Starting /dee2/code/volunteer_pipeline.sh SRR5011904 current disk space = 1543057235968 free memory = 1598201860 SRR5011904 SRAfilesize 30fea7445699f57052310eb49aec9e91 SRR5011904.sra SRR5011904.sra file validated SRR5011904 is paired end SRR5011904 is conventional basespace SRR5011904 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011904_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.80025 3.0 3.0 3.0 2.0 3.0 2 2.9025 3.0 3.0 3.0 3.0 3.0 3 2.92625 3.0 3.0 3.0 3.0 3.0 4 5.98075 6.0 6.0 6.0 6.0 6.0 5 5.9565 6.0 6.0 6.0 6.0 6.0 6 5.96475 6.0 6.0 6.0 6.0 6.0 7 5.956 6.0 6.0 6.0 6.0 6.0 8 5.965 6.0 6.0 6.0 6.0 6.0 9 7.9285 8.0 8.0 8.0 8.0 8.0 10-11 7.929 8.0 8.0 8.0 8.0 8.0 12-13 7.90225 8.0 8.0 8.0 8.0 8.0 14-15 9.691500000000001 10.0 10.0 10.0 9.0 10.0 16-17 9.665875 10.0 10.0 10.0 9.0 10.0 18-19 9.636375 10.0 10.0 10.0 9.0 10.0 20-21 9.604500000000002 10.0 10.0 10.0 9.0 10.0 22-23 9.57775 10.0 9.0 10.0 9.0 10.0 24-25 9.531 10.0 9.0 10.0 9.0 10.0 26-27 9.4755 10.0 9.0 10.0 8.0 10.0 28-29 9.468625 10.0 9.0 10.0 8.0 10.0 30-31 9.510375 10.0 9.0 10.0 8.5 10.0 32-33 9.473500000000001 10.0 9.0 10.0 8.0 10.0 34-35 9.413125 10.0 9.0 10.0 8.0 10.0 36-37 9.3555 10.0 9.0 10.0 8.0 10.0 38-39 9.27775 10.0 9.0 10.0 7.5 10.0 40-41 9.17625 10.0 9.0 10.0 7.0 10.0 42-43 9.067499999999999 10.0 9.0 10.0 7.0 10.0 44-45 8.989125 10.0 9.0 10.0 6.0 10.0 46-47 9.039750000000002 10.0 9.0 10.0 6.0 10.0 48-49 8.94375 10.0 9.0 10.0 6.0 10.0 50-51 8.789 10.0 8.5 10.0 5.0 10.0 52-53 8.623999999999999 10.0 8.0 10.0 4.0 10.0 54-55 8.4855 10.0 8.0 10.0 4.0 10.0 56-57 8.315375 10.0 7.5 10.0 4.0 10.0 58-59 8.089749999999999 9.0 6.0 10.0 4.0 10.0 60-61 7.829000000000001 9.0 6.0 10.0 4.0 10.0 62-63 7.538875 8.0 5.0 10.0 4.0 10.0 64-65 7.267875 8.0 4.5 10.0 4.0 10.0 66-67 6.947125 7.5 4.0 10.0 4.0 10.0 68-69 6.56925 6.0 4.0 9.0 4.0 10.0 70-71 6.189782828282828 6.0 4.0 8.0 4.0 10.0 72-73 5.93476314745296 5.5 4.0 8.0 4.0 10.0 74-75 5.5852431653168395 5.0 4.0 7.5 4.0 9.0 76-77 4.418307227742478 4.0 3.5 5.5 2.0 8.0 78-79 5.003374156810233 4.0 4.0 6.0 3.5 8.0 80-81 4.827414899042317 4.0 4.0 6.0 4.0 7.0 82-83 4.579712229383176 4.0 4.0 5.0 4.0 6.0 84-85 4.366688532899984 4.0 4.0 5.0 4.0 6.0 86-87 4.22257234528663 4.0 4.0 4.5 3.0 5.5 88-89 4.0983366998712265 4.0 4.0 4.0 3.0 5.0 90-91 4.000912507558209 4.0 4.0 4.0 3.0 5.0 92-93 3.9506473268553775 4.0 4.0 4.0 3.0 5.0 94-95 3.8627513861958915 4.0 4.0 4.0 3.0 5.0 96-97 3.8352099499418317 4.0 4.0 4.0 3.0 4.0 98-99 3.8283017079674524 4.0 4.0 4.0 3.0 4.0 100-101 3.406467583497053 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 5.0 4 18.0 5 247.0 6 930.0 7 2081.0 8 709.0 9 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.525 11.799999999999999 11.475 51.2 2 22.1 21.075 33.900000000000006 22.925 3 24.0 23.724999999999998 22.95 29.325000000000003 4 27.400000000000002 29.599999999999998 18.625 24.375 5 27.450000000000003 32.725 20.974999999999998 18.85 6 19.900000000000002 36.25 23.525 20.325 7 18.025 17.95 41.05 22.975 8 21.025 21.9 29.125 