Starting /dee2/code/volunteer_pipeline.sh SRR5011903 current disk space = 1543062786048 free memory = 1600679140 SRR5011903 SRAfilesize 8781461bdfdc3f03e747dff45a975b6f SRR5011903.sra SRR5011903.sra file validated SRR5011903 is paired end SRR5011903 is conventional basespace SRR5011903 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011903_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.778 3.0 3.0 3.0 2.0 3.0 2 2.89025 3.0 3.0 3.0 3.0 3.0 3 2.8985 3.0 3.0 3.0 3.0 3.0 4 5.98125 6.0 6.0 6.0 6.0 6.0 5 5.95975 6.0 6.0 6.0 6.0 6.0 6 5.9565 6.0 6.0 6.0 6.0 6.0 7 5.94775 6.0 6.0 6.0 6.0 6.0 8 5.9555 6.0 6.0 6.0 6.0 6.0 9 7.906 8.0 8.0 8.0 8.0 8.0 10-11 7.929875 8.0 8.0 8.0 8.0 8.0 12-13 7.911 8.0 8.0 8.0 8.0 8.0 14-15 9.705874999999999 10.0 10.0 10.0 9.0 10.0 16-17 9.692875 10.0 10.0 10.0 9.0 10.0 18-19 9.665 10.0 10.0 10.0 9.0 10.0 20-21 9.63675 10.0 10.0 10.0 9.0 10.0 22-23 9.5915 10.0 10.0 10.0 9.0 10.0 24-25 9.523 10.0 9.0 10.0 9.0 10.0 26-27 9.465875 10.0 9.0 10.0 8.0 10.0 28-29 9.452874999999999 10.0 9.0 10.0 8.0 10.0 30-31 9.492875 10.0 9.0 10.0 8.5 10.0 32-33 9.465250000000001 10.0 9.0 10.0 8.0 10.0 34-35 9.4285 10.0 9.0 10.0 8.0 10.0 36-37 9.370125 10.0 9.0 10.0 8.0 10.0 38-39 9.264875 10.0 9.0 10.0 7.5 10.0 40-41 9.176874999999999 10.0 9.0 10.0 7.0 10.0 42-43 9.0565 10.0 9.0 10.0 7.0 10.0 44-45 9.020375 10.0 9.0 10.0 6.5 10.0 46-47 9.049375 10.0 9.0 10.0 6.0 10.0 48-49 8.932 10.0 9.0 10.0 5.5 10.0 50-51 8.769874999999999 10.0 8.5 10.0 4.5 10.0 52-53 8.613 10.0 8.0 10.0 4.0 10.0 54-55 8.485375000000001 10.0 8.0 10.0 4.0 10.0 56-57 8.28025 10.0 7.0 10.0 4.0 10.0 58-59 8.085125 9.0 6.0 10.0 4.0 10.0 60-61 7.815875 9.0 5.5 10.0 4.0 10.0 62-63 7.544499999999999 8.0 5.0 10.0 4.0 10.0 64-65 7.270375 8.0 4.0 10.0 4.0 10.0 66-67 6.942875 7.5 4.0 9.5 4.0 10.0 68-69 6.556 6.0 4.0 9.0 4.0 10.0 70-71 6.178168697903511 6.0 4.0 8.0 4.0 10.0 72-73 5.916413133627444 5.5 4.0 8.0 4.0 10.0 74-75 5.555601292062027 5.0 4.0 7.5 4.0 9.0 76-77 4.419261022665278 4.0 3.5 5.5 2.0 8.0 78-79 4.974693883427255 4.0 4.0 6.0 3.5 8.0 80-81 4.778363461448439 4.0 4.0 5.5 4.0 7.0 82-83 4.558332596747771 4.0 4.0 5.0 4.0 6.0 84-85 4.340361572154605 4.0 4.0 5.0 4.0 6.0 86-87 4.206671281645569 4.0 4.0 4.5 3.5 5.5 88-89 4.071858837808228 4.0 4.0 4.0 3.0 5.0 90-91 3.9901635440825287 4.0 4.0 4.0 3.0 5.0 92-93 3.936627553977351 4.0 4.0 4.0 3.0 5.0 94-95 3.8648058386786515 4.0 4.0 4.0 3.0 5.0 96-97 3.841463293713935 4.0 4.0 4.0 3.0 4.5 98-99 3.8407396535563345 4.0 4.0 4.0 3.0 4.0 100-101 3.3769034630794206 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 2.0 4 22.0 5 251.0 6 947.0 7 2086.0 8 674.0 9 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.625 13.125 11.125 52.125 2 23.575 22.2 33.300000000000004 20.925 3 24.65 24.4 22.85 28.1 4 27.175 30.325000000000003 17.599999999999998 24.9 5 26.924999999999997 32.324999999999996 21.55 19.2 6 19.675 35.75 24.525 20.05 7 18.65 16.175 41.199999999999996 23.974999999999998 8 19.875 21.75 27.950000000000003 30.425 9 21.4 21.575 29.675 27.35 10-11 24.337500000000002 30.312499999999996 