Starting /dee2/code/volunteer_pipeline.sh SRR5270276 current disk space = 1548039766016 free memory = 1598777676 SRR5270276 SRAfilesize 211af5d60e2582613c59f7229365bd34 SRR5270276.sra SRR5270276.sra file validated SRR5270276 is single end SRR5270276 is conventional basespace SRR5270276 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270276_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52575 33.0 33.0 34.0 28.0 34.0 2 32.2805 33.0 33.0 34.0 30.0 34.0 3 32.184 34.0 33.0 34.0 29.0 34.0 4 32.29725 34.0 33.0 34.0 31.0 34.0 5 32.16125 34.0 33.0 34.0 30.0 34.0 6 36.15125 38.0 37.0 38.0 33.0 38.0 7 36.25075 38.0 38.0 38.0 34.0 38.0 8 36.3635 38.0 38.0 38.0 34.0 38.0 9 36.3365 38.0 38.0 38.0 34.0 38.0 10-14 36.263400000000004 38.0 38.0 38.0 34.0 38.0 15-19 36.0708 38.0 38.0 38.0 33.2 38.0 20-24 36.1094 38.0 38.0 38.0 33.4 38.0 25-29 35.9306 38.0 38.0 38.0 32.2 38.0 30-34 35.83200000000001 38.0 38.0 38.0 32.0 38.0 35-39 35.7288 38.0 38.0 38.0 30.8 38.0 40-44 35.6544 38.0 37.6 38.0 30.4 38.0 45-49 35.5122 38.0 37.4 38.0 29.6 38.0 50-54 35.41155 38.0 37.0 38.0 29.0 38.0 55-59 35.259249999999994 38.0 37.0 38.0 28.6 38.0 60-64 35.17139999999999 38.0 37.0 38.0 28.2 38.0 65-69 34.72945 38.0 36.6 38.0 26.2 38.0 70-74 34.328599999999994 38.0 36.0 38.0 24.0 38.0 75-79 33.80115 38.0 36.0 38.0 16.0 38.0 80-84 33.57405 38.0 35.0 38.0 15.4 38.0 85-89 33.0354 38.0 34.0 38.0 15.0 38.0 90-94 33.00525 38.0 34.0 38.0 15.0 38.0 95-99 32.6623 38.0 34.0 38.0 15.0 38.0 100-104 32.27759999999999 38.0 33.6 38.0 14.0 38.0 105-109 31.8738 38.0 33.2 38.0 13.2 38.0 110-114 31.3418 38.0 31.0 38.0 13.0 38.0 115-119 30.6718 38.0 28.6 38.0 6.4 38.0 120-124 30.40335 38.0 28.2 38.0 2.0 38.0 125-129 29.5957 37.0 24.8 38.0 2.0 38.0 130-134 28.51175 35.8 20.6 38.0 2.0 38.0 135-139 27.675199999999997 35.6 19.2 38.0 2.0 38.0 140-144 26.607799999999997 34.0 13.4 38.0 2.0 38.0 145-149 24.5294 33.6 2.0 38.0 2.0 38.0 150 16.79125 2.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 6.0 4 4.0 5 4.0 6 8.0 7 10.0 8 5.0 9 7.0 10 4.0 11 19.0 12 12.0 13 16.0 14 23.0 15 28.0 16 20.0 17 30.0 18 32.0 19 41.0 20 32.0 21 25.0 22 37.0 23 43.0 24 49.0 25 45.0 26 47.0 27 61.0 28 105.0 29 98.0 30 115.0 31 122.0 32 164.0 33 208.0 34 250.0 35 373.0 36 551.0 37 1375.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.61439588688946 13.856041131105398 8.766066838046273 37.76349614395887 2 24.54203262233375 22.73525721455458 32.19573400250941 20.52697616060226 3 22.158092848180676 22.258469259723963 28.331242158092852 27.25219573400251 4 26.85069008782936 28.05520702634881 18.34378920953576 26.750313676286076 5 30.338770388958597 30.61480552070264 20.476787954830613 18.569636135508155 6 25.19447929736512 32.24592220828105 21.028858218318693 21.530740276035132 7 18.92095357590966 22.534504391468005 36.51191969887076 22.03262233375157 8 21.028858218318693 26.800501882057716 25.84692597239649 26.3237139272271 9 24.592220828105397 19.648682559598495 29.91217063989962 25.84692597239649 10-14 25.350062735257218 25.892095357590968 22.941028858218317 25.8168130489335 15-19 24.889580405541057 24.96988556514756 24.412768520377433 25.72776550893395 20-24 25.094102885821833 26.12296110414053 23.844416562107902 24.938519447929735 25-29 24.8732747804266 26.338770388958594 23.8594730238394 24.92848180677541 30-34 24.416562107904642 24.62233375156838 25.284818067754077 25.676286072772896 35-39 24.28607277289837 24.80803011292346 25.545796737766622 25.360100376411545 