Starting /dee2/code/volunteer_pipeline.sh SRR5270280 current disk space = 1548443578368 free memory = 1598016076 SRR5270280 SRAfilesize 2fd76030568507a885bf00a1ae10ed9a SRR5270280.sra SRR5270280.sra file validated SRR5270280 is single end SRR5270280 is conventional basespace SRR5270280 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270280_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7905 33.0 32.0 34.0 27.0 34.0 2 32.04 33.0 33.0 34.0 28.0 34.0 3 32.2025 33.0 33.0 34.0 30.0 34.0 4 32.3305 33.0 33.0 34.0 31.0 34.0 5 31.55575 33.0 33.0 34.0 27.0 34.0 6 35.98875 38.0 37.0 38.0 31.0 38.0 7 36.289 38.0 38.0 38.0 34.0 38.0 8 36.45825 38.0 38.0 38.0 34.0 38.0 9 36.466 38.0 38.0 38.0 34.0 38.0 10-14 36.42555 38.0 38.0 38.0 34.4 38.0 15-19 36.386199999999995 38.0 38.0 38.0 34.2 38.0 20-24 36.34125 38.0 38.0 38.0 34.2 38.0 25-29 36.247249999999994 38.0 38.0 38.0 34.0 38.0 30-34 36.062599999999996 38.0 38.0 38.0 33.4 38.0 35-39 35.9987 38.0 38.0 38.0 33.0 38.0 40-44 35.9427 38.0 38.0 38.0 32.8 38.0 45-49 35.8394 38.0 38.0 38.0 32.2 38.0 50-54 35.773649999999996 38.0 38.0 38.0 32.4 38.0 55-59 35.558800000000005 38.0 37.2 38.0 30.0 38.0 60-64 35.36925 38.0 37.0 38.0 29.4 38.0 65-69 35.09245 38.0 37.0 38.0 28.8 38.0 70-74 34.8981 38.0 37.0 38.0 28.0 38.0 75-79 34.568450000000006 38.0 36.4 38.0 25.8 38.0 80-84 34.33085 38.0 36.0 38.0 24.6 38.0 85-89 34.07215 38.0 35.6 38.0 22.2 38.0 90-94 33.9053 38.0 35.2 38.0 19.4 38.0 95-99 33.393800000000006 38.0 34.8 38.0 16.2 38.0 100-104 32.92705 38.0 33.8 38.0 15.0 38.0 105-109 32.5409 38.0 33.6 38.0 14.6 38.0 110-114 32.470749999999995 38.0 33.8 38.0 14.4 38.0 115-119 31.811950000000003 38.0 32.6 38.0 13.6 38.0 120-124 31.191749999999995 38.0 31.0 38.0 13.0 38.0 125-129 30.57765 38.0 29.8 38.0 6.4 38.0 130-134 29.55575 36.4 24.8 38.0 2.0 38.0 135-139 28.3452 36.2 20.0 38.0 2.0 38.0 140-144 27.089999999999996 35.0 13.0 38.0 2.0 38.0 145-149 25.074599999999997 33.4 4.2 38.0 2.0 38.0 150 17.85225 20.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 5.0 4 5.0 5 2.0 6 4.0 7 3.0 8 6.0 9 8.0 10 7.0 11 8.0 12 11.0 13 11.0 14 18.0 15 15.0 16 11.0 17 24.0 18 33.0 19 23.0 20 22.0 21 21.0 22 33.0 23 22.0 24 41.0 25 43.0 26 51.0 27 80.0 28 79.0 29 87.0 30 105.0 31 138.0 32 183.0 33 210.0 34 296.0 35 366.0 36 549.0 37 1446.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.2827804107425 14.797261716692997 7.688256977356503 40.23170089520801 2 23.408521303258144 21.102756892230577 35.338345864661655 20.150375939849624 3 23.884711779448622 22.005012531328322 26.29072681704261 27.819548872180448 4 25.846076710955128 29.079969917272496 19.95487590874906 25.119077463023316 5 28.49260095309757 32.30499122146978 20.968146476047153 18.234261349385502 6 22.431077694235587 33.909774436090224 22.13032581453634 21.528822055137844 7 18.771929824561404 20.325814536340854 38.29573934837093 22.606516290726816 8 20.401002506265662 22.907268170426065 28.29573934837093 28.39598997493734 9 21.654135338345863 21.67919799498747 31.027568922305765 25.6390977443609 10-14 24.952380952380953 25.729323308270676 24.105263157894736 25.213032581453632 15-19 24.451127819548873 25.213032581453632 25.142857142857146 25.19298245614035 20-24 24.155388471177943 26.170426065162903 24.842105263157897 24.832080200501252 25-29 24.295739348370926 25.63408521303258 24.51127819548872 25.55889724310777 30-34 