Starting /dee2/code/volunteer_pipeline.sh SRR5011900 current disk space = 1543158312960 free memory = 1602808980 SRR5011900 SRAfilesize 8be32b47b94c568eaeb714ce83aae343 SRR5011900.sra SRR5011900.sra file validated SRR5011900 is paired end SRR5011900 is conventional basespace SRR5011900 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011900_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.79225 3.0 3.0 3.0 2.0 3.0 2 2.9095 3.0 3.0 3.0 3.0 3.0 3 2.9135 3.0 3.0 3.0 3.0 3.0 4 5.988 6.0 6.0 6.0 6.0 6.0 5 5.965 6.0 6.0 6.0 6.0 6.0 6 5.9815 6.0 6.0 6.0 6.0 6.0 7 5.9515 6.0 6.0 6.0 6.0 6.0 8 5.944 6.0 6.0 6.0 6.0 6.0 9 7.91425 8.0 8.0 8.0 8.0 8.0 10-11 7.913875 8.0 8.0 8.0 8.0 8.0 12-13 7.9115 8.0 8.0 8.0 8.0 8.0 14-15 9.702375 10.0 10.0 10.0 9.0 10.0 16-17 9.690375 10.0 10.0 10.0 9.0 10.0 18-19 9.675625 10.0 10.0 10.0 9.0 10.0 20-21 9.6445 10.0 10.0 10.0 9.0 10.0 22-23 9.599 10.0 9.5 10.0 9.0 10.0 24-25 9.554749999999999 10.0 9.0 10.0 9.0 10.0 26-27 9.475124999999998 10.0 9.0 10.0 8.5 10.0 28-29 9.465125 10.0 9.0 10.0 8.0 10.0 30-31 9.490625 10.0 9.0 10.0 8.0 10.0 32-33 9.46725 10.0 9.0 10.0 8.0 10.0 34-35 9.408375 10.0 9.0 10.0 8.0 10.0 36-37 9.359375 10.0 9.0 10.0 8.0 10.0 38-39 9.26125 10.0 9.0 10.0 7.5 10.0 40-41 9.143875000000001 10.0 9.0 10.0 7.0 10.0 42-43 9.065249999999999 10.0 9.0 10.0 7.0 10.0 44-45 8.971499999999999 10.0 9.0 10.0 6.0 10.0 46-47 8.9515 10.0 9.0 10.0 6.0 10.0 48-49 8.82025 10.0 8.5 10.0 5.0 10.0 50-51 8.66675 10.0 8.0 10.0 4.0 10.0 52-53 8.473125 10.0 8.0 10.0 4.0 10.0 54-55 8.295875 10.0 6.5 10.0 4.0 10.0 56-57 8.1075 9.0 6.0 10.0 4.0 10.0 58-59 7.88975 9.0 6.0 10.0 4.0 10.0 60-61 7.6114999999999995 8.5 5.0 10.0 4.0 10.0 62-63 7.349 8.0 4.5 10.0 4.0 10.0 64-65 7.073 8.0 4.0 10.0 4.0 10.0 66-67 6.7368749999999995 6.5 4.0 9.5 4.0 10.0 68-69 6.385625 6.0 4.0 8.5 4.0 10.0 70-71 6.050327454960669 5.5 4.0 8.0 4.0 10.0 72-73 5.755866012688335 5.0 4.0 8.0 4.0 10.0 74-75 5.444508196547416 5.0 4.0 7.0 4.0 8.5 76-77 4.32016833731579 4.0 3.0 5.5 1.5 8.0 78-79 4.882521719721163 4.0 4.0 6.0 3.5 8.0 80-81 4.724416997662306 4.0 4.0 5.5 4.0 7.0 82-83 4.494998924151376 4.0 4.0 5.0 4.0 6.0 84-85 4.3202040368582715 4.0 4.0 5.0 3.0 6.0 86-87 4.1989295464421605 4.0 4.0 4.0 3.5 5.5 88-89 4.082407061412598 4.0 4.0 4.0 3.0 5.0 90-91 3.9824030679134372 4.0 4.0 4.0 3.0 5.0 92-93 3.939167688331881 4.0 4.0 4.0 3.0 5.0 94-95 3.854667377935299 4.0 4.0 4.0 3.0 5.0 96-97 3.822037570072343 4.0 4.0 4.0 3.0 4.0 98-99 3.8099770322808535 4.0 4.0 4.0 3.0 4.0 100-101 3.409476051430839 3.5 3.5 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 2.0 4 20.0 5 250.0 6 1072.0 7 1979.0 8 666.0 9 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.55 11.525 9.950000000000001 53.974999999999994 2 21.325 20.125 35.325 23.225 3 23.825 24.15 22.375 29.65 4 26.35 29.775000000000002 17.65 26.224999999999998 5 27.975 32.675 21.224999999999998 18.125 6 22.85 35.875 19.975 21.3 7 19.55 18.775 38.675 23.0 8 19.075 22.825 29.25 28.849999999999998 9 21.65 20.3 31.175000000000004 26.875 10-11 24.099999999999998 28.775000000000002 