40-44 25.304893350062734 24.431618569636136 24.752823086574654 25.510664993726472 45-49 25.3801756587202 24.426599749058973 24.813048933500628 25.3801756587202 50-54 24.426599749058973 24.531994981179423 24.803011292346298 26.23839397741531 55-59 24.607277289836887 25.058971141781683 25.5357590966123 24.797992471769135 60-64 24.391468005018822 26.785445420326226 23.994981179422837 24.828105395232118 65-69 22.95608531994981 28.612296110414054 23.969887076537013 24.461731493099123 70-74 24.30614805520703 27.422835633626097 23.468005018820577 24.803011292346298 75-79 24.130489335006274 26.986198243412794 23.51819322459222 25.365119196988704 80-84 24.64866492672154 25.87331861072074 24.472997390082313 25.005019072475402 85-89 24.093966469229997 26.31261921493826 24.119064350968777 25.474349964862963 90-94 24.498092752459346 25.777956233688016 24.42280666532825 25.30114434852439 95-99 24.19573400250941 26.404015056461734 24.476787954830613 24.923462986198246 100-104 24.915926316317822 25.990061737690105 24.127892385684888 24.96611956030718 105-109 24.521957340025093 26.062735257214552 24.336260978670012 25.07904642409034 110-114 24.367596868098776 26.385264003212207 23.890784982935152 25.356354145753862 115-119 24.87954226059024 26.46556916281871 23.72515559124674 24.92973298534431 120-124 24.559554283993375 26.306279174823068 23.967274004918938 25.16689253626462 125-129 24.623569564344507 26.801847018670948 23.925918490262998 24.64866492672154 130-134 24.732747804265998 27.43789209535759 23.131744040150565 24.697616060225847 135-139 24.642409033877037 27.784190715181932 23.15683814303639 24.416562107904642 140-144 25.234629861982434 26.840652446675033 22.95608531994981 24.968632371392722 145-149 24.845500678289707 27.23709993468321 23.358287695322314 24.559111691704768 150 23.5633626097867 29.410288582183185 22.1831869510665 24.843161856963615 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 19.0 1 12.0 2 2.5 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 2.5 27 3.5 28 4.0 29 6.5 30 8.5 31 7.5 32 14.5 33 25.0 34 33.0 35 39.5 36 48.5 37 62.5 38 85.0 39 104.0 40 115.0 41 132.0 42 149.0 43 158.5 44 168.0 45 182.5 46 178.0 47 168.0 48 168.5 49 158.5 50 139.0 51 134.0 52 133.0 53 114.0 54 106.5 55 108.0 56 102.0 57 105.0 58 96.5 59 81.0 60 90.0 61 107.0 62 90.5 63 69.0 64 68.0 65 75.0 66 69.5 67 52.0 68 48.0 69 44.5 70 33.5 71 22.5 72 17.0 73 15.5 74 10.0 75 5.0 76 4.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.375 3 0.375 4 0.375 5 0.375 6 0.375 7 0.375 8 0.375 9 0.375 10-14 0.375 15-19 0.38 20-24 0.375 25-29 0.375 30-34 0.375 35-39 0.375 40-44 0.375 45-49 0.375 50-54 0.375 55-59 0.375 60-64 0.375 65-69 0.375 70-74 0.375 75-79 0.375 80-84 0.38 85-89 0.38999999999999996 90-94 0.38 95-99 0.375 100-104 0.385 105-109 0.375 110-114 0.38 115-119 0.38 120-124 0.385 125-129 0.38 130-134 0.375 135-139 0.375 140-144 0.375 145-149 0.485 150 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82352941176471 94.5 2 0.9411764705882352 1.7999999999999998 3 0.0784313725490196 0.22499999999999998 4 0.026143790849673207 0.1 5 0.0 0.0 6 0.026143790849673207 0.15 7 0.026143790849673207 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.052287581699346414 1.125 >50 0.026143790849673207 1.925 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 77 1.925 TruSeq Adapter, Index 12 (100% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 33 0.8250000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATG 