Starting /dee2/code/volunteer_pipeline.sh SRR5011902 current disk space = 1543004925952 free memory = 1602867548 SRR5011902 SRAfilesize ed01343c4db10a6c0824095601e42ecf SRR5011902.sra SRR5011902.sra file validated SRR5011902 is paired end SRR5011902 is conventional basespace SRR5011902 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011902_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.75775 3.0 3.0 3.0 2.0 3.0 2 2.9105 3.0 3.0 3.0 3.0 3.0 3 2.92825 3.0 3.0 3.0 3.0 3.0 4 5.98175 6.0 6.0 6.0 6.0 6.0 5 5.963 6.0 6.0 6.0 6.0 6.0 6 5.965 6.0 6.0 6.0 6.0 6.0 7 5.9505 6.0 6.0 6.0 6.0 6.0 8 5.9455 6.0 6.0 6.0 6.0 6.0 9 7.903 8.0 8.0 8.0 8.0 8.0 10-11 7.925625 8.0 8.0 8.0 8.0 8.0 12-13 7.915375 8.0 8.0 8.0 8.0 8.0 14-15 9.701875 10.0 10.0 10.0 9.0 10.0 16-17 9.694749999999999 10.0 10.0 10.0 9.0 10.0 18-19 9.672374999999999 10.0 10.0 10.0 9.0 10.0 20-21 9.6265 10.0 10.0 10.0 9.0 10.0 22-23 9.612375 10.0 9.5 10.0 9.0 10.0 24-25 9.550625 10.0 9.5 10.0 9.0 10.0 26-27 9.46425 10.0 9.0 10.0 8.0 10.0 28-29 9.477250000000002 10.0 9.0 10.0 8.0 10.0 30-31 9.515125000000001 10.0 9.0 10.0 8.5 10.0 32-33 9.506125 10.0 9.0 10.0 8.5 10.0 34-35 9.463375 10.0 9.0 10.0 8.5 10.0 36-37 9.35975 10.0 9.0 10.0 8.0 10.0 38-39 9.280625 10.0 9.0 10.0 7.5 10.0 40-41 9.187249999999999 10.0 9.0 10.0 7.0 10.0 42-43 9.065375 10.0 9.0 10.0 7.0 10.0 44-45 8.975999999999999 10.0 9.0 10.0 6.0 10.0 46-47 8.9895 10.0 9.0 10.0 6.0 10.0 48-49 8.8875 10.0 9.0 10.0 5.0 10.0 50-51 8.6915 10.0 8.0 10.0 4.5 10.0 52-53 8.509625 10.0 8.0 10.0 4.0 10.0 54-55 8.3385 10.0 7.5 10.0 4.0 10.0 56-57 8.147375 9.5 6.0 10.0 4.0 10.0 58-59 7.93025 9.0 6.0 10.0 4.0 10.0 60-61 7.67925 9.0 5.0 10.0 4.0 10.0 62-63 7.376875 8.0 4.5 10.0 4.0 10.0 64-65 7.1274999999999995 8.0 4.0 10.0 4.0 10.0 66-67 6.798875000000001 6.5 4.0 9.5 4.0 10.0 68-69 6.442875 6.0 4.0 8.5 4.0 10.0 70-71 6.071732932996207 6.0 4.0 8.0 4.0 10.0 72-73 5.784674204832019 5.0 4.0 8.0 4.0 10.0 74-75 5.461283027840685 5.0 4.0 7.0 4.0 8.5 76-77 4.311052310441834 4.0 3.0 5.5 1.5 8.0 78-79 4.907357554786621 4.0 4.0 6.0 3.5 8.0 80-81 4.74321792447318 4.0 4.0 5.5 4.0 7.0 82-83 4.507612225434007 4.0 4.0 5.0 4.0 6.0 84-85 4.344014254803916 4.0 4.0 5.0 3.5 6.0 86-87 4.202324258858942 4.0 4.0 4.0 3.0 5.5 88-89 4.095510627692416 4.0 4.0 4.0 3.0 5.0 90-91 4.001420860570997 4.0 4.0 4.0 3.0 5.0 92-93 3.9506336595270954 4.0 4.0 4.0 3.0 5.0 94-95 3.8765069978636815 4.0 4.0 4.0 3.0 5.0 96-97 3.8398916740416817 4.0 4.0 4.0 3.0 4.0 98-99 3.8161380195607935 4.0 4.0 4.0 3.0 4.0 100-101 3.3647491237426905 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 3.0 4 18.0 5 264.0 6 1030.0 7 2017.0 8 661.0 9 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.775 12.4 13.025 49.8 2 23.05 21.275 33.15 22.525000000000002 3 24.875 24.4 23.65 27.075 4 27.474999999999998 28.875 18.675 24.975 5 27.900000000000002 31.924999999999997 21.275 18.9 6 22.025 35.575 21.75 20.65 7 20.025000000000002 17.175 40.275 22.525000000000002 8 22.125 21.3 27.725 28.849999999999998 9 20.4 21.55 30.95 27.1 10-11 24.3625 29.7125 21.5 24.425 12-13 