Starting /dee2/code/volunteer_pipeline.sh SRR5270277 current disk space = 1548136960000 free memory = 1603019388 SRR5270277 SRAfilesize 12d6b523c4e7f9f2589610eb12caa17b SRR5270277.sra SRR5270277.sra file validated SRR5270277 is single end SRR5270277 is conventional basespace SRR5270277 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270277_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.712 31.0 2.0 34.0 2.0 34.0 2 22.551 31.0 2.0 34.0 2.0 34.0 3 22.55725 31.0 2.0 34.0 2.0 34.0 4 22.35 32.0 2.0 34.0 2.0 34.0 5 22.13675 32.0 2.0 34.0 2.0 34.0 6 24.394 34.0 2.0 38.0 2.0 38.0 7 24.556 35.0 2.0 38.0 2.0 38.0 8 24.463 36.0 2.0 38.0 2.0 38.0 9 24.43725 36.0 2.0 38.0 2.0 38.0 10-14 24.273850000000003 36.0 2.0 38.0 2.0 38.0 15-19 23.995449999999998 36.0 2.0 38.0 2.0 38.0 20-24 23.56105 36.0 2.0 38.0 2.0 38.0 25-29 23.3048 35.8 2.0 38.0 2.0 38.0 30-34 23.060200000000002 35.8 2.0 38.0 2.0 38.0 35-39 22.88725 35.4 2.0 38.0 2.0 38.0 40-44 22.6746 34.4 2.0 38.0 2.0 38.0 45-49 22.537950000000002 34.8 2.0 38.0 2.0 38.0 50-54 22.37635 34.2 2.0 38.0 2.0 38.0 55-59 22.245749999999997 33.8 2.0 38.0 2.0 38.0 60-64 22.162249999999997 33.8 2.0 38.0 2.0 38.0 65-69 21.94545 33.4 2.0 38.0 2.0 38.0 70-74 21.76395 32.8 2.0 38.0 2.0 38.0 75-79 21.47705 31.6 2.0 38.0 2.0 38.0 80-84 21.18575 29.6 2.0 38.0 2.0 38.0 85-89 20.73255 27.2 2.0 38.0 2.0 38.0 90-94 20.836 28.4 2.0 38.0 2.0 38.0 95-99 20.8052 28.2 2.0 38.0 2.0 38.0 100-104 20.566 27.0 2.0 38.0 2.0 38.0 105-109 20.3956 25.8 2.0 38.0 2.0 38.0 110-114 20.12375 24.0 2.0 38.0 2.0 38.0 115-119 19.80875 20.6 2.0 38.0 2.0 38.0 120-124 19.6906 19.0 2.0 38.0 2.0 38.0 125-129 19.4313 15.0 2.0 38.0 2.0 38.0 130-134 18.8071 13.4 2.0 38.0 2.0 38.0 135-139 18.693800000000003 12.6 2.0 38.0 2.0 38.0 140-144 18.447300000000002 3.8 2.0 38.0 2.0 38.0 145-149 17.744300000000003 2.0 2.0 38.0 2.0 38.0 150 12.82525 2.0 2.0 29.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1099.0 3 140.0 4 103.0 5 61.0 6 52.0 7 44.0 8 28.0 9 29.0 10 23.0 11 31.0 12 30.0 13 30.0 14 35.0 15 33.0 16 20.0 17 33.0 18 36.0 19 28.0 20 22.0 21 20.0 22 22.0 23 18.0 24 17.0 25 17.0 26 28.0 27 31.0 28 27.0 29 24.0 30 38.0 31 30.0 32 47.0 33 57.0 34 85.0 35 111.0 36 280.0 37 1271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.265665458311755 24.520973588814083 15.277058518902123 32.93630243397204 2 18.22289156626506 30.622489959839356 27.585341365461847 23.569277108433734 3 19.201807228915662 30.948795180722893 22.414658634538153 27.434738955823295 4 21.636546184738954 35.81827309236948 18.950803212851405 23.59437751004016 5 21.993472257092645 35.67662565905096 20.71303037911122 21.616871704745165 6 18.00150640220939 38.06176249058499 20.38664323374341 23.550087873462214 7 16.01807682651268 32.48807431584233 29.299522972633696 22.1943258850113 8 18.101933216168717 32.91488827516947 23.148380617624905 25.83479789103691 9 19.10620135576199 31.65955310067788 23.976901832789355 25.257343710770776 10-14 18.904398473589072 36.62382004418558 20.516167905201847 23.9556135770235 15-19 17.800652774290736 35.626412252071304 21.73738388149636 24.835551092141603 20-24 18.101933216168717 35.756967110218426 21.18503640472006 24.956063268892795 25-29 18.69571765650886 34.986696119283096 21.276168482353533 25.04141774185451 30-34 18.268072289156624 36.44578313253012 20.38152610441767 24.90461847389558 35-39 17.866465863453815 36.96285140562249 20.376506024096386 