9.0 10.0 6.5 10.0 46-47 8.872375 10.0 9.0 10.0 6.0 10.0 48-49 8.643625 9.5 8.0 10.0 5.0 10.0 50-51 7.540625 8.0 7.0 9.0 3.5 9.5 52-53 7.68225 8.5 7.0 9.0 4.0 9.5 54-55 8.14025 9.0 7.0 10.0 4.0 10.0 56-57 8.158999999999999 9.0 6.5 10.0 4.0 10.0 58-59 7.984249999999999 9.0 6.0 10.0 4.0 10.0 60-61 7.732875 9.0 5.5 10.0 4.0 10.0 62-63 7.432625 8.0 5.0 10.0 4.0 10.0 64-65 7.123125 8.0 4.0 10.0 4.0 10.0 66-67 6.7795000000000005 6.5 4.0 9.5 4.0 10.0 68-69 6.4185 6.0 4.0 8.5 4.0 10.0 70-71 6.076937579053883 5.5 4.0 8.0 4.0 10.0 72-73 5.756072601182002 5.0 4.0 8.0 4.0 9.5 74-75 5.445610595404546 5.0 4.0 6.5 4.0 8.5 76-77 5.144721262685021 4.0 4.0 6.0 4.0 8.0 78-79 4.865304906691128 4.0 4.0 6.0 4.0 8.0 80-81 4.608662023948645 4.0 4.0 5.0 3.5 6.0 82-83 4.4236474888391895 4.0 4.0 5.0 3.0 6.0 84-85 4.2271546779714395 4.0 4.0 5.0 3.0 6.0 86-87 4.08845025353469 4.0 4.0 4.0 3.0 5.0 88-89 4.018281316951072 4.0 4.0 4.0 3.0 5.0 90-91 3.9056697352722125 4.0 4.0 4.0 3.0 5.0 92-93 3.8720486146897626 4.0 4.0 4.0 3.0 5.0 94-95 3.7953747925430203 4.0 4.0 4.0 3.0 4.5 96-97 3.779730730625854 4.0 4.0 4.0 3.0 4.0 98-99 3.770602517579203 4.0 4.0 4.0 3.0 4.0 100-101 3.2020457041215105 3.5 3.0 4.0 1.5 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 2.0 4 22.0 5 264.0 6 1140.0 7 1976.0 8 587.0 9 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.625 6.075 13.900000000000002 53.400000000000006 2 23.9 21.5 32.1 22.5 3 24.875 25.724999999999998 21.825 27.575 4 27.725 29.975 17.299999999999997 25.0 5 28.000000000000004 30.825000000000003 20.75 20.424999999999997 6 19.7 34.0 23.974999999999998 22.325 7 18.725 17.05 40.875 23.35 8 21.125 21.425 27.925 29.525000000000002 9 20.825 22.975 30.8 25.4 10-11 24.087500000000002 28.962500000000002 21.625 25.324999999999996 12-13 21.85 24.2875 27.975 25.887500000000003 14-15 22.55 26.325 26.387500000000003 24.7375 16-17 23.7625 25.412499999999998 24.725 26.1 18-19 22.8 26.187500000000004 25.0625 25.95 20-21 23.3875 26.25 25.7125 24.65 22-23 24.325 26.75 24.275 24.65 24-25 23.45 26.474999999999998 25.174999999999997 24.9 26-27 23.724999999999998 25.9875 25.2875 25.0 28-29 22.95 25.7625 25.474999999999998 25.8125 30-31 22.45 25.662499999999998 26.0 25.887500000000003 32-33 24.212500000000002 26.0625 25.387500000000003 24.337500000000002 34-35 23.200000000000003 25.637500000000003 25.374999999999996 25.7875 36-37 23.3125 25.650000000000002 25.8125 25.224999999999998 38-39 23.7125 26.337500000000002 25.1 24.85 40-41 23.9375 25.900000000000002 24.95 25.2125 42-43 22.3125 26.087500000000002 25.974999999999998 25.624999999999996 44-45 23.125 25.937500000000004 24.8625 26.075 46-47 23.962500000000002 26.05 25.362499999999997 24.625 48-49 23.0125 25.412499999999998 25.8125 25.7625 50-51 24.025 25.4875 25.275 25.2125 52-53 22.237499999999997 26.5875 25.174999999999997 26.0 54-55 23.175 25.687500000000004 26.0 25.137500000000003 56-57 24.0 25.074999999999996 25.937500000000004 24.9875 58-59 24.087500000000002 25.4875 24.9375 25.4875 60-61 23.0875 25.8625 25.775 25.275 62-63 23.275000000000002 26.337500000000002 25.412499999999998 24.975 64-65 23.5625 25.8125 25.7375 24.887500000000003 66-67 23.8625 25.337500000000002 25.7875 25.0125 68-69 23.724999999999998 26.150000000000002 25.575 24.55 70-71 24.22985037092921 25.361498805482206 25.44951590594744 24.95913491764114 72-73 24.874339476736694 25.956953215620572 24.449026936460886 24.719680371181855 74-75 23.71939113170086 26.08868299139643 24.645929847782924 25.545996029119788 76-77 23.660290326956993 25.844525844525844 