24.32080200501253 25.197994987468668 25.67919799498747 24.80200501253133 35-39 24.51127819548872 25.30827067669173 24.99749373433584 25.182957393483708 40-44 24.58145363408521 25.513784461152884 25.162907268170425 24.74185463659148 45-49 24.8922305764411 25.092731829573932 24.857142857142858 25.157894736842106 50-54 24.927318295739347 25.288220551378448 24.917293233082706 24.8671679197995 55-59 24.761904761904763 25.398496240601503 25.122807017543856 24.716791979949875 60-64 24.08020050125313 25.273182957393487 25.343358395989974 25.30325814536341 65-69 24.095238095238095 26.36591478696742 24.987468671679196 24.551378446115287 70-74 24.526315789473685 25.568922305764413 24.401002506265666 25.50375939849624 75-79 24.43609022556391 25.473684210526315 24.706766917293233 25.383458646616543 80-84 24.616541353383457 26.06015037593985 24.31077694235589 25.012531328320804 85-89 24.6265664160401 24.95739348370927 25.35338345864662 25.062656641604008 90-94 24.411027568922307 25.48872180451128 25.152882205513784 24.947368421052634 95-99 24.55639097744361 25.293233082706767 24.907268170426065 25.243107769423556 100-104 24.94235588972431 25.69423558897243 24.56641604010025 24.796992481203006 105-109 24.285714285714285 25.67919799498747 24.977443609022558 25.05764411027569 110-114 24.61152882205514 25.35338345864662 24.832080200501252 25.203007518796994 115-119 25.00250626566416 25.839598997493734 24.62155388471178 24.536340852130326 120-124 24.596491228070175 25.208020050125313 24.94235588972431 25.2531328320802 125-129 24.686716791979947 25.54385964912281 24.651629072681704 25.117794486215537 130-134 25.027568922305765 26.27067669172932 24.25563909774436 24.44611528822055 135-139 25.127819548872182 25.609022556390975 23.844611528822053 25.418546365914786 140-144 25.523809523809526 25.588972431077693 24.31077694235589 24.576441102756892 145-149 25.36002809975413 25.56575844247077 24.261127000853026 24.813086456922072 150 26.591478696741856 24.51127819548872 23.93483709273183 24.962406015037594 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 11.0 1 7.0 2 1.5 3 0.5 4 1.0 5 1.5 6 2.0 7 1.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 2.0 25 3.5 26 3.5 27 3.5 28 4.5 29 5.0 30 9.5 31 17.0 32 19.5 33 22.5 34 32.5 35 46.5 36 59.5 37 73.5 38 78.5 39 84.5 40 104.5 41 131.0 42 152.0 43 166.0 44 176.5 45 179.0 46 166.5 47 172.0 48 168.0 49 155.0 50 151.0 51 142.5 52 140.5 53 129.5 54 112.5 55 97.0 56 105.5 57 104.5 58 97.5 59 92.0 60 91.5 61 93.5 62 91.0 63 78.0 64 62.5 65 67.0 66 63.5 67 50.5 68 43.0 69 39.0 70 26.0 71 19.0 72 17.0 73 9.5 74 5.0 75 5.0 76 3.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.050000000000001 2 0.25 3 0.25 4 0.27499999999999997 5 0.325 6 0.25 7 0.25 8 0.25 9 0.25 10-14 0.25 15-19 0.25 20-24 0.25 25-29 0.25 30-34 0.25 35-39 0.25 40-44 0.25 45-49 0.25 50-54 0.25 55-59 0.25 60-64 0.25 65-69 0.25 70-74 0.25 75-79 0.25 80-84 0.25 85-89 0.25 90-94 0.25 95-99 0.25 100-104 0.25 105-109 0.25 110-114 0.25 115-119 0.25 120-124 0.25 125-129 0.25 130-134 0.25 135-139 0.25 140-144 0.25 145-149 0.35500000000000004 150 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.02937420178799 96.925 2 0.7407407407407408 1.4500000000000002 3 0.10217113665389528 0.3 4 0.05108556832694764 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02554278416347382 0.22499999999999998 >10 0.05108556832694764 