22.7 24.425 12-13 22.3375 23.8625 27.85 25.95 14-15 22.537499999999998 25.275 26.0 26.187500000000004 16-17 23.525 25.7375 25.5375 25.2 18-19 22.787499999999998 25.5125 25.374999999999996 26.325 20-21 24.1375 25.937500000000004 25.6125 24.3125 22-23 23.525 25.412499999999998 24.5125 26.55 24-25 23.7 26.125 24.85 25.324999999999996 26-27 22.8625 26.125 25.362499999999997 25.650000000000002 28-29 23.799999999999997 25.8125 25.162499999999998 25.224999999999998 30-31 23.5125 26.7625 24.275 25.45 32-33 23.962500000000002 25.387500000000003 25.624999999999996 25.025 34-35 22.8375 26.825 25.2 25.137500000000003 36-37 22.9625 25.2625 26.137500000000003 25.637500000000003 38-39 23.225 26.0375 25.575 25.162499999999998 40-41 22.325 26.25 25.775 25.650000000000002 42-43 24.087500000000002 25.8125 23.9375 26.1625 44-45 22.2625 26.6125 25.15 25.974999999999998 46-47 23.8375 25.05 25.7375 25.374999999999996 48-49 23.3125 25.525 25.162499999999998 26.0 50-51 23.799999999999997 25.900000000000002 25.05 25.25 52-53 23.9125 24.887500000000003 25.8125 25.387500000000003 54-55 22.8 25.95 26.137500000000003 25.112499999999997 56-57 22.787499999999998 26.6125 25.775 24.825 58-59 23.0625 25.7375 25.5625 25.637500000000003 60-61 23.0375 25.7375 25.374999999999996 25.85 62-63 23.425 25.174999999999997 25.687500000000004 25.7125 64-65 23.3375 25.724999999999998 25.137500000000003 25.8 66-67 22.925 25.974999999999998 25.525 25.575 68-69 24.375 26.0125 23.9375 25.674999999999997 70-71 25.299080720312304 25.286487847878103 24.279058053141924 25.135373378667676 72-73 24.82544608223429 24.7737264028963 24.91595552107577 25.48487199379364 74-75 23.46762398617205 26.898018880468022 25.009972078181093 24.624385055178834 76-77 24.389192296636963 25.22276516240299 25.76889910893935 24.619143432020696 78-79 23.967184295341344 25.241722824494577 24.685027834749487 26.10606504541459 80-81 24.09476978095664 25.540157949634928 25.30174340634779 25.063328863060647 82-83 24.17465388711395 26.319793092956033 25.102692834322227 24.40286018560779 84-85 23.106947697111632 25.979703356752538 25.573770491803277 25.33957845433255 86-87 23.100450740502254 26.175144880875724 25.724404378622022 25.0 88-89 24.604221635883906 26.33575197889182 24.406332453825858 24.65369393139842 90-91 23.52141400407886 26.9544527532291 25.373895309313394 24.150237933378655 92-93 24.162133707668012 26.197578522547815 25.61852956659063 24.021758203193542 94-95 23.780155994921095 26.428441864683478 25.811717758026482 23.979684382368944 96-97 22.714526079641054 26.135726303982054 25.91138530566461 25.238362310712283 98-99 23.62082362082362 26.3014763014763 26.06837606837607 24.00932400932401 100-101 22.80893952673094 26.095530236634527 27.453987730061353 23.64154250657318 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 3.0 27 1.0 28 3.0 29 9.5 30 12.0 31 8.0 32 15.0 33 25.5 34 27.5 35 36.0 36 51.0 37 69.0 38 87.0 39 112.5 40 134.0 41 145.0 42 184.5 43 204.0 44 208.0 45 231.5 46 236.5 47 220.5 48 198.5 49 179.0 50 168.0 51 165.5 52 142.0 53 113.5 54 104.0 55 88.5 56 88.5 57 104.0 58 91.0 59 75.5 60 74.0 61 81.5 62 81.5 63 67.5 64 58.5 65 55.5 66 50.0 67 47.0 68 45.5 69 38.0 70 35.5 71 33.0 72 26.0 73 20.5 74 18.5 75 15.5 76 10.0 77 7.5 78 4.