22.45 24.025 27.775 25.75 14-15 23.2625 25.474999999999998 25.924999999999997 25.337500000000002 16-17 24.025 25.924999999999997 25.2375 24.8125 18-19 23.962500000000002 25.7 25.5375 24.8 20-21 22.6875 25.8125 25.825 25.674999999999997 22-23 23.3 25.5375 25.937500000000004 25.224999999999998 24-25 22.7625 26.25 25.224999999999998 25.7625 26-27 22.425 25.837500000000002 25.7375 26.0 28-29 23.724999999999998 25.9625 25.2875 25.025 30-31 23.6125 25.5375 25.637500000000003 25.2125 32-33 23.075000000000003 25.5625 25.0375 26.325 34-35 23.9 26.137500000000003 25.3 24.6625 36-37 23.2375 25.074999999999996 25.5 26.187500000000004 38-39 21.9625 26.150000000000002 25.45 26.437500000000004 40-41 23.2625 26.325 25.0375 25.374999999999996 42-43 22.7125 25.974999999999998 25.525 25.7875 44-45 23.3125 26.1 25.074999999999996 25.5125 46-47 22.787499999999998 26.487500000000004 25.324999999999996 25.4 48-49 23.5375 26.325 24.975 25.162499999999998 50-51 22.4375 25.525 26.8625 25.174999999999997 52-53 24.1625 25.2125 25.324999999999996 25.3 54-55 22.5 26.325 25.224999999999998 25.95 56-57 23.0125 26.375 25.637500000000003 24.975 58-59 23.9125 24.625 25.775 25.687500000000004 60-61 23.6875 25.112499999999997 25.637500000000003 25.5625 62-63 23.474999999999998 26.2875 25.412499999999998 24.825 64-65 23.8125 25.45 25.650000000000002 25.087500000000002 66-67 22.45 25.75 25.4625 26.337500000000002 68-69 23.150000000000002 25.7875 25.337500000000002 25.724999999999998 70-71 24.978001257071025 25.895663104965433 24.626021370207415 24.500314267756128 72-73 23.807080554130323 25.94920472036942 24.243201641867625 26.000513083632633 74-75 24.118032786885244 26.754098360655735 24.56393442622951 24.56393442622951 76-77 23.988195615514336 26.011804384485664 24.761101742551993 25.238898257448007 78-79 23.335246842709527 25.45924225028703 25.387485648679682 25.818025258323768 80-81 23.784417106033978 26.23022847100176 25.512595196250732 24.472759226713535 82-83 24.343283582089555 25.64179104477612 26.328358208955223 23.686567164179102 84-85 23.173533466074435 25.961096645734415 25.82325011487211 25.042119773319037 86-87 23.075717197052832 25.70935883367299 25.662329518733344 25.552594450540838 88-89 24.979880894897796 25.140833735715436 25.63978754225012 24.23949782713665 90-91 24.132804757185333 26.362735381565905 25.057813016187648 24.446646845061117 92-93 23.736600306278714 26.57818614939595 25.14888548579207 24.536328058533265 94-95 23.31212442559208 26.193001060445386 26.13997879109226 24.354895722870275 96-97 23.766568483063327 26.859351988217966 25.0 24.374079528718703 98-99 24.17414550315066 26.9620011456941 25.243459996181024 23.620393354974222 100-101 24.565916398713828 26.130760986066452 25.830653804930332 23.47266881028939 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 3.0 28 4.5 29 7.0 30 10.0 31 12.5 32 15.0 33 20.5 34 24.5 35 35.5 36 60.5 37 79.0 38 91.5 39 107.5 40 117.5 41 153.5 42 200.0 43 220.0 44 213.5 45 207.5 46 213.0 47 205.5 48 200.5 49 200.0 50 189.5 51 160.5 52 134.5 53 125.5 54 117.0 55 102.5 56 85.0 57 87.0 58 93.0 59 92.0 60 93.0 61 75.5 62 59.0 63 54.5 64 55.0 65 55.5 66 45.0 67 35.0 68 36.0 69 35.5 70 30.0 71 29.0 72 26.0 73 19.5 74 16.5 75 14.0 76 10.5 77 7.0 78 4.5 79 2.0 80 1.0 81 1.5 82 1.