Starting /dee2/code/volunteer_pipeline.sh SRR5270279 current disk space = 1548388831232 free memory = 1600708552 SRR5270279 SRAfilesize 8cce230b97b036761bbf0c9410276f7a SRR5270279.sra SRR5270279.sra file validated SRR5270279 is single end SRR5270279 is conventional basespace SRR5270279 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.77625 33.0 32.0 34.0 25.0 34.0 2 31.76825 33.0 32.0 34.0 27.0 34.0 3 31.7745 33.0 33.0 34.0 28.0 34.0 4 31.8265 33.0 33.0 34.0 28.0 34.0 5 31.85075 33.0 33.0 34.0 29.0 34.0 6 35.444 38.0 37.0 38.0 30.0 38.0 7 35.629 38.0 37.0 38.0 31.0 38.0 8 35.78825 38.0 37.0 38.0 31.0 38.0 9 35.7455 38.0 38.0 38.0 31.0 38.0 10-14 35.69855 38.0 38.0 38.0 30.8 38.0 15-19 35.517399999999995 38.0 37.6 38.0 30.6 38.0 20-24 35.444100000000006 38.0 37.4 38.0 29.0 38.0 25-29 35.2789 38.0 37.2 38.0 28.8 38.0 30-34 35.06270000000001 38.0 37.0 38.0 27.6 38.0 35-39 34.9302 38.0 37.0 38.0 27.6 38.0 40-44 34.809749999999994 38.0 36.8 38.0 27.2 38.0 45-49 34.6154 38.0 36.2 38.0 27.0 38.0 50-54 34.3683 38.0 36.0 38.0 25.4 38.0 55-59 34.2758 38.0 36.0 38.0 24.6 38.0 60-64 34.06974999999999 38.0 35.8 38.0 19.4 38.0 65-69 33.73115 38.0 35.0 38.0 16.0 38.0 70-74 33.3937 38.0 34.6 38.0 15.8 38.0 75-79 32.7759 38.0 34.0 38.0 15.0 38.0 80-84 32.46665 38.0 33.6 38.0 15.0 38.0 85-89 32.1328 38.0 32.6 38.0 14.8 38.0 90-94 31.77135 38.0 31.2 38.0 14.0 38.0 95-99 31.479599999999998 38.0 30.6 38.0 13.4 38.0 100-104 30.932050000000004 38.0 28.8 38.0 13.0 38.0 105-109 30.441450000000003 38.0 27.4 38.0 4.2 38.0 110-114 29.92425 37.2 25.6 38.0 2.0 38.0 115-119 29.364700000000006 37.0 23.0 38.0 2.0 38.0 120-124 28.86605 36.6 22.2 38.0 2.0 38.0 125-129 27.895550000000004 35.8 17.4 38.0 2.0 38.0 130-134 27.007350000000002 35.2 14.4 38.0 2.0 38.0 135-139 26.01355 35.0 13.2 38.0 2.0 38.0 140-144 24.999200000000002 35.0 2.0 38.0 2.0 38.0 145-149 23.245449999999998 33.8 2.0 38.0 2.0 38.0 150 18.36025 21.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 17.0 4 7.0 5 8.0 6 17.0 7 11.0 8 12.0 9 5.0 10 8.0 11 17.0 12 23.0 13 19.0 14 14.0 15 35.0 16 23.0 17 21.0 18 49.0 19 45.0 20 33.0 21 47.0 22 47.0 23 44.0 24 50.0 25 68.0 26 78.0 27 101.0 28 116.0 29 138.0 30 119.0 31 163.0 32 185.0 33 218.0 34 235.0 35 246.0 36 325.0 37 1404.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.032174364296836 16.86559418785677 9.185262065386611 29.91696938245978 2 25.37088257480513 21.87578576816696 32.05934121196882 20.69399044505909 3 23.113682092555333 23.365191146881287 27.590543259557343 25.930583501006037 4 27.938585451799646 27.5610369997483 18.927762396174174 25.572615152277876 5 28.636134876698538 30.926019124308002 20.86059386009059 19.577252138902868 6 24.6161590737478 33.47596274855273 21.243392902089102 20.66448527561037 7 20.51346589478983 21.31890259249937 36.72287943619431 21.444752076516487 8 20.73999496602064 24.439969796123837 27.00729927007299 27.81273596778253 9 25.82431412031211 21.193053108482253 27.485527309338032 25.49710546186761 10-14 25.451799647621442 26.216964510445507 23.458343820790333 24.872892021142714 15-19 24.887993959224765 24.782280392650392 25.446765668260763 24.882959979864083 20-24 24.438739555018625 25.994160877881807 25.03271921876573 24.534380348333837 25-29 24.311672622942567 26.204258317813462 25.237831580007047 24.246237479236925 30-34 24.37207429405547 25.922383852619923 25.24286505259979 24.462676800724818 35-39 24.3935581278309 25.86814292903875 25.118268746854554 24.620030196275795 40-44 24.389752881372992 25.184961497810658 25.456741657858977 24.96854396295737 45-49 24.568379725172395 24.83515377258771 