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 59.0 71 44.0 72 60.0 73 51.0 74 51.0 75 237.0 76 38.0 77 34.0 78 26.0 79 24.0 80 41.0 81 31.0 82 35.0 83 44.0 84 45.0 85 52.0 86 44.0 87 29.0 88 46.0 89 48.0 90 38.0 91 50.0 92 47.0 93 45.0 94 49.0 95 39.0 96 37.0 97 51.0 98 62.0 99 47.0 100 428.0 101 2068.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011900 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011900_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.24625 3.0 2.0 3.0 0.0 3.0 2 2.58125 3.0 2.0 3.0 0.0 3.0 3 2.99475 3.0 3.0 3.0 2.0 3.0 4 5.95625 6.0 6.0 6.0 6.0 6.0 5 5.94625 6.0 6.0 6.0 6.0 6.0 6 5.95225 6.0 6.0 6.0 6.0 6.0 7 5.956 6.0 6.0 6.0 6.0 6.0 8 6.087 6.0 6.0 6.0 6.0 6.0 9 7.89025 8.0 8.0 8.0 8.0 8.0 10-11 7.906000000000001 8.0 8.0 8.0 8.0 8.0 12-13 7.9712499999999995 8.0 8.0 8.0 8.0 8.0 14-15 9.697125 10.0 10.0 10.0 9.0 10.0 16-17 9.665125 10.0 10.0 10.0 9.0 10.0 18-19 9.633500000000002 10.0 10.0 10.0 9.0 10.0 20-21 9.59825 10.0 9.5 10.0 9.0 10.0 22-23 9.533249999999999 10.0 9.0 10.0 9.0 10.0 24-25 9.482125 10.0 9.0 10.0 8.5 10.0 26-27 9.481874999999999 10.0 9.0 10.0 8.0 10.0 28-29 9.566125 10.0 9.5 10.0 9.0 10.0 30-31 9.530625 10.0 9.0 10.0 9.0 10.0 32-33 9.445875000000001 10.0 9.0 10.0 8.0 10.0 34-35 9.395375 10.0 9.0 10.0 8.0 10.0 36-37 9.34525 10.0 9.0 10.0 8.0 10.0 38-39 9.283750000000001 10.0 9.0 10.0 8.0 10.0 40-41 9.178875000000001 10.0 9.0 10.0 7.0 10.0 42-43 9.075875 10.0 9.0 10.0 7.0 10.0 44-45 8.932125 10.0 9.0 10.0 6.0 10.0 46-47 8.7965 10.0 8.5 10.0 6.0 10.0 48-49 8.627 10.0 8.0 10.0 5.0 10.0 50-51 7.5655 8.0 7.0 9.0 3.5 9.5 52-53 7.6396250000000006 8.5 7.0 9.0 4.0 9.5 54-55 8.11975 9.0 7.0 10.0 4.0 10.0 56-57 8.135375 9.0 6.5 10.0 4.0 10.0 58-59 7.9155 9.0 6.0 10.0 4.0 10.0 60-61 7.7017500000000005 9.0 5.0 10.0 4.0 10.0 62-63 7.432 8.0 4.5 10.0 4.0 10.0 64-65 7.1225000000000005 8.0 4.0 10.0 4.0 10.0 66-67 6.776249999999999 6.5 4.0 9.5 4.0 10.0 68-69 6.44725 6.0 4.0 8.5 4.0 10.0 70-71 6.101474306431274 5.5 4.0 8.0 4.0 10.0 72-73 5.783655127924982 5.0 4.0 8.0 4.0 10.0 74-75 5.47392180167512 5.0 4.0 7.0 4.0 8.5 76-77 5.1975368749252215 4.0 4.0 6.0 4.0 8.0 78-79 4.906459741854334 4.0 4.0 6.0 3.5 8.0 80-81 4.6330640744333085 4.0 4.0 5.0 3.0 6.5 82-83 4.403183345173952 4.0 4.0 5.0 3.0 6.0 84-85 4.228232081862249 4.0 4.0 5.0 3.0 6.0 86-87 4.071855735963299 4.0 4.0 4.0 3.0 5.0 88-89 4.004522755329807 4.0 4.0 4.0 3.0 5.0 90-91 3.9283647880300303 4.0 4.0 4.0 3.0 5.0 92-93 3.8816263793146937 4.0 4.0 4.0 3.0 5.0 94-95 3.8030494349390747 4.0 4.0 4.0 3.0 4.5 96-97 3.7748973075888843 4.0 4.0 4.0 3.0 4.0 98-99 3.751360422962761 4.0 4.0 4.0 3.0 4.0 100-101 3.22781836153748 3.5 3.0 4.0 1.5 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 3.0 4 19.0 5 288.0 6 1129.0 7 1971.0 8 587.0 9 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.05 6.4750000000000005 12.85 53.625 2 22.400000000000002 