Starting /dee2/code/volunteer_pipeline.sh SRR5270274 current disk space = 1547852894208 free memory = 1599565540 SRR5270274 SRAfilesize 9245665b31c3ea088b028a44a719e8e9 SRR5270274.sra SRR5270274.sra file validated SRR5270274 is single end SRR5270274 is conventional basespace SRR5270274 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270274_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32475 33.0 33.0 34.0 27.0 34.0 2 32.04975 33.0 33.0 34.0 28.0 34.0 3 31.92325 33.0 33.0 34.0 28.0 34.0 4 32.14375 33.0 33.0 34.0 31.0 34.0 5 32.00525 33.0 33.0 34.0 29.0 34.0 6 35.7775 38.0 37.0 38.0 31.0 38.0 7 36.06575 38.0 38.0 38.0 33.0 38.0 8 36.0565 38.0 38.0 38.0 34.0 38.0 9 36.04975 38.0 38.0 38.0 33.0 38.0 10-14 36.06425 38.0 38.0 38.0 33.2 38.0 15-19 35.97975 38.0 38.0 38.0 33.0 38.0 20-24 35.904250000000005 38.0 38.0 38.0 33.0 38.0 25-29 35.76304999999999 38.0 38.0 38.0 31.4 38.0 30-34 35.6403 38.0 38.0 38.0 30.6 38.0 35-39 35.57535 38.0 37.6 38.0 30.4 38.0 40-44 35.4439 38.0 37.0 38.0 29.2 38.0 45-49 35.3791 38.0 37.0 38.0 29.0 38.0 50-54 35.289049999999996 38.0 37.0 38.0 29.0 38.0 55-59 35.090050000000005 38.0 37.0 38.0 28.2 38.0 60-64 34.957300000000004 38.0 37.0 38.0 27.4 38.0 65-69 34.705 38.0 36.2 38.0 26.2 38.0 70-74 34.3778 38.0 35.8 38.0 24.6 38.0 75-79 34.0745 38.0 35.4 38.0 21.6 38.0 80-84 33.840149999999994 38.0 35.0 38.0 16.6 38.0 85-89 33.2955 38.0 34.0 38.0 15.0 38.0 90-94 33.25880000000001 38.0 34.0 38.0 15.0 38.0 95-99 32.846900000000005 38.0 34.0 38.0 15.0 38.0 100-104 32.35285 38.0 33.4 38.0 14.8 38.0 105-109 31.95845 38.0 32.4 38.0 14.0 38.0 110-114 31.484 38.0 31.0 38.0 13.0 38.0 115-119 30.723400000000005 37.8 28.0 38.0 13.0 38.0 120-124 30.30025 37.2 27.6 38.0 2.0 38.0 125-129 29.7277 36.8 24.6 38.0 2.0 38.0 130-134 28.7154 35.8 22.6 38.0 2.0 38.0 135-139 27.818450000000002 35.2 19.2 38.0 2.0 38.0 140-144 26.71415 34.4 13.4 38.0 2.0 38.0 145-149 24.570449999999997 33.4 4.0 38.0 2.0 38.0 150 17.0685 15.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 8.0 4 4.0 5 3.0 6 5.0 7 8.0 8 4.0 9 5.0 10 3.0 11 7.0 12 14.0 13 19.0 14 7.0 15 22.0 16 26.0 17 19.0 18 36.0 19 36.0 20 40.0 21 37.0 22 23.0 23 45.0 24 31.0 25 49.0 26 54.0 27 83.0 28 74.0 29 98.0 30 125.0 31 160.0 32 181.0 33 214.0 34 261.0 35 376.0 36 509.0 37 1365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.99070247933884 13.739669421487601 9.22004132231405 39.0495867768595 2 24.70440251572327 20.050314465408807 34.76729559748428 20.47798742138365 3 23.345911949685537 20.754716981132077 27.32075471698113 28.57861635220126 4 27.144654088050313 28.9811320754717 19.69811320754717 24.17610062893082 5 27.762396174175684 30.807953687389883 21.46992197331991 19.959728165114523 6 22.51322085117099 34.47494333920927 22.588768572148073 20.42306723747167 7 18.852252705763906 21.721620941354143 37.981374276365464 21.444752076516487 8 20.231504781077 23.628585807750376 29.365878208354303 26.77403120281832 9 23.659702995217717 20.211427133148753 30.38006544173169 25.74880442990184 10-14 24.67029094936072 26.517668378133497 23.70381556428068 25.108225108225106 15-19 24.083400483481064 25.33742949234488 25.68996776792909 24.889202256244964 20-24 24.545591863450987 26.262524545591866 