Starting /dee2/code/volunteer_pipeline.sh SRR5011901 current disk space = 1542994075648 free memory = 1599987116 SRR5011901 SRAfilesize 98b3a469452aa94fb6c8903c72a62396 SRR5011901.sra SRR5011901.sra file validated SRR5011901 is paired end SRR5011901 is conventional basespace SRR5011901 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011901_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.804 3.0 3.0 3.0 2.0 3.0 2 2.9095 3.0 3.0 3.0 3.0 3.0 3 2.94825 3.0 3.0 3.0 3.0 3.0 4 5.998 6.0 6.0 6.0 6.0 6.0 5 5.98075 6.0 6.0 6.0 6.0 6.0 6 5.9805 6.0 6.0 6.0 6.0 6.0 7 5.97 6.0 6.0 6.0 6.0 6.0 8 5.962 6.0 6.0 6.0 6.0 6.0 9 7.909 8.0 8.0 8.0 8.0 8.0 10-11 7.93 8.0 8.0 8.0 8.0 8.0 12-13 7.9085 8.0 8.0 8.0 8.0 8.0 14-15 9.70525 10.0 10.0 10.0 9.0 10.0 16-17 9.687249999999999 10.0 10.0 10.0 9.0 10.0 18-19 9.661999999999999 10.0 10.0 10.0 9.0 10.0 20-21 9.610875 10.0 10.0 10.0 9.0 10.0 22-23 9.5555 10.0 9.0 10.0 9.0 10.0 24-25 9.526375 10.0 9.0 10.0 9.0 10.0 26-27 9.440875 10.0 9.0 10.0 8.0 10.0 28-29 9.448875000000001 10.0 9.0 10.0 8.0 10.0 30-31 9.4855 10.0 9.0 10.0 8.0 10.0 32-33 9.452875 10.0 9.0 10.0 8.0 10.0 34-35 9.409375 10.0 9.0 10.0 8.0 10.0 36-37 9.3565 10.0 9.0 10.0 8.0 10.0 38-39 9.27 10.0 9.0 10.0 8.0 10.0 40-41 9.10325 10.0 9.0 10.0 7.0 10.0 42-43 9.03125 10.0 9.0 10.0 7.0 10.0 44-45 8.989875 10.0 9.0 10.0 6.0 10.0 46-47 9.003875 10.0 9.0 10.0 6.0 10.0 48-49 8.901125 10.0 9.0 10.0 5.5 10.0 50-51 8.722625 10.0 8.0 10.0 4.0 10.0 52-53 8.555499999999999 10.0 8.0 10.0 4.0 10.0 54-55 8.42125 10.0 8.0 10.0 4.0 10.0 56-57 8.231875 10.0 6.5 10.0 4.0 10.0 58-59 8.005375 9.0 6.0 10.0 4.0 10.0 60-61 7.754125 9.0 5.5 10.0 4.0 10.0 62-63 7.473125 8.0 5.0 10.0 4.0 10.0 64-65 7.194125 8.0 4.0 10.0 4.0 10.0 66-67 6.8888750000000005 7.5 4.0 9.5 4.0 10.0 68-69 6.513625 6.0 4.0 9.0 4.0 10.0 70-71 6.1573709452610235 6.0 4.0 8.0 4.0 10.0 72-73 5.840412070862195 5.0 4.0 8.0 4.0 9.5 74-75 5.533483506937696 5.0 4.0 7.0 4.0 8.5 76-77 4.432482791554287 4.0 3.5 5.5 2.0 8.0 78-79 4.941175472219099 4.0 4.0 6.0 3.5 8.0 80-81 4.786177341415797 4.0 4.0 5.5 4.0 7.0 82-83 4.53741502372201 4.0 4.0 5.0 4.0 6.0 84-85 4.354324124213227 4.0 4.0 5.0 3.0 6.0 86-87 4.227953504491256 4.0 4.0 5.0 3.0 5.5 88-89 4.10439900268131 4.0 4.0 4.0 3.0 5.0 90-91 4.0142742281553625 4.0 4.0 4.0 3.0 5.0 92-93 3.945602911299145 4.0 4.0 4.0 3.0 5.0 94-95 3.8708496522718985 4.0 4.0 4.0 3.0 5.0 96-97 3.846701120553646 4.0 4.0 4.0 3.0 4.5 98-99 3.84039468549948 4.0 4.0 4.0 3.0 4.0 100-101 3.374736533129633 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 1.0 4 34.0 5 257.0 6 940.0 7 2046.0 8 715.0 9 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.325 12.75 10.225 52.7 2 22.0 21.7 35.15 21.15 3 24.75 23.45 23.575 28.225 4 26.724999999999998 30.4 17.525 25.35 5 26.400000000000002 33.15 21.125 19.325 6 20.0 34.525 23.375 22.1 7 18.6 18.275 40.400000000000006 22.725 8 20.474999999999998 21.349999999999998 29.2 28.975 9 20.474999999999998 20.525 32.300000000000004 26.700000000000003 10-11 24.975 