25.323400614083656 25.27306588815624 50-54 24.39969796123836 24.51044550717342 25.693430656934307 25.396425874653914 55-59 24.017115529826327 25.225270576390635 25.889755852001006 24.86785804178203 60-64 24.36446010571357 26.388119808708783 25.059149257488045 24.188270828089607 65-69 23.04052353385351 28.24565819280141 24.59602315630506 24.117795117040018 70-74 23.956707777498114 27.777498112257742 24.304052353385348 23.9617417568588 75-79 23.986911653662222 26.519003272086582 24.671532846715326 24.82255222753587 80-84 24.22854266297508 25.945129624968537 25.114523030455576 24.711804681600803 85-89 24.354392146992197 26.544173168890005 24.067455323433173 25.033979360684622 90-94 24.359426126352883 25.834382079033475 24.913163856028188 24.89302793858545 95-99 24.520513465894787 26.453561540397686 24.304052353385348 24.721872640322175 100-104 24.747042537125598 26.40322174679084 24.480241631009314 24.36949408507425 105-109 24.18323684872892 26.247168386609616 24.721872640322175 24.847722124339292 110-114 24.38963000251699 26.977095393908883 24.102693178957963 24.53058142461616 115-119 23.726339105920257 26.49013290374547 24.854007249295208 24.929520741039067 120-124 23.82079033475963 26.508935313365217 24.71683866096149 24.95343569091367 125-129 24.394663981877674 27.102944877926 24.349358167631515 24.153032972564812 130-134 24.355618203785742 27.84937575513492 23.801852597664116 23.993153443415224 135-139 24.223508683614398 27.631512710797885 23.629499119053612 24.515479486534105 140-144 23.664736974578403 27.495595268059404 23.881198087087842 24.958469670274354 145-149 23.92727639000806 27.175664786462526 23.861804995970992 25.035253827558417 150 23.91140196325195 27.359677825320915 23.68487289202114 25.044047319405994 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 29.0 1 20.0 2 6.0 3 2.0 4 2.0 5 2.5 6 2.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.5 24 2.5 25 2.0 26 1.5 27 2.0 28 6.0 29 8.5 30 10.0 31 14.0 32 16.5 33 18.0 34 22.5 35 34.0 36 51.0 37 65.5 38 79.0 39 101.0 40 129.5 41 144.5 42 155.5 43 164.5 44 159.0 45 165.5 46 193.0 47 202.0 48 190.5 49 174.5 50 153.0 51 142.0 52 138.5 53 120.0 54 100.0 55 103.0 56 94.0 57 80.0 58 80.5 59 87.0 60 85.5 61 82.5 62 83.5 63 82.5 64 71.5 65 61.0 66 55.5 67 47.5 68 45.5 69 35.0 70 24.5 71 20.0 72 15.0 73 9.5 74 5.5 75 2.5 76 1.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.575 3 0.6 4 0.675 5 0.65 6 0.675 7 0.675 8 0.675 9 0.675 10-14 0.675 15-19 0.675 20-24 0.67 25-29 0.6649999999999999 30-34 0.6649999999999999 35-39 0.65 40-44 0.655 45-49 0.6649999999999999 50-54 0.675 55-59 0.675 60-64 0.675 65-69 0.675 70-74 0.675 75-79 0.675 80-84 0.675 85-89 0.675 90-94 0.675 95-99 0.675 100-104 0.675 105-109 0.675 110-114 0.675 115-119 0.6799999999999999 120-124 0.675 125-129 0.675 130-134 0.6799999999999999 135-139 0.675 140-144 0.675 145-149 0.72 150 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04145077720207 95.575 2 0.6735751295336788 1.3 3 0.05181347150259067 0.15 4 0.07772020725388601 0.3 5 0.025906735751295335 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.10362694300518134 1.175 >50 0.025906735751295335 1.375 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 55 1.375 TruSeq Adapter, Index 9 (100% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATG 11 0.27499999999999997 TruSeq Adapter, Index 9 (100% over 49bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.475 0.0 0.0 0.0 0.0 2 0.475 0.0 0.0 0.0 0.0 3 0.475 0.0 0.0 0.0 0.0 4 0.475 0.0 0.0 0.0 0.0 5 0.475 0.0 0.0 0.0 0.0 6 0.475 0.0 0.0 0.0 0.0 7 0.475 0.0 0.0 0.0 0.0 8 