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 45.0 71 41.0 72 32.0 73 45.0 74 49.0 75 210.0 76 40.0 77 38.0 78 32.0 79 39.0 80 30.0 81 32.0 82 34.0 83 50.0 84 37.0 85 36.0 86 41.0 87 39.0 88 47.0 89 38.0 90 36.0 91 45.0 92 51.0 93 50.0 94 68.0 95 59.0 96 40.0 97 46.0 98 63.0 99 44.0 100 421.0 101 2122.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011902 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011902_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.36225 3.0 2.0 3.0 0.0 3.0 2 2.64075 3.0 3.0 3.0 2.0 3.0 3 3.052 3.0 3.0 3.0 2.0 3.0 4 5.96075 6.0 6.0 6.0 6.0 6.0 5 5.951 6.0 6.0 6.0 6.0 6.0 6 5.969 6.0 6.0 6.0 6.0 6.0 7 5.971 6.0 6.0 6.0 6.0 6.0 8 6.1255 6.0 6.0 6.0 6.0 6.0 9 7.90125 8.0 8.0 8.0 8.0 8.0 10-11 7.901 8.0 8.0 8.0 8.0 8.0 12-13 7.9935 8.0 8.0 8.0 8.0 8.0 14-15 9.7025 10.0 10.0 10.0 9.0 10.0 16-17 9.642875 10.0 10.0 10.0 9.0 10.0 18-19 9.64025 10.0 10.0 10.0 9.0 10.0 20-21 9.599875 10.0 9.5 10.0 9.0 10.0 22-23 9.55625 10.0 9.0 10.0 9.0 10.0 24-25 9.500625 10.0 9.0 10.0 8.5 10.0 26-27 9.474875 10.0 9.0 10.0 8.0 10.0 28-29 9.586500000000001 10.0 10.0 10.0 9.0 10.0 30-31 9.563875 10.0 10.0 10.0 9.0 10.0 32-33 9.45825 10.0 9.0 10.0 8.0 10.0 34-35 9.40775 10.0 9.0 10.0 8.0 10.0 36-37 9.33125 10.0 9.0 10.0 8.0 10.0 38-39 9.275375 10.0 9.0 10.0 8.0 10.0 40-41 9.21325 10.0 9.0 10.0 7.0 10.0 42-43 9.150500000000001 10.0 9.0 10.0 7.0 10.0 44-45 8.98875 10.0 9.0 10.0 6.5 10.0 46-47 8.856124999999999 10.0 9.0 10.0 6.0 10.0 48-49 8.675374999999999 10.0 8.0 10.0 5.0 10.0 50-51 7.598125 8.0 7.0 9.0 3.5 9.5 52-53 7.72275 8.5 7.0 9.5 4.0 9.5 54-55 8.24625 9.0 7.5 10.0 4.0 10.0 56-57 8.243 9.5 6.5 10.0 4.0 10.0 58-59 8.01675 9.0 6.0 10.0 4.0 10.0 60-61 7.797000000000001 9.0 5.5 10.0 4.0 10.0 62-63 7.551875 8.0 5.0 10.0 4.0 10.0 64-65 7.254125 8.0 4.0 10.0 4.0 10.0 66-67 6.918 7.5 4.0 10.0 4.0 10.0 68-69 6.55725 6.0 4.0 9.0 4.0 10.0 70-71 6.223754032258064 6.0 4.0 8.0 4.0 10.0 72-73 5.893643499028942 5.0 4.0 8.0 4.0 10.0 74-75 5.5919818787749715 5.0 4.0 7.5 4.0 9.0 76-77 5.265183187482702 4.5 4.0 6.0 4.0 8.0 78-79 4.96282044342732 4.0 4.0 6.0 4.0 8.0 80-81 4.709724585492628 4.0 4.0 5.5 4.0 7.0 82-83 4.468111811081271 4.0 4.0 5.0 3.0 6.0 84-85 4.278211306687269 4.0 4.0 5.0 3.0 6.0 86-87 4.1020906974029945 4.0 4.0 4.0 3.0 5.0 88-89 4.017036034278128 4.0 4.0 4.0 3.0 5.0 90-91 3.930830515589647 4.0 4.0 4.0 3.0 5.0 92-93 3.897469150565962 4.0 4.0 4.0 3.0 5.0 94-95 3.8323112931230803 4.0 4.0 4.0 3.0 5.0 96-97 3.8011694425906044 4.0 4.0 4.0 3.0 4.0 98-99 3.790534231746804 4.0 4.0 4.0 3.0 4.0 100-101 3.196168192862082 3.5 3.0 4.0 1.