30.3875 20.5125 24.125 12-13 22.2 24.175 28.025 25.6 14-15 22.775000000000002 25.687500000000004 26.325 25.2125 16-17 23.0625 26.8 24.925 25.2125 18-19 23.1875 26.35 25.35 25.112499999999997 20-21 23.875 26.137500000000003 25.412499999999998 24.575 22-23 23.9375 25.0 26.724999999999998 24.337500000000002 24-25 23.200000000000003 25.912499999999998 25.650000000000002 25.2375 26-27 23.325000000000003 25.7 26.187500000000004 24.7875 28-29 22.9375 25.900000000000002 26.174999999999997 24.9875 30-31 22.8375 25.525 25.624999999999996 26.0125 32-33 22.8 25.650000000000002 26.224999999999998 25.324999999999996 34-35 23.5375 25.937500000000004 25.8 24.725 36-37 23.1625 26.237500000000004 25.15 25.45 38-39 23.45 26.224999999999998 25.087500000000002 25.2375 40-41 23.1875 25.924999999999997 25.837500000000002 25.05 42-43 22.912499999999998 24.95 25.9625 26.174999999999997 44-45 23.325000000000003 26.924999999999997 25.1 24.65 46-47 23.3125 25.924999999999997 26.05 24.712500000000002 48-49 23.5625 25.3 26.1 25.0375 50-51 23.175 26.6125 26.137500000000003 24.075 52-53 23.0125 25.387500000000003 25.637500000000003 25.9625 54-55 22.575 26.650000000000002 26.1 24.675 56-57 22.95 25.924999999999997 25.85 25.275 58-59 23.150000000000002 25.5625 26.3125 24.975 60-61 24.349999999999998 26.1125 24.3875 25.15 62-63 23.2875 26.0125 25.637500000000003 25.0625 64-65 23.6375 26.337500000000002 25.025 25.0 66-67 22.5125 26.7125 25.687500000000004 25.087500000000002 68-69 24.0125 25.5 24.762500000000003 25.724999999999998 70-71 24.679083815756357 25.308331235841937 25.547445255474454 24.46513969292726 72-73 23.586492431103636 25.43666709794281 25.747185923146592 25.229654547806962 74-75 24.258939252957596 25.880632726305997 25.335637378705307 24.524790642031107 76-77 23.429639212304153 26.045709357481673 25.887595227828086 24.637056202386088 78-79 23.55444672732609 25.18344584678603 26.768417963017317 24.49368946287056 80-81 24.509069105081696 26.367860890421223 24.673961924748912 24.449108079748164 82-83 23.469231943808214 26.15666513971599 26.324629714460222 24.049473202015577 84-85 23.02270947533281 26.421299921691464 25.544244322631165 25.01174628034456 86-87 23.371831889637473 26.483798524222006 26.05068976580045 24.093679820340068 88-89 23.833855282676776 26.85017306741388 24.526124938190208 24.789846711719136 90-91 22.571282226395766 26.754311080758068 26.344544988902168 24.329861703943997 92-93 24.58179256911428 26.48353583377355 25.673534072900157 23.261137524212007 94-95 23.558394160583944 26.186131386861316 25.93065693430657 24.324817518248175 96-97 23.126419379258138 26.62755488266465 26.003028009084026 24.24299772899319 98-99 23.15251572327044 27.849842767295595 25.393081761006293 23.604559748427672 100-101 23.664459161147903 26.82119205298013 25.364238410596023 24.150110375275936 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 1.0 26 1.0 27 3.5 28 4.5 29 3.5 30 8.0 31 12.0 32 17.5 33 25.0 34 34.0 35 46.5 36 51.0 37 73.0 38 101.5 39 127.0 40 137.5 41 149.5 