Starting /dee2/code/volunteer_pipeline.sh SRR5270281 current disk space = 1548439257088 free memory = 1603164496 SRR5270281 SRAfilesize 8a1f79f6bc5d46413c046d1d63a6632b SRR5270281.sra SRR5270281.sra file validated SRR5270281 is single end SRR5270281 is conventional basespace SRR5270281 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.915 33.0 32.0 34.0 27.0 34.0 2 32.14625 33.0 33.0 34.0 28.0 34.0 3 32.367 33.0 33.0 34.0 30.0 34.0 4 32.32175 33.0 33.0 34.0 31.0 34.0 5 31.75775 33.0 33.0 34.0 28.0 34.0 6 36.2195 38.0 37.0 38.0 33.0 38.0 7 36.5135 38.0 38.0 38.0 34.0 38.0 8 36.71325 38.0 38.0 38.0 35.0 38.0 9 36.682 38.0 38.0 38.0 35.0 38.0 10-14 36.658049999999996 38.0 38.0 38.0 35.0 38.0 15-19 36.603 38.0 38.0 38.0 34.8 38.0 20-24 36.6305 38.0 38.0 38.0 35.0 38.0 25-29 36.44500000000001 38.0 38.0 38.0 34.2 38.0 30-34 36.25665 38.0 38.0 38.0 34.0 38.0 35-39 36.180550000000004 38.0 38.0 38.0 33.6 38.0 40-44 36.1321 38.0 38.0 38.0 33.2 38.0 45-49 36.04430000000001 38.0 38.0 38.0 33.0 38.0 50-54 35.9149 38.0 38.0 38.0 32.8 38.0 55-59 35.84165 38.0 37.4 38.0 31.2 38.0 60-64 35.78365 38.0 37.0 38.0 31.8 38.0 65-69 35.4366 38.0 37.0 38.0 29.2 38.0 70-74 35.16845 38.0 37.0 38.0 28.8 38.0 75-79 34.833549999999995 38.0 36.6 38.0 27.0 38.0 80-84 34.552049999999994 38.0 36.0 38.0 25.6 38.0 85-89 34.270149999999994 38.0 36.0 38.0 23.6 38.0 90-94 34.0208 38.0 35.2 38.0 21.0 38.0 95-99 33.54925 38.0 34.2 38.0 15.0 38.0 100-104 33.29725 38.0 34.0 38.0 15.0 38.0 105-109 32.8385 38.0 34.0 38.0 15.0 38.0 110-114 32.53125 38.0 33.4 38.0 14.8 38.0 115-119 32.02695 38.0 32.6 38.0 13.8 38.0 120-124 31.418649999999996 38.0 30.6 38.0 13.2 38.0 125-129 30.7327 38.0 29.6 38.0 12.6 38.0 130-134 29.8726 36.8 26.2 38.0 2.0 38.0 135-139 28.766949999999998 36.0 22.6 38.0 2.0 38.0 140-144 27.326100000000004 35.2 15.4 38.0 2.0 38.0 145-149 25.0577 33.2 6.0 38.0 2.0 38.0 150 17.829 21.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 2.0 4 3.0 5 4.0 6 5.0 7 3.0 8 2.0 9 3.0 10 6.0 11 4.0 12 13.0 13 13.0 14 12.0 15 23.0 16 20.0 17 20.0 18 22.0 19 19.0 20 21.0 21 21.0 22 20.0 23 39.0 24 28.0 25 65.0 26 45.0 27 60.0 28 93.0 29 103.0 30 107.0 31 148.0 32 182.0 33 204.0 34 292.0 35 396.0 36 543.0 37 1442.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.371609165130366 13.484329734000527 8.612062154332367 40.53199894653674 2 25.093914350112694 20.786376158276983 33.809166040571 20.31054345103932 3 22.442326980942827 23.771313941825476 25.977933801404212 27.80842527582748 4 27.382146439317957 29.663991975927782 19.157472417251757 23.796389167502507 5 27.389014296463504 32.58088788562829 21.11863556558816 18.911462252320042 6 21.136989732031054 33.38342098672677 23.441021788129227 22.03856749311295 7 19.358878036563986 20.110192837465565 38.56749311294766 21.96343601302279 8 21.337340345604808 22.163786626596544 28.449787127473076 28.049085900325572 9 23.065364387678436 20.586025544703233 30.40320560981718 25.945404457801153 10-14 24.457801152016028 25.785123966942148 23.911845730027547 25.845229151014276 15-19 24.85349361382419 24.8885549711996 25.399449035812673 24.858502379163536 20-24 25.3343350864012 25.775106436263464 24.673178061607814 24.217380415727526 25-29 24.527923866766844 25.900325569747057 24.48785374405209 25.08389681943401 30-34 24.457801152016028 25.524668169296266 25.078888054094666 24.938642624593037 35-39 24.182319058352117 25.554720761332334 25.299273729025796 