Starting /dee2/code/volunteer_pipeline.sh SRR5270278 current disk space = 1548388474880 free memory = 1505870096 SRR5270278 SRAfilesize 6900c847c5e980f613c13da333a5703c SRR5270278.sra SRR5270278.sra file validated SRR5270278 is single end SRR5270278 is conventional basespace SRR5270278 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270278_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4 33.0 32.0 34.0 18.0 34.0 2 32.0605 33.0 32.0 34.0 28.0 34.0 3 32.0085 33.0 33.0 34.0 28.0 34.0 4 32.149 33.0 33.0 34.0 31.0 34.0 5 32.074 33.0 33.0 34.0 30.0 34.0 6 35.9065 38.0 37.0 38.0 33.0 38.0 7 36.09725 38.0 37.0 38.0 33.0 38.0 8 36.22775 38.0 38.0 38.0 34.0 38.0 9 36.253 38.0 38.0 38.0 34.0 38.0 10-14 36.153150000000004 38.0 38.0 38.0 33.8 38.0 15-19 36.02315 38.0 38.0 38.0 33.2 38.0 20-24 35.942550000000004 38.0 38.0 38.0 33.0 38.0 25-29 35.84135 38.0 38.0 38.0 32.6 38.0 30-34 35.713100000000004 38.0 38.0 38.0 32.0 38.0 35-39 35.44255 38.0 37.2 38.0 29.4 38.0 40-44 35.377449999999996 38.0 37.0 38.0 29.0 38.0 45-49 35.239850000000004 38.0 37.0 38.0 29.0 38.0 50-54 35.1014 38.0 37.0 38.0 28.6 38.0 55-59 34.86084999999999 38.0 36.6 38.0 27.2 38.0 60-64 34.637 38.0 36.2 38.0 26.0 38.0 65-69 34.4773 38.0 36.0 38.0 25.4 38.0 70-74 34.10865 38.0 35.6 38.0 22.8 38.0 75-79 33.51505 38.0 34.4 38.0 16.0 38.0 80-84 33.30460000000001 38.0 34.4 38.0 15.4 38.0 85-89 33.0334 38.0 34.0 38.0 15.0 38.0 90-94 32.6954 38.0 33.8 38.0 15.0 38.0 95-99 32.4533 38.0 33.8 38.0 14.8 38.0 100-104 31.742849999999997 38.0 31.4 38.0 14.0 38.0 105-109 31.309500000000003 38.0 30.2 38.0 13.0 38.0 110-114 30.81775 38.0 28.4 38.0 13.0 38.0 115-119 30.233650000000004 37.6 26.4 38.0 4.2 38.0 120-124 29.670749999999998 37.2 24.6 38.0 2.0 38.0 125-129 28.910449999999997 36.4 22.6 38.0 2.0 38.0 130-134 28.027949999999997 36.0 16.2 38.0 2.0 38.0 135-139 27.10795 35.2 14.2 38.0 2.0 38.0 140-144 26.0631 35.0 11.0 38.0 2.0 38.0 145-149 24.19245 34.2 2.0 38.0 2.0 38.0 150 19.082 23.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 13.0 4 6.0 5 6.0 6 9.0 7 5.0 8 6.0 9 6.0 10 10.0 11 12.0 12 13.0 13 13.0 14 11.0 15 23.0 16 21.0 17 23.0 18 39.0 19 41.0 20 26.0 21 44.0 22 38.0 23 41.0 24 50.0 25 62.0 26 64.0 27 80.0 28 90.0 29 119.0 30 154.0 31 163.0 32 200.0 33 230.0 34 291.0 35 289.0 36 329.0 37 1436.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.20137602540355 15.98306430272559 7.912146070388992 34.90341360148187 2 24.103335841484828 23.952846751943817 31.15124153498871 20.792575871582645 3 23.457099849473156 20.84796788760662 27.972905168088307 27.722027094831915 4 25.489703666499246 29.33199397287795 19.663485685585133 25.51481667503767 5 27.578419071518194 32.220828105395235 21.053952321204516 19.14680050188206 6 24.03314917127072 32.87292817679558 22.375690607734807 20.718232044198896 7 18.75941737820191 22.576594676042188 37.82019085886489 20.84379708689101 8 19.236564540431942 26.192867905575092 27.523857358111503 27.046710195881467 9 24.761426418884984 20.542440984429934 30.51230537418383 24.183827222501257 10-14 23.997990959316926 26.55449522852838 24.128578603716726 25.31893520843797 15-19 24.17880462079357 25.193370165745854 25.90155700652938 24.72626820693119 20-24 24.269211451531895 26.378704168759416 25.444500251130087 23.907584128578605 25-29 24.086161879895563 26.19501908013657 24.794135368547902 24.924683671419963 30-34 24.109877969165872 25.03389745392457 26.21905288002812 24.637171696881435 35-39 23.874529485570893 25.63111668757842 25.77164366373902 24.722710163111667 40-44 