42 179.5 43 200.5 44 214.5 45 231.5 46 236.5 47 234.0 48 222.5 49 193.0 50 181.0 51 162.5 52 136.5 53 118.0 54 98.0 55 96.5 56 97.0 57 81.0 58 73.0 59 80.5 60 88.0 61 79.0 62 69.5 63 64.0 64 56.5 65 45.5 66 38.5 67 39.0 68 37.5 69 34.5 70 30.0 71 25.0 72 21.0 73 21.5 74 17.0 75 12.0 76 10.5 77 7.0 78 4.0 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 54.0 71 53.0 72 57.0 73 46.0 74 57.0 75 235.0 76 39.0 77 30.0 78 44.0 79 34.0 80 31.0 81 30.0 82 31.0 83 46.0 84 41.0 85 39.0 86 32.0 87 42.0 88 51.0 89 56.0 90 47.0 91 46.0 92 39.0 93 53.0 94 54.0 95 51.0 96 40.0 97 47.0 98 62.0 99 47.0 100 402.0 101 2064.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011901 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011901_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.281 3.0 2.0 3.0 0.0 3.0 2 2.6365 3.0 3.0 3.0 2.0 3.0 3 3.0315 3.0 3.0 3.0 2.0 3.0 4 5.946 6.0 6.0 6.0 6.0 6.0 5 5.94775 6.0 6.0 6.0 6.0 6.0 6 5.9585 6.0 6.0 6.0 6.0 6.0 7 5.9585 6.0 6.0 6.0 6.0 6.0 8 6.09875 6.0 6.0 6.0 6.0 6.0 9 7.90075 8.0 8.0 8.0 8.0 8.0 10-11 7.901875 8.0 8.0 8.0 8.0 8.0 12-13 7.967125 8.0 8.0 8.0 8.0 8.0 14-15 9.682625 10.0 10.0 10.0 9.0 10.0 16-17 9.661124999999998 10.0 10.0 10.0 9.0 10.0 18-19 9.6395 10.0 10.0 10.0 9.0 10.0 20-21 9.615625 10.0 10.0 10.0 9.0 10.0 22-23 9.56025 10.0 9.5 10.0 9.0 10.0 24-25 9.509375 10.0 9.0 10.0 8.5 10.0 26-27 9.493625 10.0 9.0 10.0 8.5 10.0 28-29 9.5745 10.0 10.0 10.0 9.0 10.0 30-31 9.53875 10.0 9.0 10.0 9.0 10.0 32-33 9.495750000000001 10.0 9.0 10.0 8.0 10.0 34-35 9.45775 10.0 9.0 10.0 8.0 10.0 36-37 9.37575 10.0 9.0 10.0 8.0 10.0 38-39 9.327375 10.0 9.0 10.0 8.0 10.0 40-41 9.246500000000001 10.0 9.0 10.0 7.5 10.0 42-43 9.151 10.0 9.0 10.0 7.0 10.0 44-45 9.052624999999999 10.0 9.0 10.0 7.0 10.0 46-47 8.9155 10.0 9.0 10.0 6.0 10.0 48-49 8.744 10.0 8.0 10.0 5.5 10.0 50-51 7.665125 8.0 7.0 9.0 4.0 9.5 52-53 7.764875 8.5 7.0 9.5 4.0 9.5 54-55 8.256375 9.0 7.0 10.0 4.0 10.0 56-57 8.262 9.0 7.0 10.0 4.0 10.0 58-59 8.08325 9.0 6.0 10.0 4.0 10.0 60-61 7.835625 9.0 6.0 10.0 4.0 10.0 62-63 7.58475 8.0 5.0 10.0 4.0 10.0 64-65 7.285375 8.0 4.5 10.0 4.0 10.0 66-67 6.959125 7.5 4.0 10.0 4.0 10.0 68-69 6.608124999999999 6.0 4.0 9.0 4.0 10.0 70-71 6.237997223624432 6.0 4.0 8.0 4.0 10.0 72-73 5.8866717575560354 5.0 4.0 8.0 4.0 10.0 74-75 5.585147244556955 5.0 4.0 7.5 4.0 9.0 76-77 5.275094135861462 4.5 4.0 6.0 4.0 8.0 78-79 4.984193093099275 4.0 4.0 6.0 4.0 8.0 80-81 4.7229558552506266 4.0 4.0 5.5 3.5 7.0 82-83 4.496222124413146 4.0 4.0 5.0 3.5 6.0 84-85 4.3086311509331985 4.0 4.0 5.0 3.0 6.0 86-87 4.143721960381861 4.0 4.0 4.5 3.0 5.5 88-89 4.046951599240115 4.0 4.0 4.0 3.0 5.0 90-91 3.972777674303098 4.0 4.0 4.0 3.0 5.0 92-93 3.9226496583508963 4.0 4.0 4.0 3.0 5.0 94-95 3.8555443101258966 4.0 4.0 4.0 3.0 5.0 96-97 3.8054457149363867 4.0 4.0 4.0 3.0 4.5 98-99 3.7968594731266867 4.0 4.0 4.0 3.0 4.0 100-101 3.2323285252014484 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 3.0 4 16.0 5 258.0 6 1031.0 7 2004.0 8 674.0 9 