21.575 34.425 21.6 3 24.575 24.5 23.05 27.875 4 27.3 29.75 16.675 26.275 5 27.150000000000002 32.125 21.525 19.2 6 21.675 32.675 25.074999999999996 20.575 7 19.375 18.375 38.95 23.3 8 20.025000000000002 22.125 29.525000000000002 28.325 9 20.549999999999997 23.400000000000002 31.374999999999996 24.675 10-11 24.025 29.2875 22.7125 23.974999999999998 12-13 22.0125 24.8 26.5375 26.650000000000002 14-15 23.1625 25.4625 26.700000000000003 24.675 16-17 24.1375 25.2875 24.762500000000003 25.8125 18-19 22.8875 25.2875 26.4125 25.412499999999998 20-21 23.200000000000003 25.575 25.9875 25.2375 22-23 23.375 24.8625 25.8125 25.95 24-25 23.275000000000002 25.15 25.837500000000002 25.7375 26-27 23.2625 25.924999999999997 25.2875 25.525 28-29 23.35 26.4125 25.0 25.2375 30-31 23.325000000000003 26.650000000000002 25.124999999999996 24.9 32-33 23.575 25.137500000000003 25.2125 26.075 34-35 23.225 25.674999999999997 25.75 25.35 36-37 23.674999999999997 25.337500000000002 25.650000000000002 25.337500000000002 38-39 23.8125 26.687499999999996 24.6875 24.8125 40-41 23.7 25.624999999999996 24.9375 25.7375 42-43 22.85 25.624999999999996 26.237500000000004 25.2875 44-45 23.150000000000002 26.0625 25.4875 25.3 46-47 23.0125 26.424999999999997 25.275 25.2875 48-49 22.3875 25.387500000000003 26.5375 25.687500000000004 50-51 24.575 25.0625 25.074999999999996 25.2875 52-53 23.6875 25.337500000000002 25.724999999999998 25.25 54-55 23.599999999999998 25.7375 25.0125 25.650000000000002 56-57 23.2375 25.424999999999997 26.387500000000003 24.95 58-59 24.125 24.9 25.412499999999998 25.5625 60-61 23.325000000000003 26.1625 25.337500000000002 25.174999999999997 62-63 24.55 25.5625 24.625 25.2625 64-65 23.1 25.7625 25.324999999999996 25.8125 66-67 23.325000000000003 25.162499999999998 25.275 26.237500000000004 68-69 23.7625 25.5625 25.4875 25.1875 70-71 23.063402385436284 25.448838669177654 25.586942875078467 25.9008160703076 72-73 24.118098159509202 25.5879345603272 25.025562372188137 25.268404907975462 74-75 24.11634276770575 25.74670666492761 25.14673275074997 24.99021781661667 76-77 23.69649286571543 25.64341912254967 25.283371116148817 25.37671689558608 78-79 24.85628250752806 25.78702436353682 25.17109225294279 24.185600875992336 80-81 25.13338949733221 26.57961246840775 24.61387250772255 23.67312552653749 82-83 25.202663578459756 25.839606253618992 24.189345686160973 24.76838448176028 84-85 24.52067106051528 25.83882564409826 25.449370880766924 24.19113241461953 86-87 24.88965952080706 25.063051702395967 25.031525851197983 25.015762925598988 88-89 23.855619360131257 25.168170631665298 25.742411812961446 25.233798195242002 90-91 23.477070499657767 26.112251882272414 26.36892539356605 24.041752224503764 92-93 24.243503025987895 26.183695265218937 25.275898896404414 24.29690281238875 94-95 24.436936936936938 26.33258258258258 24.605855855855857 24.624624624624623 96-97 23.15251572327044 26.552672955974842 26.316823899371066 23.97798742138365 98-99 24.41812136325852 25.768911055694097 26.226101413133833 23.586866167913552 100-101 23.128205128205128 