24.646119867483186 25.24344945286618 25.765485393032826 24.344945286617808 45-49 24.62341835709982 25.090379594296042 25.65274151436031 24.633460534243824 50-54 23.550979407333 25.399296835760925 25.53992968357609 25.509794073329985 55-59 24.394776494224008 25.41938724259166 26.09743847312908 24.08839779005525 60-64 24.38975389251632 26.49924660974385 24.766449020592667 24.344550477147163 65-69 23.525866398794577 28.337518834756402 24.369663485685585 23.766951280763436 70-74 23.731793068809644 27.749874434957306 24.585635359116022 23.932697137117025 75-79 23.405323957810147 26.68006027122049 25.03264691109995 24.881968859869414 80-84 23.95781014565545 26.102461074836764 25.554997488699144 24.384731290808638 85-89 23.636363636363637 26.539427423405325 25.05775991963837 24.766449020592667 90-94 23.646408839779006 25.791059768960324 25.650426921145154 24.91210447011552 95-99 23.455549974886992 25.95178302360623 25.655449522852834 24.937217478653942 100-104 23.490708186840784 26.865896534404822 25.18834756403817 24.455047714716223 105-109 24.304369663485687 26.86087393269714 24.41988950276243 24.414866901054747 110-114 23.8121546961326 26.800602712204924 24.78151682571572 24.605725765946758 115-119 23.787041687594172 27.152184831742844 24.434957307885487 24.625816172777498 120-124 24.324460070316423 26.765444500251128 24.83676544450025 24.073329984932197 125-129 23.716725263686588 27.01657458563536 24.72626820693119 24.54043194374686 130-134 24.093420391762933 27.343043696634854 24.25916624811652 24.304369663485687 135-139 23.972877950778503 27.53390256152687 23.907584128578605 24.585635359116022 140-144 24.193872425916624 27.348066298342545 24.073329984932197 24.384731290808638 145-149 23.92483922829582 27.682877813504824 23.648512861736336 24.74377009646302 150 22.55148166750377 28.90507282772476 24.234053239578103 24.30939226519337 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 14.0 1 8.5 2 2.5 3 2.0 4 1.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 3.5 22 3.0 23 1.5 24 2.0 25 1.0 26 1.5 27 8.0 28 11.0 29 9.5 30 10.5 31 11.5 32 18.5 33 23.5 34 33.0 35 44.0 36 56.5 37 74.5 38 85.5 39 98.0 40 126.5 41 151.5 42 166.5 43 174.0 44 184.5 45 190.5 46 185.5 47 194.5 48 189.5 49 168.0 50 150.5 51 141.5 52 134.0 53 126.0 54 109.5 55 96.0 56 98.0 57 94.5 58 91.5 59 77.5 60 77.5 61 74.0 62 66.0 63 70.5 64 60.5 65 58.5 66 56.0 67 47.0 68 33.5 69 23.0 70 17.0 71 12.0 72 9.0 73 7.5 74 6.0 75 3.0 76 1.5 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.525 2 0.325 3 0.35000000000000003 4 0.44999999999999996 5 0.375 6 0.44999999999999996 7 0.44999999999999996 8 0.44999999999999996 9 0.44999999999999996 10-14 0.44999999999999996 15-19 0.44999999999999996 20-24 0.44999999999999996 25-29 0.42 30-34 0.43499999999999994 35-39 0.375 40-44 0.38999999999999996 45-49 0.42 50-54 0.44999999999999996 55-59 0.44999999999999996 60-64 0.44999999999999996 65-69 0.44999999999999996 70-74 0.44999999999999996 75-79 0.44999999999999996 80-84 0.44999999999999996 85-89 0.44999999999999996 90-94 0.44999999999999996 95-99 0.44999999999999996 100-104 0.44999999999999996 105-109 0.44999999999999996 110-114 0.44999999999999996 115-119 0.44999999999999996 120-124 0.44999999999999996 125-129 0.44999999999999996 130-134 0.44999999999999996 135-139 0.44999999999999996 140-144 0.44999999999999996 145-149 0.48 150 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.25469031097404 96.55 2 0.5911076843998971 1.15 3 0.02570033410434336 0.075 4 0.02570033410434336 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02570033410434336 