Starting /dee2/code/volunteer_pipeline.sh SRR5011906 current disk space = 1543078469632 free memory = 1601306088 SRR5011906 SRAfilesize 8366a21144cd04a34cbad10c2f9ce0a3 SRR5011906.sra SRR5011906.sra file validated SRR5011906 is paired end SRR5011906 is conventional basespace SRR5011906 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.787 3.0 3.0 3.0 2.0 3.0 2 2.9045 3.0 3.0 3.0 3.0 3.0 3 2.90925 3.0 3.0 3.0 3.0 3.0 4 5.9805 6.0 6.0 6.0 6.0 6.0 5 5.954 6.0 6.0 6.0 6.0 6.0 6 5.9515 6.0 6.0 6.0 6.0 6.0 7 5.9425 6.0 6.0 6.0 6.0 6.0 8 5.952 6.0 6.0 6.0 6.0 6.0 9 7.88575 8.0 8.0 8.0 8.0 8.0 10-11 7.923375 8.0 8.0 8.0 8.0 8.0 12-13 7.906499999999999 8.0 8.0 8.0 8.0 8.0 14-15 9.712625 10.0 10.0 10.0 9.0 10.0 16-17 9.685749999999999 10.0 10.0 10.0 9.0 10.0 18-19 9.64625 10.0 10.0 10.0 9.0 10.0 20-21 9.634625 10.0 10.0 10.0 9.0 10.0 22-23 9.57775 10.0 9.0 10.0 9.0 10.0 24-25 9.562375 10.0 9.5 10.0 9.0 10.0 26-27 9.455625000000001 10.0 9.0 10.0 8.0 10.0 28-29 9.4595 10.0 9.0 10.0 8.0 10.0 30-31 9.506625 10.0 9.0 10.0 8.0 10.0 32-33 9.4925 10.0 9.0 10.0 8.0 10.0 34-35 9.46875 10.0 9.0 10.0 8.0 10.0 36-37 9.371125 10.0 9.0 10.0 8.0 10.0 38-39 9.291125000000001 10.0 9.0 10.0 7.5 10.0 40-41 9.21425 10.0 9.0 10.0 7.5 10.0 42-43 9.111875 10.0 9.0 10.0 7.0 10.0 44-45 9.066125 10.0 9.0 10.0 7.0 10.0 46-47 9.060125 10.0 9.0 10.0 6.0 10.0 48-49 8.94275 10.0 9.0 10.0 6.0 10.0 50-51 8.786999999999999 10.0 8.0 10.0 5.0 10.0 52-53 8.61025 10.0 8.0 10.0 4.0 10.0 54-55 8.459624999999999 10.0 8.0 10.0 4.0 10.0 56-57 8.278375 10.0 6.5 10.0 4.0 10.0 58-59 8.05 9.0 6.0 10.0 4.0 10.0 60-61 7.780374999999999 9.0 5.5 10.0 4.0 10.0 62-63 7.522875 8.0 5.0 10.0 4.0 10.0 64-65 7.2375 8.0 4.0 10.0 4.0 10.0 66-67 6.883375 7.5 4.0 9.5 4.0 10.0 68-69 6.510625 6.0 4.0 9.0 4.0 10.0 70-71 6.14531170886076 6.0 4.0 8.0 4.0 10.0 72-73 5.84404914441335 5.0 4.0 8.0 4.0 10.0 74-75 5.53539766035737 5.0 4.0 7.5 4.0 8.5 76-77 4.426901464710232 4.0 3.5 5.5 2.0 8.0 78-79 4.971974385585508 4.0 4.0 6.0 3.5 8.0 80-81 4.801509196545082 4.0 4.0 5.5 4.0 7.0 82-83 4.5845141012761434 4.0 4.0 5.0 4.0 6.0 84-85 4.377719765080865 4.0 4.0 5.0 3.5 6.0 86-87 4.236695574533114 4.0 4.0 4.5 3.0 5.5 88-89 4.121141931696439 4.0 4.0 4.0 3.0 5.0 90-91 4.0239287207357854 4.0 4.0 4.0 3.0 5.0 92-93 3.9439043646673686 4.0 4.0 4.0 3.0 5.0 94-95 3.871727040066226 4.0 4.0 4.0 3.0 5.0 96-97 3.8398717332050665 4.0 4.0 4.0 3.0 4.0 98-99 3.82552831783601 4.0 4.0 4.0 3.0 4.0 100-101 3.367104975223665 3.5 3.0 4.0 2.0 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 2.0 4 21.0 5 226.0 6 968.0 7 2020.0 8 749.0 9 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.9 12.225 10.975 51.9 2 22.275 20.549999999999997 35.375 21.8 3 24.05 23.35 23.325000000000003 29.275000000000002 4 27.775 29.625 17.65 24.95 5 26.775 32.0 23.275000000000002 17.95 6 21.6 32.675 23.025000000000002 22.7 7 19.525000000000002 18.125 40.6 21.75 8 21.825 20.65 28.000000000000004 29.525000000000002 9 19.8 21.175 32.824999999999996 26.200000000000003 10-11 24.45 30.7375 22.4625 22.35 12-13 