27.950000000000003 9 21.775 21.3 30.85 26.075 10-11 25.0 30.125 21.4375 23.4375 12-13 22.0875 24.425 28.8875 24.6 14-15 23.65 25.8125 26.187500000000004 24.349999999999998 16-17 23.8375 26.1125 25.4 24.65 18-19 23.8375 26.275 25.3 24.587500000000002 20-21 22.8875 26.787499999999998 25.6 24.725 22-23 22.9875 26.450000000000003 25.0375 25.525 24-25 22.45 26.924999999999997 25.7875 24.837500000000002 26-27 22.6 26.525 26.5 24.375 28-29 23.962500000000002 25.587500000000002 25.35 25.1 30-31 23.0625 26.775 25.1 25.0625 32-33 23.724999999999998 26.075 25.4375 24.762500000000003 34-35 22.787499999999998 26.85 25.624999999999996 24.7375 36-37 23.45 26.7625 24.45 25.337500000000002 38-39 22.4625 26.700000000000003 25.7625 25.074999999999996 40-41 23.425 26.3125 25.2625 25.0 42-43 23.1 26.5 25.650000000000002 24.75 44-45 22.875 27.1375 25.7125 24.275 46-47 23.375 26.35 24.962500000000002 25.3125 48-49 23.5875 25.674999999999997 25.95 24.7875 50-51 23.1 25.85 25.900000000000002 25.15 52-53 23.849999999999998 25.2 26.3125 24.637500000000003 54-55 22.525000000000002 26.887499999999996 25.4625 25.124999999999996 56-57 22.2 26.650000000000002 26.200000000000003 24.95 58-59 23.5125 25.974999999999998 25.687500000000004 24.825 60-61 23.150000000000002 25.674999999999997 26.1625 25.0125 62-63 23.6625 26.375 25.837500000000002 24.125 64-65 24.05 25.9875 25.724999999999998 24.2375 66-67 23.3125 25.4 26.1 25.1875 68-69 23.5875 26.400000000000002 25.387500000000003 24.625 70-71 23.969849246231156 26.834170854271356 24.183417085427138 25.01256281407035 72-73 23.53470437017995 26.066838046272494 25.53984575835476 24.858611825192803 74-75 24.077720887488514 26.020743074701326 25.28554549035053 24.615990547459628 76-77 23.73310810810811 25.267454954954953 26.632882882882885 24.366554054054053 78-79 23.598566308243726 26.46594982078853 26.150537634408604 23.78494623655914 80-81 24.360660529007745 26.5234546251644 24.90135905304691 24.214525792780943 82-83 24.27271371027898 25.97344472624198 25.22751007011786 24.52633149336118 84-85 22.664835164835164 25.97680097680098 25.686813186813183 25.67155067155067 86-87 24.083034181364134 25.92476978304979 25.955985640705475 24.0362103948806 88-89 23.872 27.52 24.976000000000003 23.632 90-91 23.11615663047055 27.1964461994077 25.748601513655807 23.938795656465942 92-93 23.760013635588887 26.26555309357423 26.487131412987896 23.487301857848987 94-95 23.854185099982303 26.50858255176075 26.47319058573704 23.164041762519908 96-97 23.37566721884778 25.105834713786123 26.559911651021533 24.95858641634456 98-99 23.2748760960732 27.12542889820816 26.49637819290888 23.10331681280976 100-101 23.768736616702355 26.466809421841543 25.781584582441113 23.98286937901499 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.0 29 4.0 30 8.5 31 14.5 32 20.5 33 23.5 34 29.5 35 47.0 36 60.5 37 73.5 38 99.5 39 128.0 40 149.5 41 179.0 42 204.5 43 202.5 44 208.0 45 204.5 46 212.5 47 237.5 48 209.5 49 176.0 50 166.0 51 159.5 52 154.5 53 130.0 54 118.0 55 109.5 56 87.0 57 84.0 58 90.5 59 75.5 60 63.5 61 63.5 62 56.5 63 48.5 64 43.0 65 41.5 66 39.0 67 39.0 68 35.5 69 29.0 70 24.5 71 22.5 72 23.5 73 18.5 74 14.0 75 15.5 76 11.5 77 4.5 78 1.0 79 0.5 80 0.5 81 1.