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.025 6.225 13.725000000000001 55.025 2 24.0 20.75 33.275 21.975 3 26.25 25.15 21.45 27.150000000000002 4 27.975 29.95 17.224999999999998 24.85 5 27.125 32.800000000000004 22.25 17.825 6 21.45 32.300000000000004 25.2 21.05 7 18.7 17.175 39.025 25.1 8 20.925 22.425 29.7 26.950000000000003 9 19.85 21.6 32.225 26.325 10-11 24.325 28.975 22.325 24.375 12-13 21.8625 24.825 28.249999999999996 25.0625 14-15 22.3875 25.687500000000004 27.237499999999997 24.6875 16-17 22.85 25.7375 25.8625 25.55 18-19 23.2125 25.7125 25.7375 25.337500000000002 20-21 22.825 26.575 25.575 25.025 22-23 23.0375 26.5125 26.424999999999997 24.025 24-25 22.55 26.075 26.174999999999997 25.2 26-27 22.925 26.400000000000002 26.674999999999997 24.0 28-29 23.2625 25.35 25.775 25.6125 30-31 21.837500000000002 26.1 26.787499999999998 25.275 32-33 22.825 26.724999999999998 25.7375 24.712500000000002 34-35 23.1125 26.637499999999996 25.75 24.5 36-37 22.7125 25.0 26.224999999999998 26.0625 38-39 22.4625 26.724999999999998 25.937500000000004 24.875 40-41 23.549999999999997 26.2875 26.075 24.087500000000002 42-43 22.2 26.474999999999998 26.5375 24.7875 44-45 23.35 25.974999999999998 26.237500000000004 24.4375 46-47 22.7375 26.487500000000004 25.124999999999996 25.650000000000002 48-49 22.975 26.25 25.7375 25.0375 50-51 22.4625 25.7 26.35 25.4875 52-53 22.7125 26.0375 25.8 25.45 54-55 22.775000000000002 25.724999999999998 26.7625 24.7375 56-57 23.7 26.325 25.55 24.425 58-59 23.65 25.412499999999998 25.650000000000002 25.2875 60-61 22.8125 25.837500000000002 26.375 24.975 62-63 22.8125 25.924999999999997 26.325 24.9375 64-65 22.5125 26.3125 25.8 25.374999999999996 66-67 23.9 25.650000000000002 26.05 24.4 68-69 24.125 24.925 25.525 25.424999999999997 70-71 24.805325295151974 25.14443607133886 24.930921878924895 25.119316754584275 72-73 23.4099961454452 25.97969934472568 26.48079146858538 24.129513041243737 74-75 24.008405568689255 25.689519306540582 25.63698450223273 24.66509062253743 76-77 24.67375218619669 25.655859007130367 24.983183102381272 24.687205704291674 78-79 22.932486538727044 26.30125638547563 26.30125638547563 24.465000690321688 80-81 23.142370958593304 26.3471355643789 26.106069200226884 24.404424276800906 82-83 23.994755244755243 25.815850815850816 25.582750582750585 24.606643356643357 84-85 23.037593984962406 26.075187969924812 26.39097744360902 24.49624060150376 86-87 23.937254901960785 26.47843137254902 26.101960784313725 23.482352941176472 88-89 23.70082564351627 26.16156710377206 26.30726890076089 23.830338351950786 90-91 23.735931463127834 26.1212833865278 26.709222240886948 23.433562909457418 92-93 23.67090814014293 26.372668642147463 26.390099355063622 23.566323862645984 94-95 22.523990584827086 25.602027883396705 27.720441788882855 24.153539742893354 96-97 23.81491973559962 25.967894239848917 26.87440982058546 23.342776203966007 98-99 24.23580786026201 26.30011909487892 25.48630408892418 23.977768955934895 100-101 23.266109198229216 