21.087500000000002 24.2625 12-13 21.8125 23.4125 28.3875 26.387500000000003 14-15 23.25 25.5625 26.187500000000004 25.0 16-17 23.3875 26.25 25.1875 25.174999999999997 18-19 23.625 25.637500000000003 24.875 25.8625 20-21 22.4625 27.0 26.3625 24.175 22-23 23.4625 24.5375 26.337500000000002 25.662499999999998 24-25 22.9375 26.5625 25.8125 24.6875 26-27 23.1875 26.0625 25.937500000000004 24.8125 28-29 23.35 25.374999999999996 26.187500000000004 25.087500000000002 30-31 23.5625 25.7625 25.374999999999996 25.3 32-33 22.25 25.924999999999997 26.150000000000002 25.674999999999997 34-35 23.724999999999998 25.650000000000002 25.575 25.05 36-37 22.6875 26.2625 25.637500000000003 25.412499999999998 38-39 23.150000000000002 25.9875 25.887500000000003 24.975 40-41 23.1375 24.725 25.95 26.187500000000004 42-43 23.1625 24.3625 26.2125 26.2625 44-45 23.125 25.912499999999998 25.662499999999998 25.3 46-47 23.4375 26.1125 25.525 24.925 48-49 23.0875 25.1875 25.575 26.150000000000002 50-51 23.0875 24.762500000000003 27.1375 25.0125 52-53 23.599999999999998 25.825 25.387500000000003 25.1875 54-55 24.2375 24.9375 25.337500000000002 25.4875 56-57 23.2125 25.937500000000004 25.525 25.324999999999996 58-59 23.45 26.025 25.6125 24.9125 60-61 23.4125 25.8 25.900000000000002 24.887500000000003 62-63 22.575 25.7875 26.437500000000004 25.2 64-65 22.25 26.174999999999997 26.174999999999997 25.4 66-67 23.45 24.7 25.8625 25.9875 68-69 23.549999999999997 25.900000000000002 25.387500000000003 25.162499999999998 70-71 23.972860912174895 25.744440256313606 25.354944088453323 24.927754743058173 72-73 23.082851637764932 26.39691714836224 25.459216441875405 25.06101477199743 74-75 23.67042179722295 25.530521351847003 26.52606759235001 24.272989258580036 76-77 23.366197183098592 26.380281690140844 25.971830985915496 24.28169014084507 78-79 23.94951957550552 25.94292270184999 24.982073712892586 25.125484009751904 80-81 23.074674850211895 25.953529153879877 25.573578839690192 25.398217156218035 82-83 23.661845832712093 26.19651110779782 25.82376621440286 24.317876845087223 84-85 23.815365741450698 26.92838521699126 24.6434595920871 24.612789449470938 86-87 23.742138364779876 25.896226415094343 26.242138364779876 24.11949685534591 88-89 23.53130532753903 27.007886689200067 24.271688395300178 25.18911958796073 90-91 23.25082508250825 27.244224422442244 25.660066006600662 23.844884488448844 92-93 23.43167175313666 27.263479145473042 24.7371990505256 24.5676500508647 94-95 23.321616871704745 26.203866432337435 26.942003514938488 23.532513181019333 96-97 22.364568081991216 27.763543191800878 26.024890190336748 23.846998535871155 98-99 23.19116527037319 26.16146230007616 26.75171363290175 23.895658796648895 100-101 23.386243386243386 26.158730158730158 25.693121693121697 24.761904761904763 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 3.5 28 4.5 29 3.5 30 5.5 31 10.0 32 16.5 33 24.5 34 27.0 35 35.0 36 52.0 37 72.5 38 94.0 39 128.0 40 152.5 41 170.0 42 208.0 43 225.5 44 227.5 45 217.0 46 210.0 47 220.5 48 209.5 49 176.5 50 150.0 51 140.5 52 139.5 53 129.0 54 117.0 55 104.5 56 94.5 57 93.5 58 87.0 59 83.5 60 79.5 61 68.0 62 56.5 63 57.0 64 48.5 65 42.5 66 45.5 67 42.5 68 41.0 69 33.0 70 26.5 71 26.0 72 25.5 73 26.0 74 20.0 75 10.0 76 7.5 77 8.0 78 6.0 79 2.