Starting /dee2/code/volunteer_pipeline.sh SRR5011905 current disk space = 1543078060032 free memory = 1602887852 SRR5011905 SRAfilesize afe1139c4a6b5d9828f95aadeb29d61e SRR5011905.sra SRR5011905.sra file validated SRR5011905 is paired end SRR5011905 is conventional basespace SRR5011905 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.77725 3.0 3.0 3.0 2.0 3.0 2 2.9035 3.0 3.0 3.0 3.0 3.0 3 2.92375 3.0 3.0 3.0 3.0 3.0 4 5.99525 6.0 6.0 6.0 6.0 6.0 5 5.95625 6.0 6.0 6.0 6.0 6.0 6 5.97 6.0 6.0 6.0 6.0 6.0 7 5.959 6.0 6.0 6.0 6.0 6.0 8 5.9585 6.0 6.0 6.0 6.0 6.0 9 7.90125 8.0 8.0 8.0 8.0 8.0 10-11 7.918375 8.0 8.0 8.0 8.0 8.0 12-13 7.90475 8.0 8.0 8.0 8.0 8.0 14-15 9.683250000000001 10.0 10.0 10.0 9.0 10.0 16-17 9.67525 10.0 10.0 10.0 9.0 10.0 18-19 9.666374999999999 10.0 10.0 10.0 9.0 10.0 20-21 9.620999999999999 10.0 10.0 10.0 9.0 10.0 22-23 9.5675 10.0 9.0 10.0 9.0 10.0 24-25 9.502375 10.0 9.0 10.0 8.5 10.0 26-27 9.444375 10.0 9.0 10.0 8.0 10.0 28-29 9.441749999999999 10.0 9.0 10.0 8.0 10.0 30-31 9.479624999999999 10.0 9.0 10.0 8.0 10.0 32-33 9.45475 10.0 9.0 10.0 8.0 10.0 34-35 9.400625 10.0 9.0 10.0 8.0 10.0 36-37 9.314125 10.0 9.0 10.0 8.0 10.0 38-39 9.2375 10.0 9.0 10.0 7.5 10.0 40-41 9.136500000000002 10.0 9.0 10.0 7.0 10.0 42-43 9.048 10.0 9.0 10.0 7.0 10.0 44-45 8.959499999999998 10.0 9.0 10.0 6.0 10.0 46-47 8.963625 10.0 9.0 10.0 6.0 10.0 48-49 8.879000000000001 10.0 9.0 10.0 5.0 10.0 50-51 8.70575 10.0 8.0 10.0 4.0 10.0 52-53 8.536125 10.0 8.0 10.0 4.0 10.0 54-55 8.38425 10.0 7.5 10.0 4.0 10.0 56-57 8.169875000000001 9.5 6.0 10.0 4.0 10.0 58-59 7.94 9.0 6.0 10.0 4.0 10.0 60-61 7.7044999999999995 9.0 5.0 10.0 4.0 10.0 62-63 7.4251249999999995 8.0 4.5 10.0 4.0 10.0 64-65 7.153625 8.0 4.0 10.0 4.0 10.0 66-67 6.853125 7.5 4.0 9.5 4.0 10.0 68-69 6.472250000000001 6.0 4.0 9.0 4.0 10.0 70-71 6.138814561136479 6.0 4.0 8.0 4.0 10.0 72-73 5.8384660610123 5.0 4.0 8.0 4.0 10.0 74-75 5.530131918640033 5.0 4.0 7.0 4.0 9.0 76-77 4.390509473815277 4.0 3.5 5.5 1.5 8.0 78-79 4.949488900209419 4.0 4.0 6.0 3.5 8.0 80-81 4.805149966014006 4.0 4.0 5.5 4.0 7.5 82-83 4.568540214385087 4.0 4.0 5.0 4.0 6.0 84-85 4.378554556258161 4.0 4.0 5.0 3.5 6.0 86-87 4.215651856894756 4.0 4.0 4.5 3.0 5.5 88-89 4.106088244193083 4.0 4.0 4.0 3.0 5.0 90-91 4.006083904226736 4.0 4.0 4.0 3.0 5.0 92-93 3.9443022600016153 4.0 4.0 4.0 3.0 5.0 94-95 3.875544642025882 4.0 4.0 4.0 3.0 5.0 96-97 3.839189314559306 4.0 4.0 4.0 3.0 4.5 98-99 3.8567816334340854 4.0 4.0 4.0 3.0 4.5 100-101 3.406745793045449 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 4.0 4 22.0 5 260.0 6 987.0 7 2035.0 8 682.0 9 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.55 12.225 11.600000000000001 50.625 2 23.474999999999998 21.125 33.25 22.15 3 24.75 24.7 24.075 26.474999999999998 4 27.55 30.025000000000002 16.8 25.624999999999996 5 26.8 31.85 21.224999999999998 20.125 6 21.075 35.85 21.5 21.575 7 18.425 15.9 40.949999999999996 24.725 8 20.05 21.825 29.2 28.925 9 20.8 21.6 31.075000000000003 26.525 10-11 24.5625 29.9375 21.5 