27.004426955238564 26.02065912444663 23.70880472208559 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 2.0 26 1.0 27 1.5 28 5.5 29 6.5 30 11.0 31 15.5 32 14.0 33 18.0 34 29.0 35 50.0 36 63.0 37 77.0 38 108.5 39 134.0 40 149.0 41 169.5 42 194.0 43 199.0 44 210.5 45 228.0 46 228.5 47 219.5 48 202.0 49 185.0 50 179.0 51 157.0 52 135.5 53 131.5 54 123.0 55 105.0 56 89.5 57 82.0 58 76.0 59 75.0 60 76.5 61 75.0 62 59.5 63 50.5 64 50.5 65 44.5 66 36.0 67 31.5 68 36.0 69 35.0 70 22.0 71 13.5 72 13.0 73 12.0 74 10.0 75 8.5 76 7.5 77 8.5 78 7.5 79 5.5 80 2.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 38.0 71 51.0 72 39.0 73 40.0 74 50.0 75 45.0 76 41.0 77 51.0 78 47.0 79 50.0 80 44.0 81 48.0 82 48.0 83 53.0 84 60.0 85 78.0 86 59.0 87 46.0 88 47.0 89 62.0 90 53.0 91 58.0 92 47.0 93 51.0 94 65.0 95 48.0 96 67.0 97 56.0 98 78.0 99 118.0 100 658.0 101 1704.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra Read 609868 spots for SRR5011901.sra Written 609868 spots for SRR5011901.sra Read 609853 spots for SRR5011901.sra Written 609853 spots for SRR5011901.sra SRR ids: ['SRR5011901.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7li1u0z SRR5011901.sra spots: 12197075 blocks: [[1, 609853], [609854, 1219706], [1219707, 1829559], [1829560, 2439412], [2439413, 3049265], [3049266, 3659118], [3659119, 4268971], [4268972, 4878824], [4878825, 5488677], [5488678, 6098530], [6098531, 6708383], [6708384, 7318236], [7318237, 7928089], [7928090, 8537942], [8537943, 9147795], [9147796, 9757648], [9757649, 10367501], [10367502, 10977354], [10977355, 11587207], [11587208, 12197075]] SRR5011901 file size 2695303 SRR5011901 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011901 SRR5011901_1.fastq SRR5011901_2.fastq Input file: SRR5011901_1.fastq Paired file: SRR5011901_2.fastq trimmed: SRR5011901-trimmed-pair1.fastq, SRR5011901-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:24:20 2024 >> started Sat Dec 7 11:24:33 2024 >> done (13.111s) 12197075 read pairs processed; of these: 47188 ( 0.39%) short read pairs filtered out after trimming by size control 73366 ( 0.60%) empty read pairs filtered out after trimming by size control 12076521 (99.01%) read pairs available; of these: 12076461 (100.00%) trimmed read pairs available after processing 60 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 106 0.00% 19 175 0.00% 20 365 0.00% 21 514 0.00% 22 852 0.01% 23 1466 0.01% 24 2237 0.02% 25 3449 0.03% 26 5272 0.04% 27 7444 0.06% 28 10528 0.09% 29 14468 0.12% 30 19282 0.16% 31 24686 0.20% 32 30679 0.25% 33 38530 0.32% 34 47641 0.39% 35 55471 0.46% 36 65742 0.54% 37 75493 0.63% 38 86566 0.72% 39 98967 0.82% 40 111204 0.92% 41 123195 1.02% 42 136469 1.13% 43 148693 1.23% 44 161507 1.34% 45 173807 1.44% 46 185759 1.54% 47 199346 1.65% 48 212434 1.76% 49 228731 1.89% 50 245832 2.04% 51 262596 2.17% 52 279777 2.32% 53 295101 2.44% 54 312505 2.59% 55 332719 2.76% 56 351130 2.91% 57 373506 3.09% 58 398293 3.30% 59 424795 3.52% 60 449695 3.72% 61 474764 