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 40.0 71 46.0 72 48.0 73 39.0 74 37.0 75 217.0 76 42.0 77 29.0 78 29.0 79 35.0 80 33.0 81 35.0 82 37.0 83 41.0 84 32.0 85 39.0 86 35.0 87 41.0 88 40.0 89 43.0 90 46.0 91 57.0 92 51.0 93 54.0 94 57.0 95 53.0 96 55.0 97 37.0 98 58.0 99 49.0 100 420.0 101 2125.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011904 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011904_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.375 3.0 2.0 3.0 0.0 3.0 2 2.6255 3.0 2.0 3.0 2.0 3.0 3 3.08525 3.0 3.0 3.0 2.0 4.0 4 5.94775 6.0 6.0 6.0 6.0 6.0 5 5.94025 6.0 6.0 6.0 6.0 6.0 6 5.95825 6.0 6.0 6.0 6.0 6.0 7 5.96275 6.0 6.0 6.0 6.0 6.0 8 6.12575 6.0 6.0 6.0 6.0 6.0 9 7.89075 8.0 8.0 8.0 8.0 8.0 10-11 7.905875 8.0 8.0 8.0 8.0 8.0 12-13 7.9795 8.0 8.0 8.0 8.0 8.0 14-15 9.678 10.0 10.0 10.0 9.0 10.0 16-17 9.665375000000001 10.0 10.0 10.0 9.0 10.0 18-19 9.636875 10.0 10.0 10.0 9.0 10.0 20-21 9.624749999999999 10.0 10.0 10.0 9.0 10.0 22-23 9.560875 10.0 9.0 10.0 9.0 10.0 24-25 9.501750000000001 10.0 9.0 10.0 8.5 10.0 26-27 9.505375 10.0 9.0 10.0 8.5 10.0 28-29 9.587 10.0 10.0 10.0 9.0 10.0 30-31 9.560875 10.0 10.0 10.0 9.0 10.0 32-33 9.463625 10.0 9.0 10.0 8.0 10.0 34-35 9.417 10.0 9.0 10.0 8.0 10.0 36-37 9.36275 10.0 9.0 10.0 8.0 10.0 38-39 9.32075 10.0 9.0 10.0 8.0 10.0 40-41 9.23225 10.0 9.0 10.0 7.0 10.0 42-43 9.15225 10.0 9.0 10.0 7.0 10.0 44-45 9.03975 10.0 9.0 10.0 6.5 10.0 46-47 8.9185 10.0 9.0 10.0 6.0 10.0 48-49 8.726875 10.0 8.0 10.0 5.5 10.0 50-51 7.6576249999999995 8.0 7.0 9.0 4.0 9.5 52-53 7.79575 8.5 7.0 9.5 4.0 9.5 54-55 8.292125 9.0 7.5 10.0 4.0 10.0 56-57 8.296125 9.0 7.0 10.0 4.0 10.0 58-59 8.132875 9.0 6.0 10.0 4.0 10.0 60-61 7.925375 9.0 6.0 10.0 4.0 10.0 62-63 7.659625 8.5 5.5 10.0 4.0 10.0 64-65 7.33375 8.0 4.5 10.0 4.0 10.0 66-67 7.008875 7.5 4.0 10.0 4.0 10.0 68-69 6.638249999999999 6.0 4.0 9.0 4.0 10.0 70-71 6.269954717457114 6.0 4.0 8.0 4.0 10.0 72-73 5.958120921349421 5.5 4.0 8.0 4.0 10.0 74-75 5.606553806082092 5.0 4.0 7.5 4.0 8.5 76-77 5.2725846933195175 4.5 4.0 6.0 4.0 8.0 78-79 4.976224458224954 4.0 4.0 6.0 4.0 8.0 80-81 4.705313857219175 4.0 4.0 5.5 4.0 6.5 82-83 4.455427962426528 4.0 4.0 5.0 3.0 6.0 84-85 4.2617309264067575 4.0 4.0 5.0 3.0 6.0 86-87 4.0932773968737655 4.0 4.0 4.0 3.0 5.0 88-89 4.0347542125884965 4.0 4.0 4.0 3.0 5.0 90-91 3.96463751050854 4.0 4.0 4.0 3.0 5.0 92-93 3.8974176293977325 4.0 4.0 4.0 3.0 5.0 94-95 3.833187831623629 4.0 4.0 4.0 3.0 4.5 96-97 3.800392297444346 4.0 4.0 4.0 3.0 4.0 98-99 3.7749503749874487 4.0 4.0 4.0 3.0 4.0 100-101 3.2930556766501584 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 2.0 4 18.0 5 252.0 6 1009.0 7 2071.0 8 641.0 9 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.35 6.4 13.5 52.75 2 23.225 20.9 32.275 23.599999999999998 3 26.1 24.625 23.05 26.224999999999998 