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 41.0 71 48.0 72 37.0 73 34.0 74 46.0 75 219.0 76 50.0 77 25.0 78 27.0 79 37.0 80 29.0 81 34.0 82 39.0 83 51.0 84 45.0 85 38.0 86 40.0 87 31.0 88 45.0 89 38.0 90 32.0 91 46.0 92 38.0 93 54.0 94 62.0 95 55.0 96 54.0 97 52.0 98 54.0 99 38.0 100 397.0 101 2164.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.025 0.0 0.0 0.0 0.025 72-73 0.025 0.0 0.0 0.0 0.025 74-75 0.025 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.07500000000000001 0.0 0.0 0.0 0.025 86-87 0.125 0.0 0.0 0.0 0.025 88-89 0.125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011903 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011903_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.31975 3.0 2.0 3.0 0.0 3.0 2 2.5875 3.0 2.0 3.0 0.0 3.0 3 3.061 3.0 3.0 3.0 2.0 4.0 4 5.94525 6.0 6.0 6.0 6.0 6.0 5 5.95675 6.0 6.0 6.0 6.0 6.0 6 5.95775 6.0 6.0 6.0 6.0 6.0 7 5.96375 6.0 6.0 6.0 6.0 6.0 8 6.12325 6.0 6.0 6.0 6.0 6.0 9 7.9005 8.0 8.0 8.0 8.0 8.0 10-11 7.906874999999999 8.0 8.0 8.0 8.0 8.0 12-13 7.9825 8.0 8.0 8.0 8.0 8.0 14-15 9.694125 10.0 10.0 10.0 9.0 10.0 16-17 9.65075 10.0 10.0 10.0 9.0 10.0 18-19 9.617375 10.0 10.0 10.0 9.0 10.0 20-21 9.600249999999999 10.0 10.0 10.0 9.0 10.0 22-23 9.567250000000001 10.0 9.0 10.0 9.0 10.0 24-25 9.495249999999999 10.0 9.0 10.0 8.5 10.0 26-27 9.508375000000001 10.0 9.0 10.0 8.5 10.0 28-29 9.561875 10.0 10.0 10.0 9.0 10.0 30-31 9.542 10.0 9.5 10.0 9.0 10.0 32-33 9.473125 10.0 9.0 10.0 8.0 10.0 34-35 9.427375000000001 10.0 9.0 10.0 8.0 10.0 36-37 9.3575 10.0 9.0 10.0 8.0 10.0 38-39 9.29325 10.0 9.0 10.0 7.5 10.0 40-41 9.217125 10.0 9.0 10.0 7.0 10.0 42-43 9.121 10.0 9.0 10.0 7.0 10.0 44-45 8.98325 10.0 9.0 10.0 6.5 10.0 46-47 8.883125 10.0 9.0 10.0 6.0 10.0 48-49 8.68875 10.0 8.0 10.0 5.0 10.0 50-51 7.59675 8.0 7.0 9.0 3.5 9.5 52-53 7.73225 8.5 7.0 9.0 4.0 9.5 54-55 8.244250000000001 9.0 7.0 10.0 4.0 10.0 56-57 8.251999999999999 9.0 7.0 10.0 4.0 10.0 58-59 8.082125 9.0 6.0 10.0 4.0 10.0 60-61 7.858625 9.0 6.0 10.0 4.0 10.0 62-63 7.580500000000001 8.0 5.0 10.0 4.0 10.0 64-65 7.272 8.0 4.5 10.0 4.0 10.0 66-67 6.9605 7.5 4.0 10.0 4.0 10.0 68-69 6.605625 6.0 4.0 9.0 4.0 10.0 70-71 6.228373295884878 6.0 4.0 8.0 4.0 10.0 72-73 5.887620596282936 5.0 4.0 8.0 4.0 10.0 74-75 5.5527790484708 5.0 4.0 7.0 4.0 8.5 76-77 5.230658616662279 4.5 4.0 6.0 4.0 8.0 78-79 4.939709922959514 4.0 4.0 6.0 4.0 8.0 80-81 4.665956117612917 4.0 4.0 5.5 3.0 6.5 82-83 4.465524307841223 4.0 4.0 5.0 3.0 6.0 84-85 4.27132438093114 4.0 4.0 5.0 3.0 6.0 86-87 4.127933768417902 4.0 4.0 4.0 3.0 5.0 88-89 4.046684960226272 4.0 4.0 4.0 3.0 5.0 90-91 3.9542505112602866 4.0 4.0 4.0 3.0 5.0 92-93 3.886306557299533 4.0 4.0 4.0 3.0 5.0 94-95 3.8082081385259396 4.0 4.0 4.0 3.0 4.5 96-97 3.787413130210092 4.0 4.0 4.0 3.0 4.0 98-99 3.7855693257136442 4.0 4.0 4.0 3.0 4.0 100-101 3.2301838295352443 