0.2 9 0.02570033410434336 0.22499999999999998 >10 0.02570033410434336 0.3 >50 0.02570033410434336 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 56 1.4000000000000001 TruSeq Adapter, Index 10 (100% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 12 0.3 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 8 0.2 TruSeq Adapter, Index 10 (98% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6000000000000001 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.1124999999999998 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.5499999999999998 0.0 0.0 0.0 0.0 132-133 1.6749999999999998 0.0 0.0 0.0 0.0 134-135 1.7999999999999998 0.0 0.0 0.0 0.0 136-137 1.9375 0.0 0.0 0.0 0.0 138 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAGG 10 0.006970298 144.0 2 GCAAGCT 10 0.006970298 144.0 8 GAAAAGG 10 0.006970298 144.0 2 CGAGGAT 10 0.006970298 144.0 8 CGGCAAG 10 0.006970298 144.0 6 GGAAAAG 10 0.006970298 144.0 1 AAGAGCG 20 3.684314E-4 108.0 7 GATCGGA 20 3.684314E-4 108.0 1 TCGGAAG 20 3.684314E-4 108.0 3 ATCGGAA 20 3.684314E-4 108.0 2 GAAGAGC 25 8.947623E-4 86.399994 6 CGGAAGA 25 8.947623E-4 86.399994 4 GGAAGAG 25 8.947623E-4 86.399994 5 AAAAAAA 110 5.762249E-7 14.4 60-64 >>END_MODULE Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055575 spots for SRR5270278.sra Written 5055575 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra Read 5055557 spots for SRR5270278.sra Written 5055557 spots for SRR5270278.sra SRR ids: ['SRR5270278.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_au24sdgl SRR5270278.sra spots: 101111158 blocks: [[1, 5055557], [5055558, 10111114], [10111115, 15166671], [15166672, 20222228], [20222229, 25277785], [25277786, 30333342], [30333343, 35388899], [35388900, 40444456], [40444457, 45500013], [45500014, 50555570], [50555571, 55611127], [55611128, 60666684], [60666685, 65722241], [65722242, 70777798], [70777799, 75833355], [75833356, 80888912], [80888913, 85944469], [85944470, 91000026], [91000027, 96055583], [96055584, 101111158]] SRR5270278 file size 37165269 SRR5270278 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270278 SRR5270278_1.fastq Input file: SRR5270278_1.fastq trimmed: SRR5270278-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:33:57 2024 >> started Sat Dec 7 00:44:54 2024 >> done (656.774s) 101111158 reads processed; of these: 275171 ( 0.27%) short reads filtered out after trimming by size control 2410370 ( 2.38%) empty reads filtered out after trimming by size control 98425617 (97.34%) reads available; of these: 33875237 (34.42%) trimmed reads available after processing 64550380 (65.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9958 0.01% 19 10030 0.01% 20 10305 0.01% 21 11934 0.01% 22 11947 0.01% 23 13085 0.01% 24 15059 0.02% 25 39301 0.04% 26 22057 0.02% 27 18876 0.02% 28 16869 0.02% 29 17743 0.02% 30 14918 0.02% 31 18534 0.02% 32 21468 0.02% 33 36607 0.04% 34 16556 0.02% 35 16359 0.02% 36 14942 0.02% 37 14384 0.01% 38 13857 0.01% 39 16512 0.02% 40 17969 0.02% 41 20645 0.02% 42 19301 0.02% 43 16757 0.02% 44 18604 0.02% 45 16964 0.02% 46 17576 0.02% 47 24424 0.02% 48 17525 0.02% 49 18985 0.02% 50 19013 0.02% 51 18111 0.02% 52 18437 0.02% 53 18650 0.02% 54 21336 0.02% 55 21433 0.02% 56 23965 0.02% 57 25169 0.03% 58 25761 0.03% 59 30398 0.03% 60 32050 0.03% 61 36855 0.04% 62 55107 0.06% 63 47456 0.05% 64 49075 0.05% 65 83882 0.09% 66 154507 0.16% 67 446910 0.45% 68 306145 0.31% 69 139949 0.14% 70 86100 0.09% 71 94543 0.10% 72 91000 0.09% 73 180512 0.18% 74 63977 