25.23035093902623 23.96153265193092 25-29 24.246389210407127 26.18891852448291 24.860349252679782 24.704343012430176 30-34 24.737080460926887 25.743471041111054 25.386202385145673 24.133246112816384 35-39 24.22641509433962 25.10188679245283 25.77610062893082 24.89559748427673 40-44 24.81006289308176 26.10817610062893 24.744654088050314 24.337106918238995 45-49 24.378459989934576 25.309511826874687 25.269250125817816 25.04277805737292 50-54 24.053754781558283 25.0 25.2818602778337 25.664384940608016 55-59 24.310448963156837 25.614052748137713 25.72478357157238 24.35071471713308 60-64 24.14556802738209 26.68747168671667 24.31670609553531 24.850254190365934 65-69 23.655589123867067 26.77240684793555 24.954682779456196 24.617321248741188 70-74 23.826787512588115 26.59113796576032 24.45619335347432 25.125881168177237 75-79 24.365558912386707 26.158106747230615 24.944612286002013 24.531722054380666 80-84 24.5354283124339 26.197310772019943 24.4800322304477 24.78722868509845 85-89 24.481160588353816 25.770703203707434 24.778359862986097 24.96977634495265 90-94 24.145051624276 25.897758750944345 24.880382775119617 25.076806849660034 95-99 24.27248011277817 26.019534790051353 25.420400765280437 24.28758433189004 100-104 24.43593875906527 26.027397260273972 24.395648670427075 25.141015310233684 105-109 24.45362070701984 26.286635109275856 24.428441937758084 24.83130224594622 110-114 24.551772763900082 26.818090249798548 24.576954069298953 24.053182917002417 115-119 24.433477691610435 26.654245140497533 24.66512236881861 24.24715479907342 120-124 24.255854948375724 26.37622765046588 24.53286325862503 24.835054142533366 125-129 24.224415793714744 26.838235294117645 24.6071716357776 24.330177276390007 130-134 24.13775741402749 27.19399828810231 24.233422284879914 24.43482201299028 135-139 24.137931034482758 26.810974075006293 24.03221746790838 25.01887742260257 140-144 23.859861069163397 27.061310782241016 24.499144266586125 24.579683882009462 145-149 23.99052276049806 27.509199979835657 24.156878560266172 24.34339869940011 150 22.77875660709791 30.254215957714575 22.073999496602063 24.89302793858545 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 23.0 1 13.0 2 1.5 3 1.0 4 1.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.0 25 3.5 26 4.0 27 2.0 28 5.0 29 9.5 30 10.0 31 10.0 32 16.5 33 23.5 34 31.5 35 41.0 36 52.5 37 69.0 38 86.5 39 96.0 40 112.5 41 140.0 42 159.5 43 172.5 44 187.0 45 189.5 46 190.0 47 184.0 48 161.0 49 164.5 50 166.5 51 148.5 52 140.5 53 126.5 54 121.5 55 109.5 56 98.0 57 95.0 58 88.0 59 101.0 60 89.0 61 71.0 62 70.0 63 65.0 64 59.0 65 58.5 66 58.0 67 49.0 68 37.0 69 26.5 70 18.0 71 12.5 72 14.0 73 10.0 74 3.0 75 3.0 76 2.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.625 3 0.625 4 0.625 5 0.675 6 0.7250000000000001 7 0.675 8 0.65 9 0.675 10-14 0.67 15-19 0.72 20-24 0.695 25-29 0.645 30-34 0.635 35-39 0.625 40-44 0.625 45-49 0.65 50-54 0.66 55-59 0.66 60-64 0.6649999999999999 65-69 0.7000000000000001 70-74 0.7000000000000001 75-79 0.7000000000000001 80-84 0.715 85-89 0.74 90-94 0.7250000000000001 95-99 0.69 100-104 0.72 105-109 0.7100000000000001 110-114 0.72 115-119 0.7100000000000001 120-124 0.7250000000000001 125-129 0.72 130-134 0.695 135-139 0.675 140-144 0.67 145-149 0.815 150 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.02388903159517 96.375 2 0.7192396609298741 1.4000000000000001 3 0.10274852298998202 0.3 4 0.07706139224248652 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07706139224248652 1.