25.384615384615383 27.615384615384613 23.871794871794872 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 1.0 28 3.5 29 6.5 30 7.0 31 11.5 32 17.0 33 18.0 34 27.0 35 38.0 36 51.0 37 72.0 38 97.0 39 124.0 40 137.0 41 155.0 42 174.0 43 179.5 44 208.0 45 226.5 46 224.5 47 216.0 48 199.5 49 186.0 50 166.5 51 156.0 52 138.0 53 133.0 54 129.0 55 116.0 56 115.0 57 97.5 58 82.5 59 82.0 60 75.0 61 75.0 62 79.0 63 74.5 64 62.0 65 44.5 66 41.5 67 45.0 68 44.5 69 38.0 70 28.0 71 23.0 72 23.5 73 19.0 74 10.5 75 9.0 76 9.0 77 5.5 78 1.5 79 1.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 35.0 71 33.0 72 40.0 73 38.0 74 41.0 75 40.0 76 47.0 77 48.0 78 50.0 79 45.0 80 44.0 81 56.0 82 58.0 83 54.0 84 66.0 85 98.0 86 70.0 87 58.0 88 63.0 89 55.0 90 78.0 91 46.0 92 56.0 93 85.0 94 64.0 95 54.0 96 68.0 97 61.0 98 86.0 99 102.0 100 622.0 101 1639.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra Read 543851 spots for SRR5011900.sra Written 543851 spots for SRR5011900.sra Read 543834 spots for SRR5011900.sra Written 543834 spots for SRR5011900.sra SRR ids: ['SRR5011900.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mo891ob0 SRR5011900.sra spots: 10876697 blocks: [[1, 543834], [543835, 1087668], [1087669, 1631502], [1631503, 2175336], [2175337, 2719170], [2719171, 3263004], [3263005, 3806838], [3806839, 4350672], [4350673, 4894506], [4894507, 5438340], [5438341, 5982174], [5982175, 6526008], [6526009, 7069842], [7069843, 7613676], [7613677, 8157510], [8157511, 8701344], [8701345, 9245178], [9245179, 9789012], [9789013, 10332846], [10332847, 10876697]] SRR5011900 file size 2395552 SRR5011900 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011900 SRR5011900_1.fastq SRR5011900_2.fastq Input file: SRR5011900_1.fastq Paired file: SRR5011900_2.fastq trimmed: SRR5011900-trimmed-pair1.fastq, SRR5011900-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:17:29 2024 >> started Sat Dec 7 11:17:47 2024 >> done (18.501s) 10876697 read pairs processed; of these: 45184 ( 0.42%) short read pairs filtered out after trimming by size control 65657 ( 0.60%) empty read pairs filtered out after trimming by size control 10765856 (98.98%) read pairs available; of these: 10765810 (100.00%) trimmed read pairs available after processing 46 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 87 0.00% 19 159 0.00% 20 318 0.00% 21 498 0.00% 22 815 0.01% 23 1414 0.01% 24 2181 0.02% 25 3514 0.03% 26 5299 0.05% 27 7388 0.07% 28 10477 0.10% 29 14071 0.13% 30 18969 0.18% 31 24200 0.22% 32 30737 0.29% 33 38580 0.36% 34 46961 0.44% 35 56238 0.52% 36 64912 0.60% 37 75669 0.70% 38 86442 0.80% 39 98046 0.91% 40 111000 1.03% 41 122425 1.14% 42 134472 1.25% 43 146513 1.36% 44 158664 1.47% 45 169904 1.58% 46 180399 1.68% 47 193725 1.80% 48 204494 1.90% 49 219029 2.03% 50 234611 2.18% 51 247476 2.30% 52 261655 2.43% 53 273789 2.54% 54 287868 2.67% 55 303673 2.82% 56 318285 2.96% 57 335406 3.12% 58 355650 3.30% 59 376340 3.50% 60 395213 3.67% 61 414657 3.85% 62 432571 4.02% 63 439205 4.08% 64 456820 4.24% 65 457756 4.25% 66 443935 