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 4.0 4 29.0 5 256.0 6 999.0 7 2121.0 8 585.0 9 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.450000000000003 6.65 14.174999999999999 52.725 2 23.474999999999998 21.075 33.1 22.35 3 24.85 26.625 23.575 24.95 4 27.375 29.325000000000003 17.525 25.775 5 26.474999999999998 31.874999999999996 20.5 21.15 6 18.85 32.550000000000004 26.5 22.1 7 19.5 17.724999999999998 38.6 24.175 8 20.075000000000003 22.75 29.275000000000002 27.900000000000002 9 21.075 21.45 31.374999999999996 26.1 10-11 24.474999999999998 29.3375 21.575 24.6125 12-13 23.0625 23.9 27.462500000000002 25.575 14-15 23.0625 26.187500000000004 25.6125 25.137500000000003 16-17 23.8625 26.25 25.374999999999996 24.5125 18-19 23.474999999999998 25.9625 25.587500000000002 24.975 20-21 24.087500000000002 24.95 26.3625 24.6 22-23 23.65 25.7625 25.7125 24.875 24-25 23.1875 25.974999999999998 25.974999999999998 24.8625 26-27 23.4875 26.5625 25.5 24.45 28-29 23.525 25.974999999999998 25.6 24.9 30-31 22.6375 26.387500000000003 25.4625 25.5125 32-33 22.7375 26.3625 25.8625 25.0375 34-35 23.075000000000003 26.637499999999996 25.1 25.1875 36-37 22.75 26.1125 26.275 24.8625 38-39 23.1625 25.9875 25.7375 25.112499999999997 40-41 23.0625 26.2625 25.724999999999998 24.95 42-43 22.075 26.55 26.125 25.25 44-45 23.0875 26.424999999999997 25.587500000000002 24.9 46-47 23.1625 26.1 26.087500000000002 24.65 48-49 22.05 26.325 26.3125 25.3125 50-51 22.425 26.5125 25.4625 25.6 52-53 22.7 26.087500000000002 26.05 25.162499999999998 54-55 22.825 25.4875 26.387500000000003 25.3 56-57 23.6625 25.5375 26.075 24.725 58-59 24.2875 25.8625 26.325 23.525 60-61 23.625 24.875 25.7125 25.7875 62-63 23.7625 25.9875 26.200000000000003 24.05 64-65 22.7125 26.3625 25.324999999999996 25.6 66-67 24.0 25.874999999999996 25.7 24.425 68-69 24.1625 26.5625 24.099999999999998 25.174999999999997 70-71 24.192940585353597 26.46652430599171 24.90893103881422 24.431604069840475 72-73 24.17948717948718 25.576923076923073 24.76923076923077 25.474358974358974 74-75 24.68586387434555 25.157068062827225 26.2434554973822 23.913612565445025 76-77 23.485254691689008 26.86327077747989 25.160857908847184 24.490616621983914 78-79 24.42769019876628 25.8670322138451 26.0726525017135 23.632625085675123 80-81 25.01056784556855 26.997322812455966 23.925602367197406 24.066506974778076 82-83 23.41477603257708 27.065154159395 24.360093077370564 25.15997673065736 84-85 22.65625 26.592548076923077 26.547475961538463 24.20372596153846 86-87 23.862566677125823 26.529651710072166 25.274552871038598 24.333228741763413 88-89 23.575255723331708 25.945770417275533 26.79006332196785 23.688910537424906 90-91 24.19327589119784 26.33890859942558 25.76448724446697 23.70332826490961 92-93 24.152394267738554 26.23208668297798 25.777700104858443 23.837818944425027 94-95 23.26350606394708 26.75486953325983 25.744211686879826 24.23741271591327 96-97 23.733075435203094 26.905222437137333 26.266924564796906 23.09477756286267 98-99 24.299065420560748 26.1072734660707 26.391710686712717 