4 27.575 29.675 18.2 24.55 5 26.724999999999998 32.65 21.25 19.375 6 20.474999999999998 34.1 24.8 20.625 7 19.45 18.325 38.375 23.849999999999998 8 20.549999999999997 23.425 28.849999999999998 27.175 9 20.75 23.549999999999997 30.65 25.05 10-11 25.124999999999996 29.5 21.087500000000002 24.2875 12-13 22.3375 25.2625 27.462500000000002 24.9375 14-15 23.0625 26.1625 26.3125 24.462500000000002 16-17 23.625 26.474999999999998 25.6125 24.2875 18-19 23.25 27.5125 24.75 24.4875 20-21 23.2875 27.0 24.762500000000003 24.95 22-23 23.1625 25.874999999999996 25.775 25.1875 24-25 22.0125 26.787499999999998 25.5125 25.687500000000004 26-27 23.3875 26.674999999999997 25.637500000000003 24.3 28-29 23.7 25.4625 25.637500000000003 25.2 30-31 23.225 26.05 25.9875 24.7375 32-33 22.15 26.974999999999998 26.25 24.625 34-35 23.525 25.7375 25.75 24.9875 36-37 22.125 26.7125 25.624999999999996 25.5375 38-39 22.4875 27.725 24.975 24.8125 40-41 22.575 26.4125 25.974999999999998 25.0375 42-43 22.225 26.400000000000002 26.35 25.025 44-45 22.875 27.2625 25.25 24.6125 46-47 22.875 27.0 25.6125 24.5125 48-49 21.8125 26.325 25.900000000000002 25.9625 50-51 22.875 26.325 26.137500000000003 24.6625 52-53 23.0875 26.0375 26.25 24.625 54-55 23.1375 26.8 25.7375 24.325 56-57 23.5625 26.2875 25.937500000000004 24.212500000000002 58-59 22.787499999999998 26.625 25.7125 24.875 60-61 23.4375 26.387500000000003 25.074999999999996 25.1 62-63 22.912499999999998 25.8125 25.75 25.525 64-65 23.225 25.662499999999998 25.95 25.162499999999998 66-67 23.474999999999998 26.674999999999997 25.337500000000002 24.5125 68-69 23.8625 26.85 25.887500000000003 23.400000000000002 70-71 23.681567051732795 26.10497237569061 25.313912606730288 24.89954796584631 72-73 24.437052200614126 24.84646878198567 25.95957011258956 24.756908904810647 74-75 23.23971260613978 25.721750489875898 25.956890920966693 25.081645983017637 76-77 24.3293991416309 26.287553648068666 24.557403433476395 24.825643776824037 78-79 23.975240715268225 26.038514442916096 26.052269601100413 23.93397524071527 80-81 23.4407996621146 25.974940166126988 25.580740532169504 25.003519639588905 82-83 24.102489866821077 26.476548928778225 25.839606253618992 23.5813549507817 84-85 23.20491680407735 26.45780242842153 26.038075251086795 24.29920551641433 86-87 22.848200312989047 27.198748043818465 25.44600938967136 24.507042253521128 88-89 23.685907771686555 26.426959045469207 26.330216059335697 23.556917123508544 90-91 23.41064575337894 26.247288503253795 25.946938094443517 24.395127648923744 92-93 22.705397043657612 26.67583361980062 26.16019250601581 24.458576830525956 94-95 24.134839519454903 26.071364532902997 26.878249955173033 22.91554599246907 96-97 22.81097331830139 26.738068395340097 25.49793310785419 24.95302517850432 98-99 23.678522303006485 26.861858911377478 26.46885439182551 22.990764393790528 100-101 24.203821656050955 26.090151886330233 25.477707006369428 24.228319451249387 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 3.5 28 3.5 29 4.5 30 6.5 31 9.5 32 17.5 33 28.5 34 37.5 35 45.0 36 60.5 37 81.0 38 108.0 39 121.0 40 148.0 41 180.5 42 187.5 43 202.0 44 223.5 45 238.0 46 230.5 47 219.0 48 202.0 49 188.5 50 174.5 51 160.0 52 144.0 53 119.5 54 107.5 55 105.0 56 103.5 57 95.5 58 83.0 59 75.0 60 73.0 61 60.0 62 46.5 63 49.0 64 52.5 65 46.0 66 37.5 67 32.5 68 33.0 69 26.0 70 18.0 71 19.5 72 17.5 73 11.5 74 10.5 75 14.0 76 9.5 77 4.0 78 4.0 79 2.