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCATCTCGTATGC 30 0.75 TruSeq Adapter, Index 14 (98% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 21 0.525 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.125 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 1.9875 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138 2.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992635 spots for SRR5270274.sra Written 3992635 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra Read 3992633 spots for SRR5270274.sra Written 3992633 spots for SRR5270274.sra SRR ids: ['SRR5270274.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ne0q5sgd SRR5270274.sra spots: 79852662 blocks: [[1, 3992633], [3992634, 7985266], [7985267, 11977899], [11977900, 15970532], [15970533, 19963165], [19963166, 23955798], [23955799, 27948431], [27948432, 31941064], [31941065, 35933697], [35933698, 39926330], [39926331, 43918963], [43918964, 47911596], [47911597, 51904229], [51904230, 55896862], [55896863, 59889495], [59889496, 63882128], [63882129, 67874761], [67874762, 71867394], [71867395, 75860027], [75860028, 79852662]] SRR5270274 file size 29348288 SRR5270274 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270274 SRR5270274_1.fastq Input file: SRR5270274_1.fastq trimmed: SRR5270274-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:21:23 2024 >> started Sat Dec 7 00:22:09 2024 >> done (45.764s) 79852662 reads processed; of these: 224471 ( 0.28%) short reads filtered out after trimming by size control 1342665 ( 1.68%) empty reads filtered out after trimming by size control 78285526 (98.04%) reads available; of these: 27338612 (34.92%) trimmed reads available after processing 50946914 (65.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7939 0.01% 19 8244 0.01% 20 7936 0.01% 21 14812 0.02% 22 9611 0.01% 23 10026 0.01% 24 9955 0.01% 25 10152 0.01% 26 11597 0.01% 27 10264 0.01% 28 10706 0.01% 29 10248 0.01% 30 10446 0.01% 31 10856 0.01% 32 12251 0.02% 33 19442 0.02% 34 10166 0.01% 35 9770 0.01% 36 9387 0.01% 37 9566 0.01% 38 9328 0.01% 39 10936 0.01% 40 11481 0.01% 41 12161 0.02% 42 12148 0.02% 43 11085 0.01% 44 11922 0.02% 45 13142 0.02% 46 12740 0.02% 47 15392 0.02% 48 13090 0.02% 49 13372 0.02% 50 13184 0.02% 51 12839 0.02% 52 13103 0.02% 53 13005 0.02% 54 14139 0.02% 55 14666 0.02% 56 16190 0.02% 57 17314 0.02% 58 17987 0.02% 59 20267 0.03% 60 20892 0.03% 61 23822 0.03% 62 30729 0.04% 63 26510 0.03% 64 28216 0.04% 65 39895 0.05% 66 72542 0.09% 67 241862 0.31% 68 156939 0.20% 69 68874 0.09% 70 41401 0.05% 71 44435 0.06% 72 44213 0.06% 73 75786 0.10% 74 35251 0.05% 75 30409 0.04% 76 29156 0.04% 77 28881 0.04% 78 32120 0.04% 79 29843 0.04% 80 29234 0.04% 81 29873 0.04% 82 30993 0.04% 83 31759 0.04% 84 32474 0.04% 85 34114 0.04% 86 33702 0.04% 87 34693 0.04% 88 35639 0.05% 89 37545 0.05% 90 38196 0.05% 91 39296 0.05% 92 41671 0.05% 93 42738 0.05% 94 43830 0.06% 95 45916 0.06% 96 48303 0.06% 