24.963686451289757 40-44 25.2541948409717 25.00375657400451 25.569747057350362 24.17230152767343 45-49 24.44778362133734 24.998747808665165 25.359378913097924 25.19408965689958 50-54 24.06711745554721 25.41948409717005 25.30929125970448 25.204107187578263 55-59 24.16228399699474 25.214124718256947 25.554720761332334 25.068870523415974 60-64 24.102178812922613 26.010518407212622 25.063861758076634 24.823441021788128 65-69 24.56298522414225 26.576508890558475 24.372652141247183 24.48785374405209 70-74 24.25244177310293 26.02554470323065 24.593037816178313 25.128975707488106 75-79 23.986977210117704 25.444527923866765 25.39444027047333 25.1740545955422 80-84 24.19734535437015 25.760080140245428 25.339343851740548 24.703230653643875 85-89 25.133984472827446 25.349361382419232 25.05885299273729 24.457801152016028 90-94 25.524668169296266 25.118958176809414 24.74330077635863 24.61307287753569 95-99 24.628099173553718 25.329326321061856 25.19909842223892 24.843476083145504 100-104 24.663160530929126 25.720010017530683 24.392687202604556 25.22414224893564 105-109 24.527923866766844 25.715001252191332 24.432757325319308 25.324317555722516 110-114 24.01702980215377 26.471324818432258 24.49787127473078 25.013774104683193 115-119 24.55296769346356 25.60480841472577 24.382669671925868 25.4595542198848 120-124 24.658151765589782 25.88029050838968 24.432757325319308 25.02880040070123 125-129 25.219133483596295 25.59979964938643 24.53794139744553 24.64312546957175 130-134 25.204107187578263 26.02053593789131 24.502880040070124 24.272476834460306 135-139 25.13899323816679 25.945404457801153 24.187327823691458 24.728274480340595 140-144 24.923616328575008 25.715001252191332 24.377660906586527 24.983721512647133 145-149 24.835716077251067 25.718585402558315 24.77552044143466 24.670178078755956 150 24.567993989481593 24.768344603055347 25.118958176809414 25.544703230653642 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 5.0 2 2.0 3 1.5 4 0.0 5 0.0 6 1.5 7 2.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 2.0 26 3.0 27 3.5 28 9.0 29 9.5 30 10.0 31 14.0 32 16.0 33 24.0 34 31.0 35 38.0 36 49.0 37 62.5 38 73.0 39 101.0 40 127.0 41 144.0 42 158.0 43 166.0 44 171.0 45 180.0 46 181.0 47 173.5 48 169.5 49 165.0 50 165.0 51 150.5 52 130.5 53 110.0 54 105.0 55 105.0 56 100.5 57 90.5 58 86.5 59 89.5 60 96.0 61 93.5 62 75.5 63 78.0 64 84.0 65 71.0 66 57.5 67 48.0 68 42.5 69 36.5 70 25.5 71 17.0 72 12.0 73 10.0 74 7.0 75 5.5 76 3.5 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.075 2 0.17500000000000002 3 0.3 4 0.3 5 0.325 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.17500000000000002 10-14 0.17500000000000002 15-19 0.17500000000000002 20-24 0.17500000000000002 25-29 0.17500000000000002 30-34 0.17500000000000002 35-39 0.17500000000000002 40-44 0.17500000000000002 45-49 0.17500000000000002 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.17500000000000002 80-84 0.17500000000000002 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.17500000000000002 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.17500000000000002 115-119 0.17500000000000002 120-124 0.17500000000000002 125-129 0.17500000000000002 130-134 0.17500000000000002 135-139 0.17500000000000002 140-144 0.17500000000000002 145-149 0.325 150 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 99.004848175555 97.0 2 0.8675682572084715 1.7000000000000002 3 0.025516713447307986 0.075 4 0.0 0.0 5 