25.24759191425858 25.24759191425858 78-79 23.913948646773076 25.1353226925746 25.51006245662734 25.440666204024982 80-81 23.808846536765753 27.236523965296545 24.946664770302945 24.00796472763476 82-83 24.497579580460613 25.7738007921373 25.157694000293386 24.5709256271087 84-85 24.109173616376044 25.868081880212284 25.655799848369977 24.366944655041696 86-87 24.21219319081552 26.22327790973872 25.55819477434679 24.00633412509897 88-89 23.26992456543129 26.451295506723515 25.92653328960315 24.352246638242047 90-91 23.578767123287673 26.078767123287673 25.77054794520548 24.57191780821918 92-93 23.29231317995363 26.698769395398607 25.539504191189582 24.469413233458177 94-95 24.25366215464491 25.996662340070465 25.05099202670128 24.698683478583348 96-97 22.997667185069982 25.524883359253497 25.699844479004664 25.777604976671853 98-99 24.165988608624897 25.996745321399512 26.383238405207486 23.454027664768105 100-101 23.275208491281273 25.04422542330048 26.889057366691937 24.791508718726305 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 2.5 27 1.0 28 1.0 29 2.5 30 8.5 31 13.0 32 15.5 33 22.0 34 34.5 35 45.5 36 47.5 37 66.0 38 88.0 39 113.0 40 131.0 41 147.5 42 181.5 43 192.0 44 204.0 45 226.0 46 230.5 47 220.5 48 200.0 49 201.0 50 183.5 51 159.5 52 160.0 53 137.0 54 114.0 55 105.0 56 102.0 57 96.0 58 82.5 59 73.5 60 70.5 61 71.5 62 71.0 63 58.5 64 49.5 65 50.0 66 51.0 67 48.0 68 41.0 69 36.0 70 29.0 71 19.0 72 13.5 73 14.5 74 18.5 75 14.0 76 7.0 77 5.5 78 2.0 79 1.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 47.0 71 52.0 72 43.0 73 48.0 74 65.0 75 36.0 76 47.0 77 38.0 78 43.0 79 44.0 80 43.0 81 49.0 82 73.0 83 44.0 84 61.0 85 82.0 86 55.0 87 51.0 88 60.0 89 58.0 90 82.0 91 53.0 92 45.0 93 54.0 94 61.0 95 65.0 96 58.0 97 54.0 98 62.0 99 101.0 100 695.0 101 1631.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733153 spots for SRR5011899.sra Written 733153 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra Read 733145 spots for SRR5011899.sra Written 733145 spots for SRR5011899.sra SRR ids: ['SRR5011899.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rivz8es1 SRR5011899.sra spots: 14662908 blocks: [[1, 733145], [733146, 1466290], [1466291, 2199435], [2199436, 2932580], [2932581, 3665725], [3665726, 4398870], [4398871, 5132015], [5132016, 5865160], [5865161, 6598305], [6598306, 7331450], [7331451, 8064595], [8064596, 8797740], [8797741, 9530885], [9530886, 10264030], [10264031, 10997175], [10997176, 11730320], [11730321, 12463465], [12463466, 13196610], [13196611, 13929755], [13929756, 14662908]] SRR5011899 file size 3239557 SRR5011899 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011899 SRR5011899_1.fastq SRR5011899_2.fastq Input file: SRR5011899_1.fastq Paired file: SRR5011899_2.fastq trimmed: SRR5011899-trimmed-pair1.fastq, SRR5011899-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:17:13 2024 >> started Sat Dec 7 11:17:34 2024 >> done (20.896s) 14662908 read pairs processed; of these: 62620 ( 0.43%) short read pairs filtered out after trimming by size control 89627 ( 0.61%) empty read pairs filtered out after trimming by size control 14510661 (98.96%) read pairs available; of these: 14510604 (100.00%) trimmed read pairs available after processing 57 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 164 0.00% 19 253 0.00% 20 515 0.00% 21 802 0.01% 22 1257 0.01% 23 2067 0.01% 24 3380 0.02% 25 5161 0.04% 26 7591 0.05% 27 11060 0.08% 28 15254 0.11% 29 20674 0.14% 30 27238 0.19% 31 34811 0.24% 32 43597 0.30% 33 54656 0.38% 34 66773 0.46% 35 