97 50570 0.06% 98 51286 0.07% 99 53855 0.07% 100 55725 0.07% 101 57949 0.07% 102 59837 0.08% 103 62429 0.08% 104 64393 0.08% 105 66688 0.09% 106 72095 0.09% 107 75203 0.10% 108 76675 0.10% 109 78878 0.10% 110 82402 0.11% 111 83828 0.11% 112 87528 0.11% 113 92142 0.12% 114 95522 0.12% 115 98867 0.13% 116 103652 0.13% 117 105884 0.14% 118 110498 0.14% 119 92227 0.12% 120 93619 0.12% 121 98921 0.13% 122 104013 0.13% 123 107795 0.14% 124 115684 0.15% 125 121086 0.15% 126 122312 0.16% 127 128446 0.16% 128 135205 0.17% 129 142662 0.18% 130 152403 0.19% 131 163926 0.21% 132 168751 0.22% 133 180712 0.23% 134 198607 0.25% 135 211428 0.27% 136 230628 0.29% 137 246801 0.32% 138 274879 0.35% 139 312285 0.40% 140 343396 0.44% 141 393653 0.50% 142 472947 0.60% 143 551309 0.70% 144 686393 0.88% 145 794684 1.02% 146 1112446 1.42% 147 1719650 2.20% 148 2888496 3.69% 149 11042725 14.11% 150 50946914 65.08% 78285526 reads passed initial QC criterion=sequence-density sequence-density=1.44 sequence-density-rank=1 fanout-score=50.43 fanout-score-rank=1 prefix-density=1.75 prefix-fanout=41.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA criterion=fanout-score sequence-density=1.44 sequence-density-rank=1 fanout-score=50.43 fanout-score-rank=1 prefix-density=1.75 prefix-fanout=41.5 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAA Started job on | Dec 07 00:22:32 Started mapping on | Dec 07 00:22:33 Finished on | Dec 07 00:25:23 Mapping speed, Million of reads per hour | 1657.81 Number of input reads | 78285526 Average input read length | 145 UNIQUE READS: Uniquely mapped reads number | 73917748 Uniquely mapped reads % | 94.42% Average mapped length | 145.87 Number of splices: Total | 39731886 Number of splices: Annotated (sjdb) | 37461421 Number of splices: GT/AG | 39195024 Number of splices: GC/AG | 462976 Number of splices: AT/AC | 12740 Number of splices: Non-canonical | 61146 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1277765 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 194366 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3090013 3090013 3090013 N_multimapping 1277765 1277765 1277765 N_noFeature 3260703 38257101 37506536 N_ambiguous 1608634 91879 111806 UnstrandedReadsAssigned:69048411 PositiveStrandReadsAssigned:35568768 NegativeStrandReadsAssigned:36299406 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR5270274 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270274-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 78,285,526 reads, 71,062,784 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR5270274.ke.tsv 35125 SRR5270274.se.tsv 88098 total ==> SRR5270274.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 241.467 5.91618 PNS24249 1928 1829 99.9403 1.26515 PNS24246 1044 945 241.467 5.91618 PNS24248 1044 945 241.467 5.91618 PNS24244 1471 1372 373.658 6.30573 PNS24243 293 194 27 3.22238 KQK14069 1603 1504 16915.9 260.413 KQK14071 474 375 832.123 51.3773 ==> SRR5270274.se.tsv <== BRADI_1g14170v3 20492 BRADI_1g53295v3 80 BRADI_1g59795v3 2760 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 551 BRADI_1g74790v3 193 BRADI_1g09890v3 0 BRADI_1g77505v3 882 BRADI_1g48960v3 0 SRR5270274 completed mapping pipeline successfully