24.0 12-13 22.3 24.0125 27.975 25.7125 14-15 22.8125 25.387500000000003 27.437499999999996 24.3625 16-17 23.1125 25.5625 25.387500000000003 25.937500000000004 18-19 23.5125 25.55 25.0 25.937500000000004 20-21 24.3125 25.337500000000002 25.087500000000002 25.2625 22-23 23.1875 26.55 24.9 25.362499999999997 24-25 23.6375 25.7625 25.874999999999996 24.725 26-27 23.962500000000002 25.05 25.674999999999997 25.3125 28-29 22.95 26.3625 25.174999999999997 25.5125 30-31 23.0375 25.8625 26.174999999999997 24.925 32-33 23.25 26.8125 25.5375 24.4 34-35 22.900000000000002 26.200000000000003 25.4 25.5 36-37 23.125 25.974999999999998 25.275 25.624999999999996 38-39 24.3625 25.7875 25.087500000000002 24.762500000000003 40-41 23.875 25.7 25.662499999999998 24.762500000000003 42-43 23.25 26.525 25.1 25.124999999999996 44-45 24.2875 25.412499999999998 25.7625 24.5375 46-47 24.0625 25.5375 24.9 25.5 48-49 24.025 25.637500000000003 24.675 25.662499999999998 50-51 22.5 25.5375 26.150000000000002 25.8125 52-53 23.849999999999998 26.125 25.0375 24.9875 54-55 23.1 26.25 25.2625 25.387500000000003 56-57 22.575 26.85 25.525 25.05 58-59 23.799999999999997 24.9375 25.874999999999996 25.387500000000003 60-61 23.599999999999998 25.087500000000002 26.400000000000002 24.9125 62-63 22.9375 26.3125 26.3125 24.4375 64-65 23.3875 25.587500000000002 26.200000000000003 24.825 66-67 24.587500000000002 25.7 25.637500000000003 24.075 68-69 24.05 26.25 25.0 24.7 70-71 24.37673130193906 25.11961722488038 25.54772097708386 24.955930496096702 72-73 23.806443265622978 25.954198473282442 25.4496053823263 24.789752878768276 74-75 23.920839420905832 25.674060300172663 25.63421437109842 24.770885907823086 76-77 23.368631940469374 25.48654836863194 25.772753291356608 25.37206639954207 78-79 23.873414029458946 26.17762870059793 25.229692285255943 24.719264984687182 80-81 23.58882947118241 27.36185383244207 24.70291146761735 24.34640522875817 82-83 24.28767332012799 26.19229011122962 25.5828127380771 23.93722383056529 84-85 23.70602032838155 26.020328381548087 25.06645817044566 25.207193119624705 86-87 23.85981757081133 26.548247719635143 25.39606337013922 24.195871339414307 88-89 24.011160347940258 26.440177252584935 25.160019694731663 24.388642704743148 90-91 24.035058149334233 26.192482723748522 26.243047362211357 23.52941176470588 92-93 23.595113438045377 25.37521815008726 26.212914485165793 24.81675392670157 94-95 23.660553757641136 25.88996763754045 26.06975907946782 24.379719525350595 96-97 23.122787404509037 25.414570523569964 26.774734488541085 24.687907583379914 98-99 23.580701414454563 26.157721371827165 26.157721371827165 24.103855841891107 100-101 22.91621327529924 26.61588683351469 26.4417845484222 24.026115342763873 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 3.5 27 3.5 28 3.0 29 4.5 30 6.5 31 9.0 32 10.5 33 19.5 34 35.5 35 41.5 36 51.0 37 77.5 38 101.5 39 117.5 40 149.5 41 174.5 42 189.5 43 211.0 44 209.5 45 211.5 46 222.5 47 212.0 48 197.0 49 189.0 50 170.5 51 144.0 52 140.0 53 129.0 54 116.5 55 117.0 56 102.0 57 83.5 58 75.0 59 71.0 60 67.5 61 70.5 62 63.0 63 54.5 64 57.5 65 56.5 66 52.5 67 52.5 68 44.5 69 34.0 70 25.0 71 17.5 72 17.0 73 21.5 74 26.0 75 16.5 76 7.0 77 7.0 78 5.5 79 3.0 80 1.5 81 1.5 82 2.