6 0.15 TruSeq Adapter, Index 12 (100% over 49bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.3 0.0 0.0 0.0 0.0 2 0.3 0.0 0.0 0.0 0.0 3 0.3 0.0 0.0 0.0 0.0 4 0.3 0.0 0.0 0.0 0.0 5 0.3 0.0 0.0 0.0 0.0 6 0.3 0.0 0.0 0.0 0.0 7 0.3 0.0 0.0 0.0 0.0 8 0.3 0.0 0.0 0.0 0.0 9 0.3 0.0 0.0 0.0 0.0 10-11 0.3 0.0 0.0 0.0 0.0 12-13 0.3 0.0 0.0 0.0 0.0 14-15 0.3 0.0 0.0 0.0 0.0 16-17 0.32499999999999996 0.0 0.0 0.0 0.0 18-19 0.35 0.0 0.0 0.0 0.0 20-21 0.35 0.0 0.0 0.0 0.0 22-23 0.35 0.0 0.0 0.0 0.0 24-25 0.35 0.0 0.0 0.0 0.0 26-27 0.35 0.0 0.0 0.0 0.0 28-29 0.35 0.0 0.0 0.0 0.0 30-31 0.35 0.0 0.0 0.0 0.0 32-33 0.35 0.0 0.0 0.0 0.0 34-35 0.35 0.0 0.0 0.0 0.0 36-37 0.35 0.0 0.0 0.0 0.0 38-39 0.35 0.0 0.0 0.0 0.0 40-41 0.35 0.0 0.0 0.0 0.0 42-43 0.35 0.0 0.0 0.0 0.0 44-45 0.35 0.0 0.0 0.0 0.0 46-47 0.35 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.4 0.0 0.0 0.0 0.0 52-53 0.4 0.0 0.0 0.0 0.0 54-55 0.4 0.0 0.0 0.0 0.0 56-57 0.42500000000000004 0.0 0.0 0.0 0.0 58-59 0.45 0.0 0.0 0.0 0.0 60-61 0.45 0.0 0.0 0.0 0.0 62-63 0.4625 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.475 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.5 0.0 0.0 0.0 0.0 74-75 0.525 0.0 0.0 0.0 0.0 76-77 0.525 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.525 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGACT 10 0.006973645 144.0 3 TTTTTTT 30 0.0015031899 23.999998 125-129 >>END_MODULE Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705627 spots for SRR5270276.sra Written 3705627 spots for SRR5270276.sra Read 3705641 spots for SRR5270276.sra Written 3705641 spots for SRR5270276.sra SRR ids: ['SRR5270276.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kvox0fau SRR5270276.sra spots: 74112554 blocks: [[1, 3705627], [3705628, 7411254], [7411255, 11116881], [11116882, 14822508], [14822509, 18528135], [18528136, 22233762], [22233763, 25939389], [25939390, 29645016], [29645017, 33350643], [33350644, 37056270], [37056271, 40761897], [40761898, 44467524], [44467525, 48173151], [48173152, 51878778], [51878779, 55584405], [55584406, 59290032], [59290033, 62995659], [62995660, 66701286], [66701287, 70406913], [70406914, 74112554]] SRR5270276 file size 27237857 SRR5270276 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270276 SRR5270276_1.fastq Input file: SRR5270276_1.fastq trimmed: SRR5270276-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:21:52 2024 >> started Sat Dec 7 00:22:43 2024 >> done (51.401s) 74112554 reads processed; of these: 204212 ( 0.28%) short reads filtered out after trimming by size control 1893050 ( 2.55%) empty reads filtered out after trimming by size control 72015292 (97.17%) reads available; of these: 25322392 (35.16%) trimmed reads available after processing 46692900 (64.84%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6304 0.01% 19 6922 0.01% 20 6676 0.01% 21 10225 0.01% 22 7937 0.01% 23 8544 0.01% 24 11238 0.02% 25 9316 0.01% 26 10275 0.01% 27 11016 0.02% 28 12432 0.02% 29 32740 0.05% 30 12659 0.02% 31 23403 0.03% 32 17411 0.02% 33 47604 0.07% 34 11668 0.02% 35 11116 0.02% 36 9624 0.01% 37 9060 0.01% 38 8498 0.01% 39 10887 0.02% 40 12433 0.02% 41 15930 0.02% 42 13408 0.02% 43 10061 0.01% 44 12239 0.02% 45 12912 0.02% 46 11858 0.02% 47 17447 0.02% 48 12432 0.02% 49 12679 0.02% 50 12562 0.02% 51 12526 0.02% 52 12215 0.02% 53 12293 0.02% 54 13890 0.02% 55 14553 0.02% 56 16849 0.02% 57 18537 0.03% 58 18735 0.03% 59 27283 0.04% 60 22798 0.03% 