23.20195042665583 100-101 23.290064902646034 27.309036445332 25.361957064403395 24.038941587618574 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.5 28 5.0 29 6.0 30 4.5 31 7.5 32 15.5 33 21.5 34 30.0 35 44.0 36 58.5 37 76.0 38 107.0 39 126.5 40 142.5 41 172.0 42 191.5 43 204.0 44 227.0 45 236.0 46 226.5 47 217.0 48 201.0 49 187.5 50 163.5 51 142.5 52 132.5 53 123.0 54 103.5 55 86.5 56 94.5 57 98.5 58 84.5 59 78.0 60 78.0 61 69.5 62 62.0 63 64.5 64 60.0 65 43.5 66 37.5 67 38.5 68 30.0 69 25.0 70 23.5 71 23.5 72 24.5 73 22.0 74 15.0 75 12.0 76 11.0 77 6.5 78 4.0 79 2.0 80 2.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 39.0 71 37.0 72 48.0 73 31.0 74 50.0 75 46.0 76 38.0 77 45.0 78 37.0 79 55.0 80 51.0 81 53.0 82 64.0 83 45.0 84 66.0 85 75.0 86 66.0 87 44.0 88 61.0 89 60.0 90 59.0 91 39.0 92 60.0 93 72.0 94 76.0 95 67.0 96 62.0 97 59.0 98 68.0 99 117.0 100 614.0 101 1696.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654412 spots for SRR5011903.sra Written 654412 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra Read 654409 spots for SRR5011903.sra Written 654409 spots for SRR5011903.sra SRR ids: ['SRR5011903.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1vol76gm SRR5011903.sra spots: 13088183 blocks: [[1, 654409], [654410, 1308818], [1308819, 1963227], [1963228, 2617636], [2617637, 3272045], [3272046, 3926454], [3926455, 4580863], [4580864, 5235272], [5235273, 5889681], [5889682, 6544090], [6544091, 7198499], [7198500, 7852908], [7852909, 8507317], [8507318, 9161726], [9161727, 9816135], [9816136, 10470544], [10470545, 11124953], [11124954, 11779362], [11779363, 12433771], [12433772, 13088183]] SRR5011903 file size 2895150 SRR5011903 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011903 SRR5011903_1.fastq SRR5011903_2.fastq Input file: SRR5011903_1.fastq Paired file: SRR5011903_2.fastq trimmed: SRR5011903-trimmed-pair1.fastq, SRR5011903-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:28:40 2024 >> started Sat Dec 7 11:28:58 2024 >> done (17.283s) 13088183 read pairs processed; of these: 51341 ( 0.39%) short read pairs filtered out after trimming by size control 78490 ( 0.60%) empty read pairs filtered out after trimming by size control 12958352 (99.01%) read pairs available; of these: 12958308 (100.00%) trimmed read pairs available after processing 44 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 92 0.00% 19 172 0.00% 20 386 0.00% 21 578 0.00% 22 1012 0.01% 23 1645 0.01% 24 2611 0.02% 25 4080 0.03% 26 6071 0.05% 27 8470 0.07% 28 12108 0.09% 29 16063 0.12% 30 21714 0.17% 31 27556 0.21% 32 34059 0.26% 33 42768 0.33% 34 52256 0.40% 35 61254 0.47% 36 71458 0.55% 37 83167 0.64% 38 94661 0.73% 39 107672 0.83% 40 120572 0.93% 41 133076 1.03% 42 146292 1.13% 43 159229 1.23% 44 172205 1.33% 45 185045 1.43% 46 196489 1.52% 47 212405 1.64% 48 227017 1.75% 49 242020 1.87% 50 260432 2.01% 51 277345 2.14% 52 296035 2.28% 53 313461 2.42% 54 333043 2.57% 55 355112 2.74% 56 377124 2.91% 57 400469 3.09% 58 428028 3.30% 59 456503 3.52% 60 482793 3.73% 61 512416 3.95% 62 537009 4.14% 63 