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 36.0 71 40.0 72 32.0 73 39.0 74 51.0 75 46.0 76 56.0 77 46.0 78 38.0 79 42.0 80 45.0 81 52.0 82 46.0 83 59.0 84 73.0 85 77.0 86 54.0 87 41.0 88 52.0 89 54.0 90 49.0 91 37.0 92 52.0 93 56.0 94 77.0 95 56.0 96 66.0 97 53.0 98 61.0 99 131.0 100 684.0 101 1699.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Read 708190 spots for SRR5011904.sra Written 708190 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Read 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra Written 708176 spots for SRR5011904.sra SRR ids: ['SRR5011904.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8vg784k1 SRR5011904.sra spots: 14163534 blocks: [[1, 708176], [708177, 1416352], [1416353, 2124528], [2124529, 2832704], [2832705, 3540880], [3540881, 4249056], [4249057, 4957232], [4957233, 5665408], [5665409, 6373584], [6373585, 7081760], [7081761, 7789936], [7789937, 8498112], [8498113, 9206288], [9206289, 9914464], [9914465, 10622640], [10622641, 11330816], [11330817, 12038992], [12038993, 12747168], [12747169, 13455344], [13455345, 14163534]] SRR5011904 file size 3133621 SRR5011904 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011904 SRR5011904_1.fastq SRR5011904_2.fastq Input file: SRR5011904_1.fastq Paired file: SRR5011904_2.fastq trimmed: SRR5011904-trimmed-pair1.fastq, SRR5011904-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:30:35 2024 >> started Sat Dec 7 11:30:52 2024 >> done (16.813s) 14163534 read pairs processed; of these: 55775 ( 0.39%) short read pairs filtered out after trimming by size control 86567 ( 0.61%) empty read pairs filtered out after trimming by size control 14021192 (99.00%) read pairs available; of these: 14021148 (100.00%) trimmed read pairs available after processing 44 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 152 0.00% 19 243 0.00% 20 439 0.00% 21 649 0.00% 22 1050 0.01% 23 1599 0.01% 24 2596 0.02% 25 4011 0.03% 26 6197 0.04% 27 8791 0.06% 28 11811 0.08% 29 15984 0.11% 30 21748 0.16% 31 28109 0.20% 32 34794 0.25% 33 43553 0.31% 34 53700 0.38% 35 63451 0.45% 36 74167 0.53% 37 86402 0.62% 38 98373 0.70% 39 112695 0.80% 40 126668 0.90% 41 140803 1.00% 42 155833 1.11% 43 169632 1.21% 44 184448 1.32% 45 198481 1.42% 46 211754 1.51% 47 228480 1.63% 48 244385 1.74% 49 262603 1.87% 50 283820 2.02% 51 302671 2.16% 52 321193 2.29% 53 341375 2.43% 54 361999 2.58% 55 385767 2.75% 56 408489 2.91% 57 434575 3.10% 58 464590 3.31% 59 494504 3.53% 60 524091 3.74% 61 553396 3.95% 62 581343 4.15% 63 593492 4.23% 64 620809 4.43% 65 625069 4.46% 66 612615 4.37% 67 584707 4.17% 68 545496 3.89% 69 