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 3.0 4 23.0 5 273.0 6 1066.0 7 1999.0 8 629.0 9 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.575 6.275 14.674999999999999 53.474999999999994 2 23.775 20.525 31.275 24.425 3 24.55 26.775 21.375 27.3 4 27.200000000000003 30.049999999999997 16.1 26.650000000000002 5 25.624999999999996 32.15 21.099999999999998 21.125 6 20.150000000000002 34.325 23.95 21.575 7 18.875 18.125 39.574999999999996 23.425 8 20.4 21.775 28.175 29.65 9 20.549999999999997 22.125 31.8 25.525 10-11 23.4625 29.349999999999998 22.525000000000002 24.6625 12-13 22.6375 23.5875 27.537499999999998 26.237500000000004 14-15 24.4375 25.887500000000003 25.5125 24.1625 16-17 23.4625 25.525 25.775 25.2375 18-19 23.5375 25.7 25.8125 24.95 20-21 23.962500000000002 26.1 25.662499999999998 24.275 22-23 23.775 25.324999999999996 24.575 26.325 24-25 22.775000000000002 26.525 25.924999999999997 24.775 26-27 22.8375 26.2125 25.7625 25.1875 28-29 23.7125 25.05 25.8 25.4375 30-31 22.6375 26.2125 26.0625 25.087500000000002 32-33 22.275 24.875 26.400000000000002 26.450000000000003 34-35 22.9625 24.9875 25.887500000000003 26.1625 36-37 23.200000000000003 27.037499999999998 25.162499999999998 24.6 38-39 22.8 26.6125 25.5 25.087500000000002 40-41 22.325 26.650000000000002 25.324999999999996 25.7 42-43 22.8625 24.85 25.412499999999998 26.875 44-45 22.912499999999998 26.1625 25.9625 24.962500000000002 46-47 23.7375 25.2125 25.0375 26.0125 48-49 22.2125 25.662499999999998 26.025 26.1 50-51 22.8875 25.874999999999996 25.8 25.4375 52-53 23.3375 25.8125 25.8125 25.0375 54-55 23.0375 25.9625 25.624999999999996 25.374999999999996 56-57 23.150000000000002 26.0375 25.974999999999998 24.837500000000002 58-59 23.9125 25.174999999999997 25.324999999999996 25.587500000000002 60-61 23.325000000000003 26.0 25.575 25.1 62-63 23.674999999999997 24.875 25.724999999999998 25.724999999999998 64-65 22.9875 26.325 26.025 24.6625 66-67 23.5625 25.05 25.45 25.937500000000004 68-69 23.4125 25.650000000000002 25.7 25.2375 70-71 23.45632530120482 25.702811244979916 25.31375502008032 25.52710843373494 72-73 24.111934577050857 25.274725274725274 25.504727830309225 25.10861231791464 74-75 24.503916449086162 25.56135770234987 24.556135770234988 25.378590078328983 76-77 24.426360725720382 25.533617929562435 24.98665955176094 25.05336179295624 78-79 23.945392491467576 25.515358361774744 25.474402730375427 25.064846416382252 80-81 24.199438202247194 24.84550561797753 24.78932584269663 26.165730337078653 82-83 25.29564464955293 25.785982117104123 24.603403518892414 24.314969714450534 84-85 23.917556346381968 24.747924080664294 27.20937129300119 24.125148279952548 86-87 24.658808933002483 26.023573200992555 24.534739454094293 24.78287841191067 88-89 23.827874116891458 26.07578676942839 25.979447655748235 24.11689145793192 90-91 24.80749916303984 24.790759959825913 25.962504184800807 24.439236692333445 92-93 21.884762235334954 27.125997917389792 26.778896216591463 24.210343630683788 94-95 24.08851804824959 25.267549428623255 25.811717758026482 24.832214765100673 96-97 24.05256141687298 26.242620453247 26.280708436488286 23.424109693391735 98-99 25.25413593781144 26.529798684472794 24.377117799481763 23.838947578234006 100-101 23.11297483966453 27.059694129255057 26.295017266896892 23.53231376418352 