24.794176706827308 40-44 18.288152610441767 36.661646586345384 20.266064257028113 24.78413654618474 45-49 18.72583965058487 37.3261709925197 20.106431045735228 23.8415583111602 50-54 17.87507531632858 36.60875677846957 19.87848965655754 25.637678248644306 55-59 17.87919867449917 36.782647989154995 20.82140884671386 24.51674448963197 60-64 18.33291488827517 36.60557368817474 20.326387145367814 24.735124278182276 65-69 17.75546070800904 38.56389656038162 19.086115992970125 24.594526738639217 70-74 17.42405222194326 38.4333417022345 18.920411749937234 25.22219432588501 75-79 17.800652774290736 38.79989957318604 18.38312829525483 25.01631935726839 80-84 16.987195581220185 39.38237509415014 18.749686166206377 24.8807431584233 85-89 17.554607080090385 39.70374089881999 18.132061260356515 24.609590760733116 90-94 17.514436354506653 39.20662816972131 18.71955812201858 24.559377353753455 95-99 17.183027868440874 38.8802410243535 18.73462214411248 25.202108963093146 100-104 17.378860155661563 39.949786593020335 18.19733868943008 24.474014561888026 105-109 17.152899824253076 40.13055485814713 18.01657042430329 24.69997489329651 110-114 16.761235249811698 40.060256088375596 18.227466733617874 24.95104192819483 115-119 16.7913632939995 39.82425307557118 18.353000251067034 25.03138337936229 120-124 15.927692693949286 41.62189304544313 17.41903088124529 25.03138337936229 125-129 16.931960833542554 40.60256088375596 17.8207381370826 24.64474014561888 130-134 16.484233781883912 41.0473990761197 17.553725647720427 24.914641494275962 135-139 16.33442129048456 41.33065528496108 17.172985187044944 25.161938237509414 140-144 17.347861016268325 40.80638682466359 17.076722233380195 24.76902992568789 145-149 15.874132904393285 41.76636171710063 17.16095305117121 25.198552327334873 150 15.415515942756716 47.77805674114989 15.465729349736378 21.340697966357016 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 21.0 1 14.0 2 5.5 3 4.0 4 2.0 5 3.5 6 5.5 7 5.0 8 6.0 9 5.0 10 6.0 11 6.5 12 9.0 13 13.0 14 11.5 15 10.0 16 11.0 17 16.5 18 20.0 19 21.5 20 27.0 21 24.0 22 24.5 23 35.5 24 38.0 25 41.5 26 50.5 27 42.0 28 37.5 29 48.0 30 57.0 31 63.0 32 65.0 33 77.0 34 76.5 35 73.0 36 82.0 37 94.0 38 106.0 39 118.5 40 129.0 41 140.0 42 147.5 43 136.5 44 151.0 45 157.0 46 141.5 47 145.0 48 140.5 49 124.5 50 116.5 51 100.5 52 92.0 53 85.5 54 81.0 55 76.5 56 63.5 57 70.5 58 66.5 59 59.0 60 56.5 61 50.0 62 50.0 63 41.0 64 30.5 65 36.0 66 35.0 67 30.0 68 23.0 69 15.0 70 12.0 71 9.0 72 8.0 73 5.5 74 2.0 75 1.0 76 1.5 77 0.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.4 3 0.4 4 0.4 5 0.42500000000000004 6 0.42500000000000004 7 0.42500000000000004 8 0.42500000000000004 9 0.42500000000000004 10-14 0.42 15-19 0.42500000000000004 20-24 0.42500000000000004 25-29 0.40499999999999997 30-34 0.4 35-39 0.4 40-44 0.4 45-49 0.40499999999999997 50-54 0.42 55-59 0.415 60-64 0.42500000000000004 65-69 0.42500000000000004 70-74 0.42500000000000004 75-79 0.42500000000000004 80-84 0.42500000000000004 85-89 0.42500000000000004 90-94 0.42500000000000004 95-99 0.42500000000000004 100-104 0.42500000000000004 105-109 0.42500000000000004 110-114 0.42500000000000004 115-119 0.42500000000000004 120-124 0.42500000000000004 125-129 0.42500000000000004 130-134 0.42 135-139 0.42500000000000004 140-144 0.42 145-149 0.53 150 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56709956709958 97.75 2 0.2801120448179272 