61 27741 0.04% 62 55180 0.08% 63 34669 0.05% 64 30735 0.04% 65 50697 0.07% 66 112435 0.16% 67 385229 0.53% 68 260318 0.36% 69 104548 0.15% 70 55474 0.08% 71 63762 0.09% 72 55537 0.08% 73 145873 0.20% 74 48674 0.07% 75 38441 0.05% 76 31432 0.04% 77 30855 0.04% 78 37402 0.05% 79 31255 0.04% 80 29793 0.04% 81 29600 0.04% 82 30638 0.04% 83 31138 0.04% 84 32900 0.05% 85 33872 0.05% 86 33049 0.05% 87 34418 0.05% 88 36189 0.05% 89 37271 0.05% 90 38262 0.05% 91 40601 0.06% 92 46302 0.06% 93 42884 0.06% 94 44280 0.06% 95 46401 0.06% 96 48891 0.07% 97 51517 0.07% 98 52815 0.07% 99 54812 0.08% 100 57101 0.08% 101 59418 0.08% 102 62565 0.09% 103 65618 0.09% 104 67468 0.09% 105 69699 0.10% 106 75811 0.11% 107 78681 0.11% 108 81513 0.11% 109 84054 0.12% 110 86922 0.12% 111 88639 0.12% 112 92659 0.13% 113 98520 0.14% 114 100223 0.14% 115 105718 0.15% 116 110144 0.15% 117 112379 0.16% 118 116325 0.16% 119 78034 0.11% 120 79666 0.11% 121 84148 0.12% 122 88768 0.12% 123 92025 0.13% 124 99955 0.14% 125 103997 0.14% 126 103608 0.14% 127 110146 0.15% 128 115480 0.16% 129 121598 0.17% 130 129300 0.18% 131 139326 0.19% 132 143007 0.20% 133 153939 0.21% 134 169000 0.23% 135 178631 0.25% 136 195008 0.27% 137 209749 0.29% 138 233877 0.32% 139 265861 0.37% 140 292815 0.41% 141 337956 0.47% 142 406754 0.56% 143 473394 0.66% 144 591620 0.82% 145 685133 0.95% 146 966489 1.34% 147 1498077 2.08% 148 2535751 3.52% 149 10020738 13.91% 150 46692900 64.84% 72015292 reads passed initial QC criterion=sequence-density sequence-density=3.00 sequence-density-rank=1 fanout-score=49.05 fanout-score-rank=1 prefix-density=3.49 prefix-fanout=42.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAACA criterion=fanout-score sequence-density=3.00 sequence-density-rank=1 fanout-score=49.05 fanout-score-rank=1 prefix-density=3.49 prefix-fanout=42.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAACA Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAAAAACA -o SRR5270276 - Input file: STDIN trimmed: SRR5270276-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 00:26:50 2024 >> started Sat Dec 7 00:27:18 2024 >> done (27.430s) 24005097 reads processed; of these: 1967 ( 0.01%) short reads filtered out after trimming by size control 368782 ( 1.54%) empty reads filtered out after trimming by size control 23634348 (98.46%) reads available; of these: 1690835 ( 7.15%) trimmed reads available after processing 21943513 (92.85%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2096 0.01% 19 2401 0.01% 20 2261 0.01% 21 3447 0.01% 22 2645 0.01% 23 2753 0.01% 24 4345 0.02% 25 3686 0.02% 26 3413 0.01% 27 3512 0.01% 28 3011 0.01% 29 10061 0.04% 30 4093 0.02% 31 7664 0.03% 32 3975 0.02% 33 14623 0.06% 34 3507 0.01% 35 3312 0.01% 36 2935 0.01% 37 2649 0.01% 38 2588 0.01% 39 3224 0.01% 40 3734 0.02% 41 4508 0.02% 42 3615 0.02% 43 3077 0.01% 44 3614 0.02% 45 3892 0.02% 46 4062 0.02% 47 5503 0.02% 48 4066 0.02% 49 4063 0.02% 50 4113 0.02% 51 4518 0.02% 52 4262 0.02% 53 4497 0.02% 54 5104 0.02% 55 5210 0.02% 56 6192 0.03% 57 6510 0.03% 58 7028 0.03% 59 9582 0.04% 60 7412 0.03% 61 11452 0.05% 62 17314 0.07% 63 8929 0.04% 64 6348 0.03% 65 8228 0.03% 66 12371 0.05% 67 11893 0.05% 68 8603 0.04% 69 7196 0.03% 70 31372 0.13% 71 9357 0.04% 72 13735 0.06% 73 10638 0.05% 74 10966 0.05% 75 8668 0.04% 76 7969 0.03% 77 8404 0.04% 78 10165 0.04% 79 8916 0.04% 80 9049 0.04% 81 9272 0.04% 82 10302 0.04% 83 10536 0.04% 84 10856 0.05% 85 11408 0.05% 86 11547 0.05% 