3.93% 62 498483 4.13% 63 509581 4.22% 64 530726 4.39% 65 535386 4.43% 66 523331 4.33% 67 501450 4.15% 68 466379 3.86% 69 422678 3.50% 70 371766 3.08% 71 313987 2.60% 72 257475 2.13% 73 201777 1.67% 74 151648 1.26% 75 109865 0.91% 76 75468 0.62% 77 50708 0.42% 78 32981 0.27% 79 20781 0.17% 80 12921 0.11% 81 7949 0.07% 82 4601 0.04% 83 2563 0.02% 84 1271 0.01% 85 555 0.00% 86 259 0.00% 87 97 0.00% 88 26 0.00% 89 11 0.00% 90 5 0.00% 91 2 0.00% 12076521 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=9 prefix-density=0.18 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=11.04 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=12 prefix-density=0.16 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=30.00 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=10.3 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGC SRR5011901 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:24:56 Started mapping on | Dec 07 11:24:56 Finished on | Dec 07 11:25:47 Mapping speed, Million of reads per hour | 852.46 Number of input reads | 12076521 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 11701160 Uniquely mapped reads % | 96.89% Average mapped length | 117.85 Number of splices: Total | 4973863 Number of splices: Annotated (sjdb) | 4757239 Number of splices: GT/AG | 4905144 Number of splices: GC/AG | 58940 Number of splices: AT/AC | 2743 Number of splices: Non-canonical | 7036 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.00% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 152124 % of reads mapped to multiple loci | 1.26% Number of reads mapped to too many loci | 29934 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 230359 230359 230359 N_multimapping 152124 152124 152124 N_noFeature 499314 5989688 6007825 N_ambiguous 235218 16771 16934 UnstrandedReadsAssigned:10966628 PositiveStrandReadsAssigned:5694701 NegativeStrandReadsAssigned:5676401 Dataset is classified unstranded MeadianReadLen=61 20thPercentileLength=49 echo kmer=45 SRR5011901 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011901-trimmed-pair1.fastq SRR5011901-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,076,521 reads, 11,302,111 reads pseudoaligned [quant] estimated average fragment length: 213.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR5011901.ke.tsv 35125 SRR5011901.se.tsv 88098 total ==> SRR5011901.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.567 0 0 PNS24247 1044 831.378 27.0699 4.50943 PNS24249 1928 1715.38 26.394 2.13097 PNS24246 1044 831.378 27.0699 4.50943 PNS24248 1044 831.378 27.0699 4.50943 PNS24244 1471 1258.38 24.3963 2.68501 PNS24243 293 111.342 3 3.73159 KQK14069 1603 1390.38 962.482 95.8722 KQK14071 474 270.245 74.2152 38.0336 ==> SRR5011901.se.tsv <== BRADI_1g14170v3 1337 BRADI_1g53295v3 28 BRADI_1g59795v3 173 BRADI_1g07683v3 0 BRADI_1g00485v3 73 BRADI_1g20270v3 2065 BRADI_1g74790v3 99 BRADI_1g09890v3 11 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR5011901 completed mapping pipeline successfully