78533 0.54% 36 91441 0.63% 37 105740 0.73% 38 120895 0.83% 39 137224 0.95% 40 152716 1.05% 41 168655 1.16% 42 185402 1.28% 43 200300 1.38% 44 216795 1.49% 45 231331 1.59% 46 244545 1.69% 47 261802 1.80% 48 278259 1.92% 49 295103 2.03% 50 315250 2.17% 51 333259 2.30% 52 349667 2.41% 53 368199 2.54% 54 386695 2.66% 55 407342 2.81% 56 428508 2.95% 57 451099 3.11% 58 476911 3.29% 59 505028 3.48% 60 530429 3.66% 61 558659 3.85% 62 580682 4.00% 63 589562 4.06% 64 611956 4.22% 65 612364 4.22% 66 595695 4.11% 67 566715 3.91% 68 526147 3.63% 69 472796 3.26% 70 412251 2.84% 71 349295 2.41% 72 283732 1.96% 73 221334 1.53% 74 166157 1.15% 75 118982 0.82% 76 82415 0.57% 77 54623 0.38% 78 35510 0.24% 79 22554 0.16% 80 14125 0.10% 81 8584 0.06% 82 4935 0.03% 83 2706 0.02% 84 1443 0.01% 85 615 0.00% 86 297 0.00% 87 101 0.00% 88 35 0.00% 89 9 0.00% 90 0 0.00% 91 1 0.00% 14510661 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=13 prefix-density=0.20 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=25.92 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.6 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGCTG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=12 prefix-density=0.19 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=28.00 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.3 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGC SRR5011899 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:17:59 Started mapping on | Dec 07 11:17:59 Finished on | Dec 07 11:18:23 Mapping speed, Million of reads per hour | 2176.60 Number of input reads | 14510661 Average input read length | 116 UNIQUE READS: Uniquely mapped reads number | 14089864 Uniquely mapped reads % | 97.10% Average mapped length | 116.39 Number of splices: Total | 5747417 Number of splices: Annotated (sjdb) | 5496407 Number of splices: GT/AG | 5669436 Number of splices: GC/AG | 66755 Number of splices: AT/AC | 3072 Number of splices: Non-canonical | 8154 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.00% Insertion average length | 1.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180320 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 30716 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 248817 248817 248817 N_multimapping 180320 180320 180320 N_noFeature 551475 7209644 7184011 N_ambiguous 287117 20645 20574 UnstrandedReadsAssigned:13251272 PositiveStrandReadsAssigned:6859575 NegativeStrandReadsAssigned:6885279 Dataset is classified unstranded MeadianReadLen=60 20thPercentileLength=47 echo kmer=43 SRR5011899 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011899-trimmed-pair1.fastq SRR5011899-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,510,661 reads, 13,629,904 reads pseudoaligned [quant] estimated average fragment length: 220.26 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR5011899.ke.tsv 35125 SRR5011899.se.tsv 88098 total ==> SRR5011899.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.023 0 0 PNS24247 1044 824.74 34.4673 4.68024 PNS24249 1928 1708.74 23.5034 1.5404 PNS24246 1044 824.74 34.4673 4.68024 PNS24248 1044 824.74 34.4673 4.68024 PNS24244 1471 1251.74 57.0946 5.10808 PNS24243 293 112.281 1 0.997406 KQK14069 1603 1383.74 1615.79 130.77 KQK14071 474 265.994 97.5133 41.0553 ==> SRR5011899.se.tsv <== BRADI_1g14170v3 2300 BRADI_1g53295v3 43 BRADI_1g59795v3 220 BRADI_1g07683v3 0 BRADI_1g00485v3 82 BRADI_1g20270v3 2545 BRADI_1g74790v3 99 BRADI_1g09890v3 9 BRADI_1g77505v3 264 BRADI_1g48960v3 0 SRR5011899 completed mapping pipeline successfully