0.07% 75 51213 0.05% 76 47168 0.05% 77 47207 0.05% 78 58380 0.06% 79 47851 0.05% 80 45577 0.05% 81 46138 0.05% 82 47123 0.05% 83 47598 0.05% 84 49776 0.05% 85 51851 0.05% 86 51611 0.05% 87 52830 0.05% 88 57235 0.06% 89 57259 0.06% 90 59836 0.06% 91 61757 0.06% 92 63479 0.06% 93 64955 0.07% 94 68406 0.07% 95 70009 0.07% 96 73763 0.07% 97 76347 0.08% 98 77678 0.08% 99 80889 0.08% 100 84296 0.09% 101 86924 0.09% 102 90487 0.09% 103 93351 0.09% 104 95387 0.10% 105 99911 0.10% 106 104970 0.11% 107 108604 0.11% 108 112178 0.11% 109 116581 0.12% 110 122607 0.12% 111 126061 0.13% 112 132467 0.13% 113 138450 0.14% 114 142110 0.14% 115 147950 0.15% 116 151701 0.15% 117 161194 0.16% 118 166156 0.17% 119 139897 0.14% 120 147057 0.15% 121 158120 0.16% 122 166507 0.17% 123 175759 0.18% 124 184682 0.19% 125 190308 0.19% 126 194635 0.20% 127 208377 0.21% 128 218060 0.22% 129 222119 0.23% 130 239955 0.24% 131 248737 0.25% 132 266234 0.27% 133 278581 0.28% 134 295538 0.30% 135 312446 0.32% 136 341986 0.35% 137 357667 0.36% 138 385765 0.39% 139 419069 0.43% 140 472864 0.48% 141 538926 0.55% 142 608563 0.62% 143 721262 0.73% 144 857186 0.87% 145 1067862 1.08% 146 1423110 1.45% 147 2043730 2.08% 148 3456744 3.51% 149 11135778 11.31% 150 64550380 65.58% 98425617 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=51.29 fanout-score-rank=2 prefix-density=1.24 prefix-fanout=42.2 sequence=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=67.75 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGC Started job on | Dec 07 00:47:58 Started mapping on | Dec 07 00:47:58 Finished on | Dec 07 01:40:09 Mapping speed, Million of reads per hour | 113.17 Number of input reads | 98425617 Average input read length | 144 UNIQUE READS: Uniquely mapped reads number | 91597876 Uniquely mapped reads % | 93.06% Average mapped length | 145.42 Number of splices: Total | 49182172 Number of splices: Annotated (sjdb) | 46328761 Number of splices: GT/AG | 48520093 Number of splices: GC/AG | 567318 Number of splices: AT/AC | 16249 Number of splices: Non-canonical | 78512 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.99 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1845881 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 267110 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.69% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4981860 4981860 4981860 N_multimapping 1845881 1845881 1845881 N_noFeature 4075157 47342426 46612457 N_ambiguous 1963177 117938 139867 UnstrandedReadsAssigned:85559542 PositiveStrandReadsAssigned:44137512 NegativeStrandReadsAssigned:44845552 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR5270278 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270278-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 98,425,617 reads, 88,182,289 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR5270278.ke.tsv 35125 SRR5270278.se.tsv 88098 total ==> SRR5270278.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 87.9897 1.97969 PNS24247 1044 945 264.232 5.26558 PNS24249 1928 1829 128.555 1.32364 PNS24246 1044 945 264.232 5.26558 PNS24248 1044 945 264.232 5.26558 PNS24244 1471 1372 419.758 5.76151 PNS24243 293 194 37 3.59163 KQK14069 1603 1504 21116.4 264.402 KQK14071 474 375 1165.57 58.5326 ==> SRR5270278.se.tsv <== BRADI_1g14170v3 26461 BRADI_1g53295v3 108 BRADI_1g59795v3 3419 BRADI_1g07683v3 0 BRADI_1g00485v3 79 BRADI_1g20270v3 973 BRADI_1g74790v3 262 BRADI_1g09890v3 1 BRADI_1g77505v3 1161 BRADI_1g48960v3 0 SRR5270278 completed mapping pipeline successfully