21.65 24.025 28.325 26.0 14-15 22.95 26.35 26.025 24.675 16-17 23.25 25.912499999999998 25.8625 24.975 18-19 22.6875 26.237500000000004 24.9375 26.137500000000003 20-21 24.0125 26.1625 25.95 23.875 22-23 22.7375 27.0 24.525 25.7375 24-25 24.224999999999998 25.55 25.6125 24.6125 26-27 23.0875 25.7 26.450000000000003 24.762500000000003 28-29 22.912499999999998 26.1 25.8 25.1875 30-31 22.8 26.5 25.15 25.55 32-33 22.4875 26.8625 26.424999999999997 24.224999999999998 34-35 23.4625 26.150000000000002 25.412499999999998 24.975 36-37 23.674999999999997 25.7375 25.412499999999998 25.174999999999997 38-39 22.525000000000002 25.9625 26.2625 25.25 40-41 23.200000000000003 26.075 25.887500000000003 24.837500000000002 42-43 23.275000000000002 25.1875 26.2875 25.25 44-45 23.8875 26.1 25.974999999999998 24.0375 46-47 23.625 26.5875 25.2625 24.525 48-49 22.662499999999998 25.9875 25.2875 26.0625 50-51 23.3 26.0125 25.4375 25.25 52-53 23.150000000000002 26.6125 25.474999999999998 24.762500000000003 54-55 22.425 26.25 25.7375 25.587500000000002 56-57 23.625 26.187500000000004 25.75 24.4375 58-59 24.099999999999998 26.187500000000004 24.85 24.8625 60-61 23.175 26.337500000000002 25.5625 24.925 62-63 22.775000000000002 25.5 26.525 25.2 64-65 23.849999999999998 25.5125 26.275 24.3625 66-67 22.75 25.5 25.674999999999997 26.075 68-69 24.075 24.9125 26.150000000000002 24.8625 70-71 24.540880503144656 25.58490566037736 25.610062893081757 24.264150943396228 72-73 23.937475778323215 25.87520992119881 24.880506394522673 25.306807905955303 74-75 24.190552016985137 27.123142250530783 25.172505307855626 23.51380042462845 76-77 23.602573266619014 26.576125804145818 25.561115082201574 24.260185847033593 78-79 23.761655011655012 25.946969696969695 25.713869463869464 24.577505827505828 80-81 24.257278669043377 26.41117052881759 25.564468211527036 23.767082590612002 82-83 24.53922315308454 25.20944402132521 26.47372429550647 23.77760853008378 84-85 23.756646856427903 25.383171723490772 26.055677197372535 24.80450422270879 86-87 23.001918158567776 27.173913043478258 25.271739130434785 24.55242966751918 88-89 23.73629968918698 26.48454114182889 25.339440536561426 24.439718632422704 90-91 24.250084260195486 26.204920795416246 25.581395348837212 23.96359959555106 92-93 24.31025507548152 25.177858754121118 27.121290994273817 23.390595176123547 94-95 23.556038384935725 27.14104653268151 24.98642042368278 24.316494658699984 96-97 22.95205738014345 26.802567006417515 26.481691204228007 23.763684409211024 98-99 24.409756097560976 26.595121951219515 26.06829268292683 22.926829268292686 100-101 23.40983606557377 26.797814207650273 25.61748633879781 24.174863387978142 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.5 27 3.0 28 3.5 29 5.5 30 9.0 31 11.5 32 17.0 33 26.5 34 32.5 35 41.0 36 61.0 37 78.5 38 104.5 39 126.5 40 147.5 41 172.5 42 187.0 43 190.5 44 202.5 45 209.0 46 216.0 47 228.0 48 216.5 49 193.5 50 173.0 51 165.5 52 145.0 53 122.0 54 108.0 55 98.5 56 88.5 57 85.0 58 84.5 59 77.0 60 74.5 61 76.0 62 68.5 63 62.5 64 62.5 65 53.0 66 43.0 67 38.0 68 29.0 69 25.5 70 26.0 71 18.5 72 18.5 73 21.5 74 15.0 75 7.0 76 4.5 77 5.0 78 2.5 79 0.5 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 50.0 71 52.0 72 55.0 73 47.0 74 56.0 75 221.0 76 43.0 77 28.0 78 32.0 79 28.0 80 44.0 81 40.0 82 43.0 83 43.0 84 42.0 85 34.0 86 28.0 87 33.0 88 49.0 89 42.0 90 46.0 91 41.0 92 43.0 93 66.0 94 65.0 95 56.0 96 48.0 97 35.0 98 55.0 99 44.0 100 407.0 101 2084.