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 58.0 71 52.0 72 51.0 73 47.0 74 55.0 75 222.0 76 42.0 77 32.0 78 25.0 79 33.0 80 34.0 81 41.0 82 53.0 83 45.0 84 25.0 85 42.0 86 37.0 87 37.0 88 45.0 89 30.0 90 55.0 91 50.0 92 48.0 93 39.0 94 42.0 95 47.0 96 59.0 97 41.0 98 65.0 99 46.0 100 409.0 101 2093.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011905 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.33325 3.0 2.0 3.0 0.0 3.0 2 2.60925 3.0 2.0 3.0 0.0 3.0 3 3.035 3.0 3.0 3.0 2.0 3.0 4 5.95225 6.0 6.0 6.0 6.0 6.0 5 5.94875 6.0 6.0 6.0 6.0 6.0 6 5.966 6.0 6.0 6.0 6.0 6.0 7 5.974 6.0 6.0 6.0 6.0 6.0 8 6.1155 6.0 6.0 6.0 6.0 6.0 9 7.89425 8.0 8.0 8.0 8.0 8.0 10-11 7.907125 8.0 8.0 8.0 8.0 8.0 12-13 7.9807500000000005 8.0 8.0 8.0 8.0 8.0 14-15 9.707125000000001 10.0 10.0 10.0 9.0 10.0 16-17 9.681125 10.0 10.0 10.0 9.0 10.0 18-19 9.6395 10.0 10.0 10.0 9.0 10.0 20-21 9.6115 10.0 10.0 10.0 9.0 10.0 22-23 9.559375 10.0 9.0 10.0 9.0 10.0 24-25 9.48575 10.0 9.0 10.0 8.5 10.0 26-27 9.512625 10.0 9.5 10.0 8.5 10.0 28-29 9.572 10.0 10.0 10.0 9.0 10.0 30-31 9.5475 10.0 10.0 10.0 9.0 10.0 32-33 9.4725 10.0 9.0 10.0 8.0 10.0 34-35 9.41175 10.0 9.0 10.0 8.0 10.0 36-37 9.354 10.0 9.0 10.0 8.0 10.0 38-39 9.308875 10.0 9.0 10.0 8.0 10.0 40-41 9.251875 10.0 9.0 10.0 7.5 10.0 42-43 9.13975 10.0 9.0 10.0 7.0 10.0 44-45 8.998125 10.0 9.0 10.0 6.5 10.0 46-47 8.898875 10.0 9.0 10.0 6.0 10.0 48-49 8.675249999999998 10.0 8.0 10.0 5.5 10.0 50-51 7.561375 8.0 7.0 9.0 3.5 9.5 52-53 7.7041249999999994 8.5 7.0 9.5 4.0 9.5 54-55 8.196125 9.0 7.0 10.0 4.0 10.0 56-57 8.194624999999998 9.0 6.5 10.0 4.0 10.0 58-59 8.03025 9.0 6.0 10.0 4.0 10.0 60-61 7.786625 9.0 5.5 10.0 4.0 10.0 62-63 7.520625 8.0 5.0 10.0 4.0 10.0 64-65 7.21475 8.0 4.0 10.0 4.0 10.0 66-67 6.893625 7.5 4.0 10.0 4.0 10.0 68-69 6.545125 6.0 4.0 9.0 4.0 10.0 70-71 6.189482480463827 6.0 4.0 8.0 4.0 10.0 72-73 5.851350795316975 5.0 4.0 8.0 4.0 10.0 74-75 5.557550260068738 5.0 4.0 7.0 4.0 8.5 76-77 5.246641069316601 4.5 4.0 6.0 4.0 8.0 78-79 4.9591582096247775 4.0 4.0 6.0 4.0 8.0 80-81 4.703138485715531 4.0 4.0 5.0 3.5 7.0 82-83 4.496387410687099 4.0 4.0 5.0 3.0 6.0 84-85 4.286232555343318 4.0 4.0 5.0 3.0 6.0 86-87 4.087433814830885 4.0 4.0 4.0 3.0 5.0 88-89 4.017000464893075 4.0 4.0 4.0 3.0 5.0 90-91 3.946700053678436 4.0 4.0 4.0 3.0 5.0 92-93 3.902123871560497 4.0 4.0 4.0 3.0 5.0 94-95 3.813060641599841 4.0 4.0 4.0 3.0 4.5 96-97 3.7780360015457477 4.0 4.0 4.0 3.0 4.0 98-99 3.780298432317625 4.0 4.0 4.0 3.0 4.0 100-101 3.241420503744952 3.5 3.0 4.0 1.5 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 1.0 4 22.0 5 237.0 6 1081.0 7 2025.0 8 621.0 9 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.875 5.55 14.825 52.75 2 23.7 21.0 32.550000000000004 22.75 3 24.375 25.025 24.15 26.450000000000003 4 27.125 29.299999999999997 