0.025516713447307986 0.125 6 0.0 0.0 7 0.025516713447307986 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05103342689461597 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAAATCTCGTATGC 21 0.525 TruSeq Adapter, Index 19 (98% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 16 0.4 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.15 0.0 0.0 0.0 0.0 2 0.15 0.0 0.0 0.0 0.0 3 0.15 0.0 0.0 0.0 0.0 4 0.15 0.0 0.0 0.0 0.0 5 0.15 0.0 0.0 0.0 0.0 6 0.15 0.0 0.0 0.0 0.0 7 0.15 0.0 0.0 0.0 0.0 8 0.15 0.0 0.0 0.0 0.0 9 0.15 0.0 0.0 0.0 0.0 10-11 0.15 0.0 0.0 0.0 0.0 12-13 0.15 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.15 0.0 0.0 0.0 0.0 24-25 0.15 0.0 0.0 0.0 0.0 26-27 0.15 0.0 0.0 0.0 0.0 28-29 0.15 0.0 0.0 0.0 0.0 30-31 0.15 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.4 0.0 0.0 0.0 0.0 122-123 1.6749999999999998 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.65 0.0 0.0 0.0 0.0 134-135 2.95 0.0 0.0 0.0 0.0 136-137 3.1 0.0 0.0 0.0 0.0 138 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATCA 10 0.0067322105 145.68355 3 AGGTGAT 10 0.0067322105 145.68355 1 >>END_MODULE Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934577 spots for SRR5270281.sra Written 3934577 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra Read 3934571 spots for SRR5270281.sra Written 3934571 spots for SRR5270281.sra SRR ids: ['SRR5270281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zvd4jzkm SRR5270281.sra spots: 78691426 blocks: [[1, 3934571], [3934572, 7869142], [7869143, 11803713], [11803714, 15738284], [15738285, 19672855], [19672856, 23607426], [23607427, 27541997], [27541998, 31476568], [31476569, 35411139], [35411140, 39345710], [39345711, 43280281], [43280282, 47214852], [47214853, 51149423], [51149424, 55083994], [55083995, 59018565], [59018566, 62953136], [62953137, 66887707], [66887708, 70822278], [70822279, 74756849], [74756850, 78691426]] SRR5270281 file size 28921159 SRR5270281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270281 SRR5270281_1.fastq Input file: SRR5270281_1.fastq trimmed: SRR5270281-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:26:07 2024 >> started Sat Dec 7 00:26:52 2024 >> done (45.142s) 78691426 reads processed; of these: 116352 ( 0.15%) short reads filtered out after trimming by size control 900476 ( 1.14%) empty reads filtered out after trimming by size control 77674598 (98.71%) reads available; of these: 28619250 (36.85%) trimmed reads available after processing 49055348 (63.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5145 0.01% 19 5155 0.01% 20 5384 0.01% 21 7733 0.01% 22 6772 0.01% 23 7671 0.01% 24 7871 0.01% 25 7780 0.01% 26 8140 0.01% 27 7744 0.01% 28 9898 0.01% 29 8052 0.01% 30 7609 0.01% 31 7663 0.01% 32 7790 0.01% 33 12811 0.02% 34 7455 0.01% 35 6933 0.01% 36 6814 0.01% 37 6985 0.01% 38 6656 0.01% 39 7527 0.01% 40 8088 0.01% 41 8861 0.01% 42 8287 0.01% 43 8366 0.01% 44 9123 0.01% 45 8869 0.01% 46 9476 0.01% 47 11140 0.01% 48 10881 0.01% 49 10376 0.01% 50 10449 0.01% 51 10039 0.01% 52 10412 0.01% 53 10380 0.01% 54 11876 0.02% 55 11889 0.02% 56 12884 0.02% 57 13803 0.02% 58 14555 0.02% 59 17187 0.02% 60 16362 0.02% 61 22399 0.03% 62 26235 0.03% 63 21321 0.03% 64 20533 0.03% 65 27768 0.04% 66 50202 0.06% 67 171838 0.22% 68 111083 0.14% 69 55865 0.07% 70 30628 0.04% 71 32151 0.04% 72 30663 0.04% 73 48018 0.06% 74 27380 0.04% 75 24384 0.03% 76 23108 0.03% 77 23856 0.03% 