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5011906 read2 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5011906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.31475 3.0 2.0 3.0 0.0 3.0 2 2.59275 3.0 2.0 3.0 0.0 3.0 3 3.03575 3.0 3.0 3.0 2.0 3.0 4 5.9505 6.0 6.0 6.0 6.0 6.0 5 5.936 6.0 6.0 6.0 6.0 6.0 6 5.9635 6.0 6.0 6.0 6.0 6.0 7 5.9625 6.0 6.0 6.0 6.0 6.0 8 6.11025 6.0 6.0 6.0 6.0 6.0 9 7.8975 8.0 8.0 8.0 8.0 8.0 10-11 7.909000000000001 8.0 8.0 8.0 8.0 8.0 12-13 7.9567499999999995 8.0 8.0 8.0 8.0 8.0 14-15 9.686 10.0 10.0 10.0 9.0 10.0 16-17 9.6765 10.0 10.0 10.0 9.0 10.0 18-19 9.649000000000001 10.0 10.0 10.0 9.0 10.0 20-21 9.628375 10.0 10.0 10.0 9.0 10.0 22-23 9.581624999999999 10.0 9.0 10.0 9.0 10.0 24-25 9.52025 10.0 9.0 10.0 8.5 10.0 26-27 9.486375 10.0 9.0 10.0 8.0 10.0 28-29 9.5825 10.0 10.0 10.0 9.0 10.0 30-31 9.5515 10.0 9.5 10.0 9.0 10.0 32-33 9.487874999999999 10.0 9.0 10.0 8.0 10.0 34-35 9.447125 10.0 9.0 10.0 8.0 10.0 36-37 9.38425 10.0 9.0 10.0 8.0 10.0 38-39 9.310125 10.0 9.0 10.0 8.0 10.0 40-41 9.243875 10.0 9.0 10.0 7.0 10.0 42-43 9.151125 10.0 9.0 10.0 7.0 10.0 44-45 9.027375 10.0 9.0 10.0 6.5 10.0 46-47 8.895875 10.0 9.0 10.0 6.0 10.0 48-49 8.718 10.0 8.0 10.0 5.5 10.0 50-51 7.615875000000001 8.0 7.0 9.0 3.5 9.5 52-53 7.744999999999999 8.5 7.0 9.5 4.0 9.5 54-55 8.2425 9.0 7.0 10.0 4.0 10.0 56-57 8.2185 9.0 6.5 10.0 4.0 10.0 58-59 8.048124999999999 9.0 6.0 10.0 4.0 10.0 60-61 7.836625 9.0 6.0 10.0 4.0 10.0 62-63 7.57275 8.5 5.0 10.0 4.0 10.0 64-65 7.2515 8.0 4.0 10.0 4.0 10.0 66-67 6.933624999999999 7.5 4.0 10.0 4.0 10.0 68-69 6.602375 6.0 4.0 9.0 4.0 10.0 70-71 6.244881570634319 6.0 4.0 8.0 4.0 10.0 72-73 5.935517952275871 5.5 4.0 8.0 4.0 10.0 74-75 5.623245645730714 5.0 4.0 7.5 4.0 9.0 76-77 5.30229091982099 4.5 4.0 6.0 4.0 8.0 78-79 4.996728439249317 4.0 4.0 6.0 4.0 8.0 80-81 4.727214773167095 4.0 4.0 5.5 3.5 7.0 82-83 4.488854068868585 4.0 4.0 5.0 3.0 6.0 84-85 4.287157679816387 4.0 4.0 5.0 3.0 6.0 86-87 4.110737166332462 4.0 4.0 4.0 3.0 5.0 88-89 4.042628720030061 4.0 4.0 4.0 3.0 5.0 90-91 3.973769185036585 4.0 4.0 4.0 3.0 5.0 92-93 3.902391159028327 4.0 4.0 4.0 3.0 5.0 94-95 3.8214454275769523 4.0 4.0 4.0 3.0 4.5 96-97 3.7852131992849882 4.0 4.0 4.0 3.0 4.0 98-99 3.773718458371317 4.0 4.0 4.0 3.0 4.0 100-101 3.2313300045197044 3.5 3.0 4.0 1.5 4.