16.85 26.724999999999998 5 26.474999999999998 32.725 21.2 19.6 6 21.0 34.0 24.025 20.974999999999998 7 20.1 17.1 39.800000000000004 23.0 8 21.275 22.45 27.125 29.15 9 21.15 22.55 31.324999999999996 24.975 10-11 24.975 28.975 21.6 24.45 12-13 22.075 24.025 27.575 26.325 14-15 22.112499999999997 26.924999999999997 26.0 24.962500000000002 16-17 23.6875 25.624999999999996 24.9875 25.7 18-19 23.575 25.95 25.337500000000002 25.137500000000003 20-21 23.962500000000002 26.05 25.337500000000002 24.65 22-23 23.325000000000003 26.337500000000002 25.2875 25.05 24-25 23.1125 25.724999999999998 26.1 25.0625 26-27 22.7125 26.25 25.7375 25.3 28-29 22.75 25.3 25.75 26.200000000000003 30-31 22.3125 26.8375 25.5625 25.2875 32-33 22.787499999999998 26.275 26.150000000000002 24.7875 34-35 23.1625 26.775 25.162499999999998 24.9 36-37 23.075000000000003 26.0 25.650000000000002 25.275 38-39 22.4375 26.6125 25.337500000000002 25.6125 40-41 22.787499999999998 26.137500000000003 25.5125 25.5625 42-43 22.875 26.137500000000003 25.4375 25.55 44-45 23.0875 26.224999999999998 26.275 24.4125 46-47 23.5375 26.2625 24.474999999999998 25.724999999999998 48-49 22.7375 25.674999999999997 26.0375 25.55 50-51 22.537499999999998 25.2125 26.35 25.900000000000002 52-53 23.925 25.924999999999997 24.725 25.424999999999997 54-55 23.150000000000002 26.05 25.162499999999998 25.637500000000003 56-57 23.7625 25.637500000000003 25.7 24.9 58-59 23.1625 25.7625 24.725 26.35 60-61 22.650000000000002 25.9625 26.0375 25.35 62-63 23.1625 25.874999999999996 25.900000000000002 25.0625 64-65 22.775000000000002 25.974999999999998 26.087500000000002 25.162499999999998 66-67 23.2625 26.275 25.662499999999998 24.8 68-69 22.625 25.687500000000004 26.0375 25.650000000000002 70-71 23.88602987322706 25.417346554537467 25.39224300238484 25.304380569850633 72-73 23.945821620240224 25.74750830564784 25.28750319447994 25.019166879631992 74-75 24.585238406270413 25.486610058785107 25.460483344219465 24.467668190725018 76-77 24.764974482943863 25.369325812516784 25.315605694332525 24.55009401020682 78-79 24.15412235879022 25.714680292777242 25.742300787184092 24.388896561248448 80-81 23.223422399090392 26.733939738487777 26.264923251847637 23.77771461057419 82-83 23.628383321141186 25.822970007315288 25.940014630577906 24.60863204096562 84-85 24.038026256224537 25.637543383129625 24.97359287762185 25.35083748302399 86-87 24.66835123183828 26.058117498420717 24.810486418193303 24.463044851547693 88-89 23.482245131729666 26.755031909671086 26.165930289641633 23.596792668957615 90-91 23.939342307036974 26.103254387459536 25.592094053501448 24.365309252002046 92-93 23.963296276689604 26.027880712899243 26.698429504146816 23.310393506264337 94-95 24.820475050635242 25.4280979561775 25.299208248941262 24.452218744245997 96-97 22.252321981424146 26.025541795665635 26.683436532507738 25.038699690402478 98-99 23.33603896103896 26.623376623376622 26.0349025974026 24.005681818181817 100-101 23.56592997268438 27.166625279364293 25.13037000248324 