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.5 28 3.5 29 3.0 30 6.5 31 10.5 32 16.5 33 23.0 34 34.0 35 49.0 36 59.5 37 71.5 38 89.5 39 126.5 40 145.0 41 145.5 42 165.5 43 195.0 44 214.5 45 217.5 46 216.5 47 220.5 48 212.5 49 192.5 50 172.5 51 145.0 52 133.0 53 126.0 54 110.5 55 110.5 56 104.0 57 84.0 58 77.0 59 79.0 60 78.0 61 75.0 62 80.0 63 74.0 64 59.0 65 50.5 66 42.5 67 39.5 68 33.5 69 29.5 70 26.0 71 21.5 72 24.0 73 24.0 74 17.0 75 11.0 76 11.0 77 8.0 78 4.0 79 2.5 80 1.5 81 1.0 82 0.0 83 1.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 32.0 71 34.0 72 42.0 73 38.0 74 48.0 75 42.0 76 32.0 77 39.0 78 61.0 79 50.0 80 44.0 81 48.0 82 46.0 83 42.0 84 60.0 85 85.0 86 66.0 87 49.0 88 56.0 89 67.0 90 64.0 91 50.0 92 48.0 93 59.0 94 83.0 95 64.0 96 51.0 97 53.0 98 77.0 99 111.0 100 664.0 101 1695.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756250 spots for SRR5011902.sra Written 756250 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra Read 756243 spots for SRR5011902.sra Written 756243 spots for SRR5011902.sra SRR ids: ['SRR5011902.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f0td8hii SRR5011902.sra spots: 15124867 blocks: [[1, 756243], [756244, 1512486], [1512487, 2268729], [2268730, 3024972], [3024973, 3781215], [3781216, 4537458], [4537459, 5293701], [5293702, 6049944], [6049945, 6806187], [6806188, 7562430], [7562431, 8318673], [8318674, 9074916], [9074917, 9831159], [9831160, 10587402], [10587403, 11343645], [11343646, 12099888], [12099889, 12856131], [12856132, 13612374], [13612375, 14368617], [14368618, 15124867]] SRR5011902 file size 3342269 SRR5011902 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011902 SRR5011902_1.fastq SRR5011902_2.fastq Input file: SRR5011902_1.fastq Paired file: SRR5011902_2.fastq trimmed: SRR5011902-trimmed-pair1.fastq, SRR5011902-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:25:53 2024 >> started Sat Dec 7 11:26:11 2024 >> done (17.757s) 15124867 read pairs processed; of these: 65034 ( 0.43%) short read pairs filtered out after trimming by size control 93174 ( 0.62%) empty read pairs filtered out after trimming by size control 14966659 (98.95%) read pairs available; of these: 14966589 (100.00%) trimmed read pairs available after processing 70 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 126 0.00% 19 243 0.00% 20 497 0.00% 21 776 0.01% 22 1313 0.01% 23 2178 0.01% 24 3465 0.02% 25 5240 0.04% 26 7920 0.05% 27 11261 0.08% 28 15704 0.10% 29 20865 0.14% 30 27883 0.19% 31 35525 0.24% 32 43744 0.29% 33 54951 0.37% 34 66593 0.44% 35 78475 0.52% 36 90589 0.61% 37 105060 0.70% 38 118976 0.79% 39 135360 0.90% 40 150402 1.00% 41 165601 1.11% 42 180530 1.21% 43 195386 1.31% 44 211721 1.41% 45 226250 1.51% 46 239603 1.60% 47 256163 1.71% 48 271559 1.81% 49 290688 1.94% 50 311306 2.08% 51 330053 2.21% 52 347678 2.32% 53 368440 2.46% 54 390377 2.61% 55 413773 2.76% 56 436706 2.92% 57 463191 3.09% 58 493037 3.29% 59 524286 3.50% 60 553714 3.70% 61 583442 3.90% 62 613035 4.10% 63 624307 4.17% 64 647652 4.33% 65 649673 4.34% 66 634724 4.24% 