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 3 1.0 4 21.0 5 245.0 6 1070.0 7 1992.0 8 666.0 9 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.700000000000003 5.575 14.05 52.675000000000004 2 23.025000000000002 21.15 31.275 24.55 3 24.375 25.2 22.875 27.55 4 27.525 28.025 18.525 25.924999999999997 5 27.875 32.0 21.525 18.6 6 19.975 34.599999999999994 24.55 20.875 7 18.6 18.175 39.15 24.075 8 21.125 21.7 28.725 28.449999999999996 9 21.4 21.775 32.125 24.7 10-11 24.6625 29.525000000000002 21.3125 24.5 12-13 22.125 24.462500000000002 27.987499999999997 25.424999999999997 14-15 21.675 26.737499999999997 26.650000000000002 24.9375 16-17 23.0875 26.275 25.3 25.337500000000002 18-19 22.275 26.8375 25.2375 25.650000000000002 20-21 22.575 27.025 25.900000000000002 24.5 22-23 22.975 26.2125 24.825 25.9875 24-25 22.900000000000002 25.3 26.137500000000003 25.662499999999998 26-27 22.825 26.9625 25.162499999999998 25.05 28-29 22.8625 25.25 26.35 25.5375 30-31 23.425 26.737499999999997 25.362499999999997 24.474999999999998 32-33 22.7625 26.0375 25.575 25.624999999999996 34-35 23.3 26.700000000000003 24.9875 25.0125 36-37 23.400000000000002 27.6375 24.1125 24.85 38-39 22.5875 26.400000000000002 25.687500000000004 25.324999999999996 40-41 23.3625 26.3625 25.637500000000003 24.637500000000003 42-43 22.7375 26.3 25.7 25.2625 44-45 22.75 26.2875 26.400000000000002 24.5625 46-47 23.3125 25.8125 25.900000000000002 24.975 48-49 23.2375 26.137500000000003 25.6 25.025 50-51 23.575 25.674999999999997 25.650000000000002 25.1 52-53 23.1375 25.8125 26.0 25.05 54-55 23.1875 25.924999999999997 24.525 26.3625 56-57 23.225 26.224999999999998 26.437500000000004 24.1125 58-59 23.65 26.0125 26.075 24.2625 60-61 22.75 26.487500000000004 25.2125 25.55 62-63 23.75 26.674999999999997 25.624999999999996 23.95 64-65 23.1 25.75 25.924999999999997 25.224999999999998 66-67 22.9875 26.05 26.3 24.6625 68-69 23.1125 26.887499999999996 25.224999999999998 24.775 70-71 24.418750785471914 25.54983033806711 25.80118134975493 24.230237526706045 72-73 24.627632254750896 25.205444273240886 25.667693888032872 24.499229583975346 74-75 23.398950131233594 25.5249343832021 25.826771653543307 25.249343832020998 76-77 24.100575096964022 26.32071686505283 25.504881637020194 24.073826400962954 78-79 24.02135231316726 26.17027101012866 25.540651519299207 24.267725157404875 80-81 23.857223476297968 25.973476297968396 25.60665914221219 24.562641083521445 82-83 23.930384336475708 26.134880348078315 25.438723712835387 24.496011602610587 84-85 23.381294964028775 26.43884892086331 25.764388489208635 24.415467625899282 86-87 23.429196623944986 26.258205689277897 25.804939043451082 24.50765864332604 88-89 22.56558828263319 26.63769515531949 25.301786576533075 25.494929985514243 90-91 22.39228081849942 27.15022458825487 26.834137414739644 23.623357178506073 92-93 22.956730769230766 27.455357142857146 25.755494505494504 23.832417582417584 94-95 24.03656569277648 25.775228535579853 25.829001613192325 24.359204158451337 96-97 22.764994341757827 27.121840814786875 26.254243681629575 23.858921161825727 98-99 22.732626619552416 26.52139772281115 26.442873969375736 24.303101688260696 100-101 23.2810615199035 26.586248492159225 26.15199034981906 23.980699638118214 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 2.0 27 4.0 28 3.5 29 5.5 30 7.5 31 12.5 32 20.5 33 26.5 34 31.5 35 37.0 36 50.5 37 71.0 38 108.0 39 135.5 40 152.0 41 183.0 42 202.0 43 202.0 44 205.5 45 220.5 46 228.5 47 213.5 48 207.5 49 190.0 50 156.0 51 140.5 52 131.5 53 122.0 54 105.5 55 94.5 56 89.0 57 79.5 58 82.0 59 92.0 60 85.5 61 74.5 62 66.5 63 61.5 64 59.0 65 48.0 66 44.5 67 42.5 68 32.0 69 27.5 70 24.0 71 20.0 72 16.0 73 15.5 74 13.5 75 8.0 76 7.0 77 6.0 78 3.0 79 2.