4.12% 67 423761 3.94% 68 392240 3.64% 69 353341 3.28% 70 308770 2.87% 71 260414 2.42% 72 213650 1.98% 73 166318 1.54% 74 124187 1.15% 75 88922 0.83% 76 61860 0.57% 77 41419 0.38% 78 26882 0.25% 79 16923 0.16% 80 10350 0.10% 81 6547 0.06% 82 3756 0.03% 83 2136 0.02% 84 1056 0.01% 85 493 0.00% 86 228 0.00% 87 62 0.00% 88 17 0.00% 89 8 0.00% 90 6 0.00% 10765856 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=10 prefix-density=0.21 prefix-fanout=2.5 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=9.13 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.5 sequence=CTTGGCCTTCGCTGCTGTCTTGCGCATGGTCACGCGGGCCTCGCCAAAAAGAGCTGACGATGGCAAGTTCTTTACGGCCTTGCC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=14 prefix-density=0.19 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=12.34 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.5 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGG SRR5011900 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:18:12 Started mapping on | Dec 07 11:18:12 Finished on | Dec 07 11:18:30 Mapping speed, Million of reads per hour | 2153.17 Number of input reads | 10765856 Average input read length | 117 UNIQUE READS: Uniquely mapped reads number | 10482436 Uniquely mapped reads % | 97.37% Average mapped length | 116.57 Number of splices: Total | 4326612 Number of splices: Annotated (sjdb) | 4137692 Number of splices: GT/AG | 4268100 Number of splices: GC/AG | 50266 Number of splices: AT/AC | 2218 Number of splices: Non-canonical | 6028 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.00% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 122921 % of reads mapped to multiple loci | 1.14% Number of reads mapped to too many loci | 14486 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 166685 166685 166685 N_multimapping 122921 122921 122921 N_noFeature 418315 5359510 5356202 N_ambiguous 214952 15617 15571 UnstrandedReadsAssigned:9849169 PositiveStrandReadsAssigned:5107309 NegativeStrandReadsAssigned:5110663 Dataset is classified unstranded MeadianReadLen=61 20thPercentileLength=48 echo kmer=43 SRR5011900 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011900-trimmed-pair1.fastq SRR5011900-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,765,856 reads, 10,132,819 reads pseudoaligned [quant] estimated average fragment length: 227.746 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR5011900.ke.tsv 35125 SRR5011900.se.tsv 88098 total ==> SRR5011900.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.477 0 0 PNS24247 1044 817.254 27.7652 5.06655 PNS24249 1928 1701.25 19.36 1.69709 PNS24246 1044 817.254 27.7652 5.06655 PNS24248 1044 817.254 27.7652 5.06655 PNS24244 1471 1244.25 39.3445 4.71569 PNS24243 293 109.544 2 2.72277 KQK14069 1603 1376.25 1249 135.342 KQK14071 474 261.652 69.5057 39.6155 ==> SRR5011900.se.tsv <== BRADI_1g14170v3 1649 BRADI_1g53295v3 29 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1865 BRADI_1g74790v3 111 BRADI_1g09890v3 4 BRADI_1g77505v3 196 BRADI_1g48960v3 0 SRR5011900 completed mapping pipeline successfully