24.13707474546809 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 2.5 27 4.0 28 2.5 29 8.0 30 13.0 31 13.0 32 16.0 33 23.0 34 28.0 35 38.0 36 55.5 37 69.5 38 88.5 39 120.5 40 139.5 41 168.5 42 192.0 43 194.0 44 227.0 45 245.5 46 228.5 47 213.5 48 205.0 49 182.5 50 160.0 51 148.0 52 134.5 53 134.5 54 126.5 55 99.5 56 89.5 57 85.5 58 78.0 59 82.5 60 79.0 61 62.5 62 63.5 63 70.0 64 62.5 65 51.5 66 46.0 67 39.5 68 36.0 69 36.0 70 28.5 71 22.0 72 17.0 73 15.5 74 15.0 75 12.0 76 8.5 77 6.5 78 7.0 79 6.0 80 3.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 33.0 71 33.0 72 42.0 73 41.0 74 47.0 75 50.0 76 62.0 77 47.0 78 49.0 79 47.0 80 62.0 81 43.0 82 53.0 83 46.0 84 63.0 85 89.0 86 54.0 87 59.0 88 49.0 89 69.0 90 55.0 91 49.0 92 49.0 93 51.0 94 85.0 95 63.0 96 52.0 97 56.0 98 76.0 99 100.0 100 625.0 101 1701.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700095 spots for SRR5011905.sra Written 700095 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra Read 700077 spots for SRR5011905.sra Written 700077 spots for SRR5011905.sra SRR ids: ['SRR5011905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yuqm76bu SRR5011905.sra spots: 14001558 blocks: [[1, 700077], [700078, 1400154], [1400155, 2100231], [2100232, 2800308], [2800309, 3500385], [3500386, 4200462], [4200463, 4900539], [4900540, 5600616], [5600617, 6300693], [6300694, 7000770], [7000771, 7700847], [7700848, 8400924], [8400925, 9101001], [9101002, 9801078], [9801079, 10501155], [10501156, 11201232], [11201233, 11901309], [11901310, 12601386], [12601387, 13301463], [13301464, 14001558]] SRR5011905 file size 3092710 SRR5011905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011905 SRR5011905_1.fastq SRR5011905_2.fastq Input file: SRR5011905_1.fastq Paired file: SRR5011905_2.fastq trimmed: SRR5011905-trimmed-pair1.fastq, SRR5011905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:30:13 2024 >> started Sat Dec 7 11:30:33 2024 >> done (19.705s) 14001558 read pairs processed; of these: 57298 ( 0.41%) short read pairs filtered out after trimming by size control 86739 ( 0.62%) empty read pairs filtered out after trimming by size control 13857521 (98.97%) read pairs available; of these: 13857467 (100.00%) trimmed read pairs available after processing 54 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 99 0.00% 19 190 0.00% 20 445 0.00% 21 700 0.01% 22 1150 0.01% 23 1845 0.01% 24 2979 0.02% 25 4638 0.03% 26 6836 0.05% 27 9847 0.07% 28 13543 0.10% 29 18369 0.13% 30 24139 0.17% 31 30837 0.22% 32 38542 0.28% 33 48113 0.35% 34 58843 0.42% 35 69092 0.50% 36 80137 0.58% 37 93464 0.67% 38 106162 0.77% 39 120351 0.87% 40 135046 0.97% 41 149095 1.08% 42 163117 1.18% 43 176585 1.27% 44 191212 1.38% 45 205077 1.48% 46 217860 1.57% 47 232929 1.68% 48 248673 1.79% 49 265092 1.91% 50 285340 2.06% 51 302304 2.18% 52 321563 2.32% 53 339510 2.45% 54 359885 2.60% 55 381502 2.75% 56 404336 2.92% 57 428881 3.09% 58 458380 3.31% 59 486906 3.51% 60 515328 3.72% 61 543984 3.93% 62 570145 4.11% 63 581982 4.20% 64 604155 4.36% 