0.475 0.0 0.0 0.0 0.0 9 0.475 0.0 0.0 0.0 0.0 10-11 0.475 0.0 0.0 0.0 0.0 12-13 0.475 0.0 0.0 0.0 0.0 14-15 0.475 0.0 0.0 0.0 0.0 16-17 0.475 0.0 0.0 0.0 0.0 18-19 0.475 0.0 0.0 0.0 0.0 20-21 0.475 0.0 0.0 0.0 0.0 22-23 0.475 0.0 0.0 0.0 0.0 24-25 0.475 0.0 0.0 0.0 0.0 26-27 0.475 0.0 0.0 0.0 0.0 28-29 0.475 0.0 0.0 0.0 0.0 30-31 0.475 0.0 0.0 0.0 0.0 32-33 0.475 0.0 0.0 0.0 0.0 34-35 0.475 0.0 0.0 0.0 0.0 36-37 0.475 0.0 0.0 0.0 0.0 38-39 0.475 0.0 0.0 0.0 0.0 40-41 0.5 0.0 0.0 0.0 0.0 42-43 0.5 0.0 0.0 0.0 0.0 44-45 0.5 0.0 0.0 0.0 0.0 46-47 0.5 0.0 0.0 0.0 0.0 48-49 0.5 0.0 0.0 0.0 0.0 50-51 0.525 0.0 0.0 0.0 0.0 52-53 0.55 0.0 0.0 0.0 0.0 54-55 0.55 0.0 0.0 0.0 0.0 56-57 0.5625 0.0 0.0 0.0 0.0 58-59 0.575 0.0 0.0 0.0 0.0 60-61 0.575 0.0 0.0 0.0 0.0 62-63 0.575 0.0 0.0 0.0 0.0 64-65 0.575 0.0 0.0 0.0 0.0 66-67 0.575 0.0 0.0 0.0 0.0 68-69 0.575 0.0 0.0 0.0 0.0 70-71 0.575 0.0 0.0 0.0 0.0 72-73 0.575 0.0 0.0 0.0 0.0 74-75 0.575 0.0 0.0 0.0 0.0 76-77 0.575 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.425 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.5750000000000002 0.0 0.0 0.0 0.0 132-133 1.8624999999999998 0.0 0.0 0.0 0.0 134-135 1.975 0.0 0.0 0.0 0.0 136-137 2.2 0.0 0.0 0.0 0.0 138 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCCA 10 0.0069790767 143.96251 2 >>END_MODULE Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806228 spots for SRR5270279.sra Written 3806228 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra Read 3806212 spots for SRR5270279.sra Written 3806212 spots for SRR5270279.sra SRR ids: ['SRR5270279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e62kt6p3 SRR5270279.sra spots: 76124256 blocks: [[1, 3806212], [3806213, 7612424], [7612425, 11418636], [11418637, 15224848], [15224849, 19031060], [19031061, 22837272], [22837273, 26643484], [26643485, 30449696], [30449697, 34255908], [34255909, 38062120], [38062121, 41868332], [41868333, 45674544], [45674545, 49480756], [49480757, 53286968], [53286969, 57093180], [57093181, 60899392], [60899393, 64705604], [64705605, 68511816], [68511817, 72318028], [72318029, 76124256]] SRR5270279 file size 27977445 SRR5270279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270279 SRR5270279_1.fastq Input file: SRR5270279_1.fastq trimmed: SRR5270279-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:41:20 2024 >> started Sat Dec 7 00:42:07 2024 >> done (46.397s) 76124256 reads processed; of these: 308452 ( 0.41%) short reads filtered out after trimming by size control 1858904 ( 2.44%) empty reads filtered out after trimming by size control 73956900 (97.15%) reads available; of these: 26313628 (35.58%) trimmed reads available after processing 47643272 (64.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10736 0.01% 19 10851 0.01% 20 11306 0.02% 21 17454 0.02% 22 13996 0.02% 23 14283 0.02% 24 16739 0.02% 25 16301 0.02% 26 15641 0.02% 27 14727 0.02% 28 17398 0.02% 29 24635 0.03% 30 14517 0.02% 31 27848 0.04% 32 22463 0.03% 33 21190 0.03% 34 15897 0.02% 35 15194 0.02% 36 16963 0.02% 37 14959 0.02% 38 13965 0.02% 39 17754 0.02% 40 23563 0.03% 41 26771 0.04% 42 27047 0.04% 43 18986 0.03% 44 18918 0.03% 45 17832 0.02% 46 17016 0.02% 47 20332 0.03% 48 18211 0.02% 49 23318 0.03% 50 19819 0.03% 51 25138 0.03% 52 19306 0.03% 53 19725 0.03% 54 21519 0.03% 55 22665 0.03% 56 23785 0.03% 57 27210 0.04% 58 26400 0.04% 59 33638 0.05% 60 32756 0.04% 61 40179 0.05% 62 59292 0.08% 63 56424 0.08% 64 43240 0.06% 65 58359 0.08% 66 104142 0.14% 67 350055 0.47% 68 226903 0.31% 69 107925 0.15% 70 64893 0.09% 71 63731 0.09% 72 77738 0.11% 73 96570 0.13% 