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGGCCATCTCGTATGC 22 0.5499999999999999 TruSeq Adapter, Index 20 (98% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.037500000000000006 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.425 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 1.975 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.625 0.0 0.0 0.0 0.0 134-135 2.9000000000000004 0.0 0.0 0.0 0.0 136-137 3.2375 0.0 0.0 0.0 0.0 138 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGCT 10 0.0069790767 143.96251 9 ACCAAGG 10 0.0069790767 143.96251 6 GCCACCA 10 0.0069790767 143.96251 3 CTCAAGC 10 0.0069790767 143.96251 8 >>END_MODULE Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099842 spots for SRR5270280.sra Written 3099842 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra Read 3099830 spots for SRR5270280.sra Written 3099830 spots for SRR5270280.sra SRR ids: ['SRR5270280.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_00py5wch SRR5270280.sra spots: 61996612 blocks: [[1, 3099830], [3099831, 6199660], [6199661, 9299490], [9299491, 12399320], [12399321, 15499150], [15499151, 18598980], [18598981, 21698810], [21698811, 24798640], [24798641, 27898470], [27898471, 30998300], [30998301, 34098130], [34098131, 37197960], [37197961, 40297790], [40297791, 43397620], [43397621, 46497450], [46497451, 49597280], [49597281, 52697110], [52697111, 55796940], [55796941, 58896770], [58896771, 61996612]] SRR5270280 file size 22783086 SRR5270280 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270280 SRR5270280_1.fastq Input file: SRR5270280_1.fastq trimmed: SRR5270280-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:23:38 2024 >> started Sat Dec 7 00:24:47 2024 >> done (68.765s) 61996612 reads processed; of these: 128465 ( 0.21%) short reads filtered out after trimming by size control 748299 ( 1.21%) empty reads filtered out after trimming by size control 61119848 (98.59%) reads available; of these: 22837648 (37.37%) trimmed reads available after processing 38282200 (62.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6009 0.01% 19 5998 0.01% 20 6178 0.01% 21 7497 0.01% 22 7377 0.01% 23 7994 0.01% 24 8526 0.01% 25 8665 0.01% 26 9034 0.01% 27 8647 0.01% 28 9095 0.01% 29 8785 0.01% 30 8959 0.01% 31 8416 0.01% 32 8681 0.01% 33 9274 0.02% 34 8354 0.01% 35 7781 0.01% 36 7689 0.01% 37 7639 0.01% 38 7454 0.01% 39 8411 0.01% 40 8910 0.01% 41 9717 0.02% 42 9053 0.01% 43 9388 0.02% 44 9765 0.02% 45 9619 0.02% 46 10341 0.02% 47 11471 0.02% 48 11417 0.02% 49 11128 0.02% 50 11055 0.02% 51 10912 0.02% 52 11328 0.02% 53 11564 0.02% 54 12316 0.02% 55 12991 0.02% 56 13809 0.02% 57 14630 0.02% 58 14949 0.02% 59 17225 0.03% 60 16471 0.03% 61 21157 0.03% 62 21678 0.04% 63 21330 0.03% 64 21169 0.03% 65 26121 0.04% 66 42721 0.07% 67 144841 0.24% 68 93053 0.15% 69 48099 0.08% 70 28073 0.05% 71 27560 0.05% 72 31243 0.05% 73 33702 0.06% 74 24271 0.04% 75 22664 0.04% 76 21915 0.04% 77 22344 0.04% 78 22955 0.04% 79 23183 0.04% 80 23112 0.04% 81 23347 0.04% 82 24145 0.04% 83 24143 0.04% 84 25401 0.04% 85 26496 0.04% 86 27009 0.04% 87 27805 0.05% 88 28970 0.05% 89 29564 0.05% 90 30707 0.05% 91 31615 0.05% 92 33200 0.05% 93 35148 0.06% 94 37664 0.06% 95 38841 0.06% 96 39404 0.06% 97 42329 0.07% 98 44093 0.07% 99 44921 0.07% 100 46763 0.08% 101 47916 0.08% 102 50352 0.08% 103 55222 0.09% 104 