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 43.0 71 47.0 72 32.0 73 51.0 74 34.0 75 35.0 76 39.0 77 41.0 78 50.0 79 59.0 80 50.0 81 46.0 82 51.0 83 52.0 84 68.0 85 84.0 86 38.0 87 46.0 88 55.0 89 49.0 90 49.0 91 43.0 92 52.0 93 62.0 94 69.0 95 76.0 96 56.0 97 46.0 98 60.0 99 101.0 100 687.0 101 1729.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688634 spots for SRR5011906.sra Written 688634 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra Read 688630 spots for SRR5011906.sra Written 688630 spots for SRR5011906.sra SRR ids: ['SRR5011906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iou_wpfz SRR5011906.sra spots: 13772604 blocks: [[1, 688630], [688631, 1377260], [1377261, 2065890], [2065891, 2754520], [2754521, 3443150], [3443151, 4131780], [4131781, 4820410], [4820411, 5509040], [5509041, 6197670], [6197671, 6886300], [6886301, 7574930], [7574931, 8263560], [8263561, 8952190], [8952191, 9640820], [9640821, 10329450], [10329451, 11018080], [11018081, 11706710], [11706711, 12395340], [12395341, 13083970], [13083971, 13772604]] SRR5011906 file size 3046217 SRR5011906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5011906 SRR5011906_1.fastq SRR5011906_2.fastq Input file: SRR5011906_1.fastq Paired file: SRR5011906_2.fastq trimmed: SRR5011906-trimmed-pair1.fastq, SRR5011906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:29:54 2024 >> started Sat Dec 7 11:30:09 2024 >> done (15.408s) 13772604 read pairs processed; of these: 51558 ( 0.37%) short read pairs filtered out after trimming by size control 81034 ( 0.59%) empty read pairs filtered out after trimming by size control 13640012 (99.04%) read pairs available; of these: 13639947 (100.00%) trimmed read pairs available after processing 65 ( 0.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 67 0.00% 19 147 0.00% 20 287 0.00% 21 505 0.00% 22 844 0.01% 23 1383 0.01% 24 2333 0.02% 25 3794 0.03% 26 5446 0.04% 27 7888 0.06% 28 11078 0.08% 29 15108 0.11% 30 20179 0.15% 31 25977 0.19% 32 32834 0.24% 33 41234 0.30% 34 51323 0.38% 35 59984 0.44% 36 70833 0.52% 37 82284 0.60% 38 94497 0.69% 39 107586 0.79% 40 121072 0.89% 41 135296 0.99% 42 150801 1.11% 43 163703 1.20% 44 178429 1.31% 45 191403 1.40% 46 206442 1.51% 47 220743 1.62% 48 238482 1.75% 49 255950 1.88% 50 274347 2.01% 51 294197 2.16% 52 313639 2.30% 53 331957 2.43% 54 353596 2.59% 55 376911 2.76% 56 399979 2.93% 57 425976 3.12% 58 453134 3.32% 59 483857 3.55% 60 513102 3.76% 61 542741 3.98% 62 569356 4.17% 63 581772 4.27% 64 605318 4.44% 65 610490 4.48% 66 597991 4.38% 67 571123 4.19% 68 532765 3.91% 69 479240 