65 608426 4.39% 66 595368 4.30% 67 565423 4.08% 68 527510 3.81% 69 474970 3.43% 70 414847 2.99% 71 350360 2.53% 72 286374 2.07% 73 223458 1.61% 74 166521 1.20% 75 119376 0.86% 76 82421 0.59% 77 54229 0.39% 78 35189 0.25% 79 22132 0.16% 80 13702 0.10% 81 8326 0.06% 82 4705 0.03% 83 2663 0.02% 84 1300 0.01% 85 605 0.00% 86 259 0.00% 87 108 0.00% 88 33 0.00% 89 8 0.00% 13857521 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=12 prefix-density=0.18 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=21.50 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.8 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=14 prefix-density=0.16 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=22.72 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTCTTCATCTTCTTCACTCTCCAGTTCAGAACTTCAGTTCAGCTCAAGCAAGCAATCAGTCTGAGATGGCTCGTGCTCAGGTGATGTTCATGGTGGC SRR5011905 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:30:55 Started mapping on | Dec 07 11:30:55 Finished on | Dec 07 11:31:21 Mapping speed, Million of reads per hour | 1918.73 Number of input reads | 13857521 Average input read length | 117 UNIQUE READS: Uniquely mapped reads number | 13471404 Uniquely mapped reads % | 97.21% Average mapped length | 117.31 Number of splices: Total | 5700241 Number of splices: Annotated (sjdb) | 5460129 Number of splices: GT/AG | 5622205 Number of splices: GC/AG | 66762 Number of splices: AT/AC | 3222 Number of splices: Non-canonical | 8052 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.00% Insertion average length | 1.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 165410 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 24338 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 228755 228755 228755 N_multimapping 165410 165410 165410 N_noFeature 539401 6868406 6910337 N_ambiguous 269838 19442 20025 UnstrandedReadsAssigned:12662165 PositiveStrandReadsAssigned:6583556 NegativeStrandReadsAssigned:6541042 Dataset is classified unstranded MeadianReadLen=61 20thPercentileLength=48 echo kmer=43 SRR5011905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011905-trimmed-pair1.fastq SRR5011905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,857,521 reads, 13,030,040 reads pseudoaligned [quant] estimated average fragment length: 218.324 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 SRR5011905.ke.tsv 35125 SRR5011905.se.tsv 88098 total ==> SRR5011905.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 718.991 0 0 PNS24247 1044 826.676 24.8881 3.57731 PNS24249 1928 1710.68 35.9113 2.49439 PNS24246 1044 826.676 24.8881 3.57731 PNS24248 1044 826.676 24.8881 3.57731 PNS24244 1471 1253.68 37.4245 3.54708 PNS24243 293 109.442 6 6.5143 KQK14069 1603 1385.68 1054.32 90.4091 KQK14071 474 266.051 41.5711 18.5664 ==> SRR5011905.se.tsv <== BRADI_1g14170v3 1384 BRADI_1g53295v3 44 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 2991 BRADI_1g74790v3 105 BRADI_1g09890v3 7 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR5011905 completed mapping pipeline successfully