67 604784 4.04% 68 561262 3.75% 69 505813 3.38% 70 442061 2.95% 71 371441 2.48% 72 303616 2.03% 73 236205 1.58% 74 176131 1.18% 75 126520 0.85% 76 86700 0.58% 77 57456 0.38% 78 37356 0.25% 79 23603 0.16% 80 14681 0.10% 81 8856 0.06% 82 5015 0.03% 83 2717 0.02% 84 1354 0.01% 85 617 0.00% 86 287 0.00% 87 99 0.00% 88 27 0.00% 89 13 0.00% 90 2 0.00% 91 0 0.00% 92 1 0.00% 93 1 0.00% 14966659 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=12 prefix-density=0.16 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=26.95 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.4 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=9 prefix-density=0.14 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=34.24 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.8 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGCTG SRR5011902 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:26:33 Started mapping on | Dec 07 11:26:34 Finished on | Dec 07 11:26:56 Mapping speed, Million of reads per hour | 2449.09 Number of input reads | 14966659 Average input read length | 117 UNIQUE READS: Uniquely mapped reads number | 14562452 Uniquely mapped reads % | 97.30% Average mapped length | 116.97 Number of splices: Total | 6122891 Number of splices: Annotated (sjdb) | 5864094 Number of splices: GT/AG | 6039717 Number of splices: GC/AG | 71260 Number of splices: AT/AC | 3424 Number of splices: Non-canonical | 8490 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.00% Insertion average length | 1.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177224 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 21702 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.14% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235974 235974 235974 N_multimapping 177224 177224 177224 N_noFeature 563743 7430169 7445340 N_ambiguous 291194 21144 21307 UnstrandedReadsAssigned:13707515 PositiveStrandReadsAssigned:7111139 NegativeStrandReadsAssigned:7095805 Dataset is classified unstranded MeadianReadLen=61 20thPercentileLength=48 echo kmer=43 SRR5011902 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011902-trimmed-pair1.fastq SRR5011902-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,966,659 reads, 14,097,653 reads pseudoaligned [quant] estimated average fragment length: 219.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR5011902.ke.tsv 35125 SRR5011902.se.tsv 88098 total ==> SRR5011902.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 718.048 0 0 PNS24247 1044 825.726 24.7564 3.27598 PNS24249 1928 1709.73 41.7681 2.66936 PNS24246 1044 825.726 24.7564 3.27598 PNS24248 1044 825.726 24.7564 3.27598 PNS24244 1471 1252.73 53.9627 4.70682 PNS24243 293 109.955 1 0.993745 KQK14069 1603 1384.73 966.694 76.2807 KQK14071 474 265.434 61.0895 25.1478 ==> SRR5011902.se.tsv <== BRADI_1g14170v3 1352 BRADI_1g53295v3 38 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 92 BRADI_1g20270v3 3343 BRADI_1g74790v3 118 BRADI_1g09890v3 14 BRADI_1g77505v3 283 BRADI_1g48960v3 0 SRR5011902 completed mapping pipeline successfully