0.5499999999999999 3 0.05092946269416857 0.15 4 0.025464731347084286 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025464731347084286 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05092946269416857 1.275 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 37 0.9249999999999999 TruSeq Adapter, Index 11 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 14 0.35000000000000003 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0125 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6000000000000001 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.175 0.0 0.0 0.0 0.0 118-119 1.2999999999999998 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 1.8625 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138 3.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAAA 10 0.0069790767 143.96251 8 >>END_MODULE Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294044 spots for SRR5270277.sra Written 4294044 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra Read 4294040 spots for SRR5270277.sra Written 4294040 spots for SRR5270277.sra SRR ids: ['SRR5270277.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6i43xji0 SRR5270277.sra spots: 85880804 blocks: [[1, 4294040], [4294041, 8588080], [8588081, 12882120], [12882121, 17176160], [17176161, 21470200], [21470201, 25764240], [25764241, 30058280], [30058281, 34352320], [34352321, 38646360], [38646361, 42940400], [42940401, 47234440], [47234441, 51528480], [51528481, 55822520], [55822521, 60116560], [60116561, 64410600], [64410601, 68704640], [68704641, 72998680], [72998681, 77292720], [77292721, 81586760], [81586761, 85880804]] SRR5270277 file size 31564648 SRR5270277 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270277 SRR5270277_1.fastq Input file: SRR5270277_1.fastq trimmed: SRR5270277-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:23:34 2024 >> started Sat Dec 7 00:24:50 2024 >> done (75.751s) 85880804 reads processed; of these: 1236913 ( 1.44%) short reads filtered out after trimming by size control 4103497 ( 4.78%) empty reads filtered out after trimming by size control 80540394 (93.78%) reads available; of these: 32949660 (40.91%) trimmed reads available after processing 47590734 (59.09%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 62814 0.08% 19 60903 0.08% 20 58087 0.07% 21 60208 0.07% 22 54149 0.07% 23 52950 0.07% 24 51444 0.06% 25 48330 0.06% 26 48885 0.06% 27 49272 0.06% 28 46936 0.06% 29 44835 0.06% 30 43489 0.05% 31 43031 0.05% 32 42574 0.05% 33 48850 0.06% 34 40407 0.05% 35 42177 0.05% 36 40638 0.05% 37 41036 0.05% 38 40329 0.05% 39 41649 0.05% 40 43234 0.05% 41 42604 0.05% 42 43105 0.05% 43 42171 0.05% 44 41860 0.05% 45 43664 0.05% 46 43526 0.05% 47 44617 0.06% 48 42971 0.05% 49 42170 0.05% 50 41285 0.05% 51 42178 0.05% 52 42822 0.05% 53 42076 0.05% 54 43385 0.05% 55 44558 0.06% 56 46574 0.06% 57 47722 0.06% 58 47925 0.06% 59 49380 0.06% 60 52394 0.07% 61 55306 0.07% 62 59800 0.07% 63 59641 0.07% 64 62372 0.08% 65 75910 0.09% 66 103351 0.13% 67 240471 0.30% 68 133992 0.17% 69 84141 0.10% 70 70454 0.09% 71 74540 0.09% 72 77543 0.10% 73 99322 0.12% 74 71376 0.09% 75 66577 0.08% 76 65661 0.08% 77 65954 0.08% 78 68696 0.09% 79 68055 0.08% 80 68598 0.09% 81 70280 0.09% 82 72504 0.09% 83 74660 0.09% 84 75999 0.09% 85 78990 0.10% 86 80784 0.10% 87 82038 0.10% 88 84353 0.10% 89 86432 0.11% 90 88898 0.11% 91 91940 0.11% 92 96083 0.12% 93 