548723 4.23% 64 572015 4.41% 65 575745 4.44% 66 564706 4.36% 67 538981 4.16% 68 501769 3.87% 69 452455 3.49% 70 395789 3.05% 71 336534 2.60% 72 276595 2.13% 73 215947 1.67% 74 161771 1.25% 75 117522 0.91% 76 81073 0.63% 77 53766 0.41% 78 35498 0.27% 79 22325 0.17% 80 14240 0.11% 81 8606 0.07% 82 5069 0.04% 83 2781 0.02% 84 1409 0.01% 85 624 0.00% 86 279 0.00% 87 102 0.00% 88 36 0.00% 89 10 0.00% 90 8 0.00% 91 1 0.00% 12958352 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=15 prefix-density=0.15 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=19.53 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.7 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGCTG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=10 prefix-density=0.15 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=31.67 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.9 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGCT SRR5011903 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:29:23 Started mapping on | Dec 07 11:29:23 Finished on | Dec 07 11:29:45 Mapping speed, Million of reads per hour | 2120.46 Number of input reads | 12958352 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 12605999 Uniquely mapped reads % | 97.28% Average mapped length | 117.82 Number of splices: Total | 5302117 Number of splices: Annotated (sjdb) | 5074343 Number of splices: GT/AG | 5230102 Number of splices: GC/AG | 61759 Number of splices: AT/AC | 2952 Number of splices: Non-canonical | 7304 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.00% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 153504 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 20733 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 206020 206020 206020 N_multimapping 153504 153504 153504 N_noFeature 521327 6440220 6468231 N_ambiguous 253577 18308 18004 UnstrandedReadsAssigned:11831095 PositiveStrandReadsAssigned:6147471 NegativeStrandReadsAssigned:6119764 Dataset is classified unstranded MeadianReadLen=61 20thPercentileLength=49 echo kmer=45 SRR5011903 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011903-trimmed-pair1.fastq SRR5011903-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,958,352 reads, 12,173,215 reads pseudoaligned [quant] estimated average fragment length: 211.81 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52973 SRR5011903.ke.tsv 35125 SRR5011903.se.tsv 88098 total ==> SRR5011903.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 725.431 0 0 PNS24247 1044 833.19 22.4864 3.45273 PNS24249 1928 1717.19 32.8608 2.4482 PNS24246 1044 833.19 22.4864 3.45273 PNS24248 1044 833.19 22.4864 3.45273 PNS24244 1471 1260.19 56.6801 5.75416 PNS24243 293 112.542 4 4.54708 KQK14069 1603 1392.19 1120.31 102.95 KQK14071 474 271.518 62.0237 29.2245 ==> SRR5011903.se.tsv <== BRADI_1g14170v3 1516 BRADI_1g53295v3 29 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 65 BRADI_1g20270v3 2671 BRADI_1g74790v3 117 BRADI_1g09890v3 5 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR5011903 completed mapping pipeline successfully