3.51% 70 422126 3.09% 71 355595 2.61% 72 291585 2.14% 73 228736 1.68% 74 171798 1.26% 75 123141 0.90% 76 85390 0.63% 77 57050 0.42% 78 37037 0.27% 79 23896 0.18% 80 14854 0.11% 81 8933 0.07% 82 5140 0.04% 83 2842 0.02% 84 1413 0.01% 85 638 0.00% 86 265 0.00% 87 116 0.00% 88 19 0.00% 89 11 0.00% 90 3 0.00% 91 1 0.00% 13640012 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=9 prefix-density=0.15 prefix-fanout=2.3 sequence=GAGGGCATCAAGAAGTTCGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=11.97 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.8 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.11 prefix-fanout=2.0 sequence=GGCCACACCTGCATGCACCTGATCCTTCCACCGTTGGAGACGCTGCCGAGACCAGCGCTGGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=9.55 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=2.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGG SRR5011906 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:30:34 Started mapping on | Dec 07 11:30:34 Finished on | Dec 07 11:30:54 Mapping speed, Million of reads per hour | 2455.20 Number of input reads | 13640012 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 13279751 Uniquely mapped reads % | 97.36% Average mapped length | 118.12 Number of splices: Total | 5645978 Number of splices: Annotated (sjdb) | 5403552 Number of splices: GT/AG | 5569680 Number of splices: GC/AG | 65858 Number of splices: AT/AC | 3185 Number of splices: Non-canonical | 7255 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.00% Insertion average length | 1.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 157515 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 22800 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 209881 209881 209881 N_multimapping 157515 157515 157515 N_noFeature 560331 6781204 6824839 N_ambiguous 270072 18881 18785 UnstrandedReadsAssigned:12449348 PositiveStrandReadsAssigned:6479666 NegativeStrandReadsAssigned:6436127 Dataset is classified unstranded MeadianReadLen=62 20thPercentileLength=49 echo kmer=45 SRR5011906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5011906-trimmed-pair1.fastq SRR5011906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,640,012 reads, 12,807,042 reads pseudoaligned [quant] estimated average fragment length: 215.332 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR5011906.ke.tsv 35125 SRR5011906.se.tsv 88098 total ==> SRR5011906.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 721.915 0 0 PNS24247 1044 829.668 26.8282 3.93169 PNS24249 1928 1713.67 19.2383 1.36501 PNS24246 1044 829.668 26.8282 3.93169 PNS24248 1044 829.668 26.8282 3.93169 PNS24244 1471 1256.67 45.2772 4.38079 PNS24243 293 111.174 5 5.46841 KQK14069 1603 1388.67 1254.85 109.872 KQK14071 474 268.673 36.0157 16.299 ==> SRR5011906.se.tsv <== BRADI_1g14170v3 1552 BRADI_1g53295v3 27 BRADI_1g59795v3 202 BRADI_1g07683v3 0 BRADI_1g00485v3 86 BRADI_1g20270v3 2776 BRADI_1g74790v3 111 BRADI_1g09890v3 7 BRADI_1g77505v3 253 BRADI_1g48960v3 0 SRR5011906 completed mapping pipeline successfully