78 25196 0.03% 79 24615 0.03% 80 24035 0.03% 81 24148 0.03% 82 24853 0.03% 83 25622 0.03% 84 26174 0.03% 85 26610 0.03% 86 28154 0.04% 87 28576 0.04% 88 29454 0.04% 89 30260 0.04% 90 31196 0.04% 91 32922 0.04% 92 34144 0.04% 93 35826 0.05% 94 38536 0.05% 95 39695 0.05% 96 40581 0.05% 97 43326 0.06% 98 44599 0.06% 99 45997 0.06% 100 48690 0.06% 101 49658 0.06% 102 53290 0.07% 103 57587 0.07% 104 58161 0.07% 105 59842 0.08% 106 63743 0.08% 107 65594 0.08% 108 68364 0.09% 109 71949 0.09% 110 75404 0.10% 111 78455 0.10% 112 81856 0.11% 113 87191 0.11% 114 91301 0.12% 115 95662 0.12% 116 99001 0.13% 117 106159 0.14% 118 109461 0.14% 119 90761 0.12% 120 92092 0.12% 121 99307 0.13% 122 107572 0.14% 123 112163 0.14% 124 118127 0.15% 125 125707 0.16% 126 129659 0.17% 127 138560 0.18% 128 146585 0.19% 129 154016 0.20% 130 159899 0.21% 131 173662 0.22% 132 187613 0.24% 133 199588 0.26% 134 214161 0.28% 135 227423 0.29% 136 238181 0.31% 137 265760 0.34% 138 293588 0.38% 139 329835 0.42% 140 362307 0.47% 141 411367 0.53% 142 483931 0.62% 143 577822 0.74% 144 702673 0.90% 145 888410 1.14% 146 1252871 1.61% 147 1924764 2.48% 148 3177282 4.09% 149 11961354 15.40% 150 49055348 63.15% 77674598 reads passed initial QC criterion=sequence-density sequence-density=1.52 sequence-density-rank=1 fanout-score=52.17 fanout-score-rank=2 prefix-density=1.88 prefix-fanout=42.0 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=127.01 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGC Started job on | Dec 07 00:27:14 Started mapping on | Dec 07 00:27:14 Finished on | Dec 07 00:29:54 Mapping speed, Million of reads per hour | 1747.68 Number of input reads | 77674598 Average input read length | 145 UNIQUE READS: Uniquely mapped reads number | 73598301 Uniquely mapped reads % | 94.75% Average mapped length | 146.00 Number of splices: Total | 38533872 Number of splices: Annotated (sjdb) | 36366163 Number of splices: GT/AG | 38005656 Number of splices: GC/AG | 449947 Number of splices: AT/AC | 13133 Number of splices: Non-canonical | 65136 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1158571 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 164003 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2917726 2917726 2917726 N_multimapping 1158571 1158571 1158571 N_noFeature 3056753 37808777 37382639 N_ambiguous 1657122 91660 111510 UnstrandedReadsAssigned:68884426 PositiveStrandReadsAssigned:35697864 NegativeStrandReadsAssigned:36104152 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR5270281 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270281-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 77,674,598 reads, 70,955,366 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,336 rounds 52973 SRR5270281.ke.tsv 35125 SRR5270281.se.tsv 88098 total ==> SRR5270281.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 365.585 9.81833 PNS24247 1044 945 106.007 2.5216 PNS24249 1928 1829 107.206 1.31759 PNS24246 1044 945 106.007 2.5216 PNS24248 1044 945 106.007 2.5216 PNS24244 1471 1372 414.188 6.78606 PNS24243 293 194 32 3.70785 KQK14069 1603 1504 19210.6 287.122 KQK14071 474 375 1158.63 69.4527 ==> SRR5270281.se.tsv <== BRADI_1g14170v3 24046 BRADI_1g53295v3 133 BRADI_1g59795v3 3245 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 549 BRADI_1g74790v3 219 BRADI_1g09890v3 0 BRADI_1g77505v3 1141 BRADI_1g48960v3 0 SRR5270281 completed mapping pipeline successfully