74 53572 0.07% 75 46030 0.06% 76 40907 0.06% 77 40211 0.05% 78 44471 0.06% 79 40426 0.05% 80 39874 0.05% 81 40452 0.05% 82 41760 0.06% 83 42382 0.06% 84 43893 0.06% 85 45574 0.06% 86 45850 0.06% 87 48049 0.06% 88 49430 0.07% 89 51047 0.07% 90 53259 0.07% 91 54270 0.07% 92 56690 0.08% 93 57965 0.08% 94 61385 0.08% 95 63082 0.09% 96 65963 0.09% 97 67669 0.09% 98 69661 0.09% 99 72055 0.10% 100 74916 0.10% 101 77436 0.10% 102 79423 0.11% 103 82619 0.11% 104 84830 0.11% 105 88177 0.12% 106 91922 0.12% 107 94941 0.13% 108 98841 0.13% 109 102372 0.14% 110 108052 0.15% 111 110347 0.15% 112 116104 0.16% 113 119990 0.16% 114 123168 0.17% 115 127938 0.17% 116 131600 0.18% 117 138612 0.19% 118 142584 0.19% 119 115777 0.16% 120 121513 0.16% 121 129452 0.18% 122 136123 0.18% 123 142167 0.19% 124 149895 0.20% 125 154508 0.21% 126 156799 0.21% 127 167134 0.23% 128 174440 0.24% 129 178431 0.24% 130 191582 0.26% 131 198636 0.27% 132 211300 0.29% 133 221098 0.30% 134 232812 0.31% 135 246917 0.33% 136 267398 0.36% 137 279992 0.38% 138 300324 0.41% 139 326237 0.44% 140 366452 0.50% 141 415773 0.56% 142 468413 0.63% 143 551902 0.75% 144 653793 0.88% 145 813239 1.10% 146 1077487 1.46% 147 1535652 2.08% 148 2579602 3.49% 149 8220758 11.12% 150 47643272 64.42% 73956900 reads passed initial QC criterion=sequence-density sequence-density=1.32 sequence-density-rank=1 fanout-score=51.66 fanout-score-rank=2 prefix-density=1.60 prefix-fanout=42.6 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=55.78 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGC Started job on | Dec 07 00:42:32 Started mapping on | Dec 07 00:42:33 Finished on | Dec 07 00:44:44 Mapping speed, Million of reads per hour | 2032.40 Number of input reads | 73956900 Average input read length | 143 UNIQUE READS: Uniquely mapped reads number | 69530582 Uniquely mapped reads % | 94.02% Average mapped length | 144.81 Number of splices: Total | 36429952 Number of splices: Annotated (sjdb) | 34360243 Number of splices: GT/AG | 35933872 Number of splices: GC/AG | 424004 Number of splices: AT/AC | 11524 Number of splices: Non-canonical | 60552 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 1.95 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1330755 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 219041 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.78% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3095563 3095563 3095563 N_multimapping 1330755 1330755 1330755 N_noFeature 2785390 35869222 35103601 N_ambiguous 1527674 87546 107126 UnstrandedReadsAssigned:65217518 PositiveStrandReadsAssigned:33573814 NegativeStrandReadsAssigned:34319855 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR5270279 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270279-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 73,956,900 reads, 67,218,440 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR5270279.ke.tsv 35125 SRR5270279.se.tsv 88098 total ==> SRR5270279.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 143.66 4.11464 PNS24247 1044 945 145.796 3.69857 PNS24249 1928 1829 37.4493 0.490852 PNS24246 1044 945 145.796 3.69857 PNS24248 1044 945 145.796 3.69857 PNS24244 1471 1372 427.503 7.46975 PNS24243 293 194 27 3.33644 KQK14069 1603 1504 17209.1 274.304 KQK14071 474 375 833.807 53.3034 ==> SRR5270279.se.tsv <== BRADI_1g14170v3 20933 BRADI_1g53295v3 99 BRADI_1g59795v3 2540 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 687 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 859 BRADI_1g48960v3 1 SRR5270279 completed mapping pipeline successfully