87 12443 0.05% 88 13025 0.06% 89 13765 0.06% 90 14450 0.06% 91 15515 0.07% 92 17134 0.07% 93 16825 0.07% 94 17801 0.08% 95 18889 0.08% 96 20057 0.08% 97 20934 0.09% 98 21880 0.09% 99 23079 0.10% 100 24072 0.10% 101 25099 0.11% 102 26805 0.11% 103 28189 0.12% 104 29340 0.12% 105 30491 0.13% 106 32575 0.14% 107 33959 0.14% 108 35548 0.15% 109 37247 0.16% 110 38082 0.16% 111 38975 0.16% 112 40953 0.17% 113 43491 0.18% 114 43941 0.19% 115 46957 0.20% 116 48443 0.20% 117 49324 0.21% 118 50745 0.21% 119 38822 0.16% 120 39947 0.17% 121 41708 0.18% 122 43759 0.19% 123 44725 0.19% 124 47891 0.20% 125 49856 0.21% 126 49617 0.21% 127 52458 0.22% 128 54188 0.23% 129 56818 0.24% 130 59094 0.25% 131 62920 0.27% 132 65164 0.28% 133 68827 0.29% 134 73586 0.31% 135 77431 0.33% 136 94407 0.40% 137 111316 0.47% 138 119986 0.51% 139 132023 0.56% 140 142010 0.60% 141 156665 0.66% 142 179401 0.76% 143 204631 0.87% 144 249500 1.06% 145 304377 1.29% 146 453046 1.92% 147 762038 3.22% 148 775169 3.28% 149 3100893 13.12% 150 14509785 61.39% criterion=sequence-density sequence-density=1.40 sequence-density-rank=1 fanout-score=44.20 fanout-score-rank=1 prefix-density=1.44 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=1.40 sequence-density-rank=1 fanout-score=44.20 fanout-score-rank=1 prefix-density=1.44 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Started job on | Dec 07 00:28:13 Started mapping on | Dec 07 00:28:13 Finished on | Dec 07 00:31:20 Mapping speed, Million of reads per hour | 1379.25 Number of input reads | 71644543 Average input read length | 144 UNIQUE READS: Uniquely mapped reads number | 65807473 Uniquely mapped reads % | 91.85% Average mapped length | 145.27 Number of splices: Total | 32287551 Number of splices: Annotated (sjdb) | 30475435 Number of splices: GT/AG | 31846238 Number of splices: GC/AG | 372707 Number of splices: AT/AC | 9479 Number of splices: Non-canonical | 59127 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.03 Insertion rate per base | 0.01% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1293043 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 316363 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.80% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4544027 4544027 4544027 N_multimapping 1293043 1293043 1293043 N_noFeature 2451256 33727434 33114871 N_ambiguous 1594426 81832 105593 UnstrandedReadsAssigned:61761791 PositiveStrandReadsAssigned:31998207 NegativeStrandReadsAssigned:32587009 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=147 echo kmer=143 SRR5270276 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270276-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 71,644,543 reads, 63,780,719 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52973 SRR5270276.ke.tsv 35125 SRR5270276.se.tsv 88098 total ==> SRR5270276.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 9.66983e-08 2.77196e-09 PNS24247 1044 945 180.439 4.58134 PNS24249 1928 1829 79.3043 1.04034 PNS24246 1044 945 180.439 4.58134 PNS24248 1044 945 180.439 4.58134 PNS24244 1471 1372 560.378 9.79987 PNS24243 293 194 19 2.34988 KQK14069 1603 1504 21392.9 341.283 KQK14071 474 375 1057.09 67.6351 ==> SRR5270276.se.tsv <== BRADI_1g14170v3 25482 BRADI_1g53295v3 63 BRADI_1g59795v3 2311 BRADI_1g07683v3 1 BRADI_1g00485v3 43 BRADI_1g20270v3 393 BRADI_1g74790v3 220 BRADI_1g09890v3 0 BRADI_1g77505v3 992 BRADI_1g48960v3 0 SRR5270276 completed mapping pipeline successfully