492067 3.51% 70 432264 3.08% 71 368731 2.63% 72 301571 2.15% 73 237401 1.69% 74 177767 1.27% 75 128430 0.92% 76 88756 0.63% 77 59602 0.43% 78 39135 0.28% 79 24770 0.18% 80 15768 0.11% 81 9687 0.07% 82 5679 0.04% 83 3164 0.02% 84 1529 0.01% 85 752 0.01% 86 348 0.00% 87 110 0.00% 88 40 0.00% 89 14 0.00% 90 4 0.00% 91 0 0.00% 92 0 0.00% 93 1 0.00% 14021192 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=13 prefix-density=0.17 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=7.59 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.5 sequence=CTTGGCCTTCGCTGCTGTCTTGCGCATGGTCACGCGGGCCTCGCCAAAAAGAGCTGACGATGGCAAGTTCTTTACGGCCTTGCCGGC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=11 prefix-density=0.15 prefix-fanout=2.4 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=9.83 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.7 sequence=CTTGGCCTTCGCTGCTGTCTTGCGCATGGTCACGCGGGCCTCGCCAAAAAGAGCTGACGATGGC SRR5011904 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:31:13 Started mapping on | Dec 07 11:31:14 Finished on | Dec 07 11:31:32 Mapping speed, Million of reads per hour | 2804.24 Number of input reads | 14021192 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 13652695 Uniquely mapped reads % | 97.37% Average mapped length | 118.00 Number of splices: Total | 5722609 Number of splices: Annotated (sjdb) | 5468611 Number of splices: GT/AG | 5645182 Number of splices: GC/AG | 66624 Number of splices: AT/AC | 3105 Number of splices: Non-canonical | 7698 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.00% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162637 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 20296 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 213058 213058 213058 N_multimapping 162637 162637 162637 N_noFeature 601624 6975722 7038815 N_ambiguous 278102 20144 19795 UnstrandedReadsAssigned:12772969 PositiveStrandReadsAssigned:6656829 NegativeStrandReadsAssigned:6594085 Dataset is classified unstranded MeadianReadLen=62 20thPercentileLength=49 echo kmer=45 SRR5011904 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011904-trimmed-pair1.fastq SRR5011904-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,021,192 reads, 13,140,358 reads pseudoaligned [quant] estimated average fragment length: 214.284 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR5011904.ke.tsv 35125 SRR5011904.se.tsv 88098 total ==> SRR5011904.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.964 0 0 PNS24247 1044 830.716 30.8352 4.40101 PNS24249 1928 1714.72 25.9316 1.79307 PNS24246 1044 830.716 30.8352 4.40101 PNS24248 1044 830.716 30.8352 4.40101 PNS24244 1471 1257.72 32.5629 3.06973 PNS24243 293 112.13 0 0 KQK14069 1603 1389.72 1658.71 141.516 KQK14071 474 269.843 115.746 50.8575 ==> SRR5011904.se.tsv <== BRADI_1g14170v3 2544 BRADI_1g53295v3 35 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 2349 BRADI_1g74790v3 112 BRADI_1g09890v3 7 BRADI_1g77505v3 255 BRADI_1g48960v3 0 SRR5011904 completed mapping pipeline successfully