55668 0.09% 105 57285 0.09% 106 60642 0.10% 107 62961 0.10% 108 64461 0.11% 109 68288 0.11% 110 71528 0.12% 111 73066 0.12% 112 76495 0.13% 113 80772 0.13% 114 85246 0.14% 115 88917 0.15% 116 91598 0.15% 117 97369 0.16% 118 99706 0.16% 119 75956 0.12% 120 76666 0.13% 121 82638 0.14% 122 88398 0.14% 123 92173 0.15% 124 97200 0.16% 125 103037 0.17% 126 106314 0.17% 127 114131 0.19% 128 120070 0.20% 129 124823 0.20% 130 129408 0.21% 131 140241 0.23% 132 151272 0.25% 133 160981 0.26% 134 172122 0.28% 135 181197 0.30% 136 189957 0.31% 137 211039 0.35% 138 233070 0.38% 139 260512 0.43% 140 286473 0.47% 141 324117 0.53% 142 380243 0.62% 143 453557 0.74% 144 545361 0.89% 145 690360 1.13% 146 969316 1.59% 147 1482605 2.43% 148 2438574 3.99% 149 9261067 15.15% 150 38282200 62.63% 61119848 reads passed initial QC criterion=sequence-density sequence-density=2.22 sequence-density-rank=1 fanout-score=50.07 fanout-score-rank=1 prefix-density=2.72 prefix-fanout=40.8 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=2.22 sequence-density-rank=1 fanout-score=50.07 fanout-score-rank=1 prefix-density=2.72 prefix-fanout=40.8 sequence=AGATCGGAAGAGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 0 (0.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 1 (100.00%) aligned >1 times 100.00% overall alignment rate Potential adapter found in reference sequence. Continuing without clipping. Started job on | Dec 07 00:25:09 Started mapping on | Dec 07 00:25:09 Finished on | Dec 07 00:26:41 Mapping speed, Million of reads per hour | 2391.65 Number of input reads | 61119848 Average input read length | 145 UNIQUE READS: Uniquely mapped reads number | 58611222 Uniquely mapped reads % | 95.90% Average mapped length | 145.36 Number of splices: Total | 28974771 Number of splices: Annotated (sjdb) | 27310906 Number of splices: GT/AG | 28573923 Number of splices: GC/AG | 336268 Number of splices: AT/AC | 8697 Number of splices: Non-canonical | 55883 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 963275 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 181399 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.14% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1545351 1545351 1545351 N_multimapping 963275 963275 963275 N_noFeature 2166714 29943548 29555639 N_ambiguous 1435909 72429 92602 UnstrandedReadsAssigned:55008599 PositiveStrandReadsAssigned:28595245 NegativeStrandReadsAssigned:28962981 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR5270280 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270280-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,119,848 reads, 56,759,447 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52973 SRR5270280.ke.tsv 35125 SRR5270280.se.tsv 88098 total ==> SRR5270280.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 99.1958 3.19411 PNS24247 1044 945 115.341 3.28954 PNS24249 1928 1829 53.9896 0.795568 PNS24246 1044 945 115.341 3.28954 PNS24248 1044 945 115.341 3.28954 PNS24244 1471 1372 451.79 8.87492 PNS24243 293 194 23 3.19527 KQK14069 1603 1504 18172.6 325.65 KQK14071 474 375 1070.96 76.9704 ==> SRR5270280.se.tsv <== BRADI_1g14170v3 22211 BRADI_1g53295v3 112 BRADI_1g59795v3 2664 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 330 BRADI_1g74790v3 195 BRADI_1g09890v3 0 BRADI_1g77505v3 881 BRADI_1g48960v3 0 SRR5270280 completed mapping pipeline successfully