97543 0.12% 94 100218 0.12% 95 104909 0.13% 96 108865 0.14% 97 111516 0.14% 98 113018 0.14% 99 116796 0.15% 100 118861 0.15% 101 123701 0.15% 102 125475 0.16% 103 129818 0.16% 104 133403 0.17% 105 137690 0.17% 106 145205 0.18% 107 149099 0.19% 108 151541 0.19% 109 154454 0.19% 110 159331 0.20% 111 162535 0.20% 112 167012 0.21% 113 173661 0.22% 114 177905 0.22% 115 183940 0.23% 116 189195 0.23% 117 194266 0.24% 118 198193 0.25% 119 153798 0.19% 120 156266 0.19% 121 160882 0.20% 122 166855 0.21% 123 173060 0.21% 124 181272 0.23% 125 189793 0.24% 126 189073 0.23% 127 195917 0.24% 128 204018 0.25% 129 212122 0.26% 130 222500 0.28% 131 233040 0.29% 132 239544 0.30% 133 251342 0.31% 134 268729 0.33% 135 281935 0.35% 136 298605 0.37% 137 312985 0.39% 138 342934 0.43% 139 377264 0.47% 140 406496 0.50% 141 456781 0.57% 142 531338 0.66% 143 609982 0.76% 144 740689 0.92% 145 837073 1.04% 146 1146063 1.42% 147 1726475 2.14% 148 2842342 3.53% 149 10464402 12.99% 150 47590734 59.09% 80540394 reads passed initial QC criterion=sequence-density sequence-density=1.91 sequence-density-rank=1 fanout-score=53.63 fanout-score-rank=1 prefix-density=2.37 prefix-fanout=43.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=1.91 sequence-density-rank=1 fanout-score=53.63 fanout-score-rank=1 prefix-density=2.37 prefix-fanout=43.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA Started job on | Dec 07 00:25:13 Started mapping on | Dec 07 00:25:13 Finished on | Dec 07 00:27:48 Mapping speed, Million of reads per hour | 1870.62 Number of input reads | 80540394 Average input read length | 141 UNIQUE READS: Uniquely mapped reads number | 75248136 Uniquely mapped reads % | 93.43% Average mapped length | 142.56 Number of splices: Total | 39058860 Number of splices: Annotated (sjdb) | 36836244 Number of splices: GT/AG | 38519993 Number of splices: GC/AG | 455512 Number of splices: AT/AC | 12841 Number of splices: Non-canonical | 70514 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 1.88 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1670575 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 212462 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3621683 3621683 3621683 N_multimapping 1670575 1670575 1670575 N_noFeature 3232305 41440212 35649085 N_ambiguous 1592779 90188 121421 UnstrandedReadsAssigned:70423052 PositiveStrandReadsAssigned:33717736 NegativeStrandReadsAssigned:39477630 Dataset is classified unstranded MeadianReadLen=149 20thPercentileLength=107 echo kmer=103 SRR5270277 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270277-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 80,540,394 reads, 71,768,999 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,285 rounds 52973 SRR5270277.ke.tsv 35125 SRR5270277.se.tsv 88098 total ==> SRR5270277.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 70.6306 1.94217 PNS24247 1044 945 200.822 4.89102 PNS24249 1928 1829 80.2503 1.00984 PNS24246 1044 945 200.822 4.89102 PNS24248 1044 945 200.822 4.89102 PNS24244 1471 1372 401.653 6.73776 PNS24243 293 194 19 2.25409 KQK14069 1603 1504 13550.6 207.363 KQK14071 474 375 1025.99 62.9694 ==> SRR5270277.se.tsv <== BRADI_1g14170v3 18303 BRADI_1g53295v3 93 BRADI_1g59795v3 2425 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 852 BRADI_1g74790v3 256 BRADI_1g09890v3 0 BRADI_1g77505v3 916 BRADI_1g48960v3 1 SRR5270277 completed mapping pipeline successfully