Starting /dee2/code/volunteer_pipeline.sh SRR5270282 current disk space = 1548427243520 free memory = 1600122928 SRR5270282 SRAfilesize 74ecf7aa5be39d46bd989f34ce3fc152 SRR5270282.sra SRR5270282.sra file validated SRR5270282 is single end SRR5270282 is conventional basespace SRR5270282 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5270282_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.34975 33.0 32.0 34.0 25.0 34.0 2 31.69225 33.0 31.0 34.0 27.0 34.0 3 31.87725 33.0 31.0 34.0 28.0 34.0 4 32.06525 33.0 33.0 34.0 29.0 34.0 5 30.63925 33.0 31.0 34.0 15.0 34.0 6 35.40575 38.0 36.0 38.0 29.0 38.0 7 35.8625 38.0 37.0 38.0 31.0 38.0 8 36.071 38.0 37.0 38.0 33.0 38.0 9 36.1665 38.0 38.0 38.0 33.0 38.0 10-14 36.186099999999996 38.0 38.0 38.0 33.2 38.0 15-19 36.130399999999995 38.0 38.0 38.0 33.4 38.0 20-24 36.02025 38.0 38.0 38.0 33.0 38.0 25-29 35.896 38.0 38.0 38.0 31.6 38.0 30-34 35.8227 38.0 37.6 38.0 31.6 38.0 35-39 35.8895 38.0 37.8 38.0 32.2 38.0 40-44 35.79195 38.0 37.4 38.0 31.4 38.0 45-49 35.65755 38.0 37.0 38.0 30.6 38.0 50-54 35.605149999999995 38.0 37.0 38.0 29.4 38.0 55-59 35.50685 38.0 37.0 38.0 29.4 38.0 60-64 35.2739 38.0 37.0 38.0 28.6 38.0 65-69 35.13459999999999 38.0 37.0 38.0 28.2 38.0 70-74 35.0019 38.0 36.4 38.0 27.8 38.0 75-79 34.76545 38.0 36.2 38.0 26.6 38.0 80-84 34.548500000000004 38.0 36.0 38.0 24.8 38.0 85-89 34.2822 38.0 35.6 38.0 23.8 38.0 90-94 34.0621 38.0 35.2 38.0 21.4 38.0 95-99 33.56975 38.0 34.4 38.0 15.0 38.0 100-104 33.1863 38.0 34.0 38.0 15.0 38.0 105-109 32.81755 38.0 34.0 38.0 15.0 38.0 110-114 32.24685000000001 38.0 32.8 38.0 14.4 38.0 115-119 31.833949999999998 38.0 32.0 38.0 13.4 38.0 120-124 31.236199999999997 38.0 30.2 38.0 13.0 38.0 125-129 30.7404 37.6 28.6 38.0 10.8 38.0 130-134 29.83585 36.8 25.4 38.0 2.0 38.0 135-139 28.87315 36.0 22.4 38.0 2.0 38.0 140-144 27.718349999999997 36.0 16.8 38.0 2.0 38.0 145-149 25.940700000000003 34.2 6.4 38.0 2.0 38.0 150 19.3095 24.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 10.0 4 4.0 5 4.0 6 4.0 7 1.0 8 6.0 9 4.0 10 4.0 11 4.0 12 7.0 13 7.0 14 13.0 15 16.0 16 15.0 17 26.0 18 28.0 19 28.0 20 30.0 21 35.0 22 35.0 23 41.0 24 49.0 25 39.0 26 58.0 27 64.0 28 70.0 29 96.0 30 131.0 31 153.0 32 171.0 33 201.0 34 285.0 35 345.0 36 539.0 37 1457.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.74855034264628 16.842382709541383 7.82814971006853 34.580917237743805 2 23.93483709273183 21.17794486215539 34.48621553884712 20.401002506265662 3 22.18045112781955 22.305764411027567 28.79699248120301 26.71679197994987 4 25.770869892203557 28.67886688393081 20.807219854600152 24.74304336926548 5 26.999247931812487 32.84031085485084 21.308598646277265 18.851842567059414 6 20.681875156680874 34.46979192780145 22.286287290047632 22.56204562547004 7 19.62897969415894 20.957633492103284 39.107545750814744 20.30584106292304 8 19.804462271245924 23.790423665078965 28.804211581850087 27.600902481825017 9 22.963148658811733 20.957633492103284 29.93231386312359 26.146903985961394 10-14 23.88448811791838 26.596811390755036 24.837060062167854 24.68164042915873 15-19 24.530004511956687 26.20945505589813 24.56008422319146 24.700456208953728 20-24 24.60651629072682 26.536340852130323 25.062656641604008 23.794486215538846 25-29 24.24561403508772 26.40601503759398 24.791979949874687 24.55639097744361 30-34 24.185463659147867 26.08020050125313 25.719298245614038 24.01503759398496 35-39 23.567740965365143 25.542579319332365 25.592702120194478 25.296977595108018 40-44 24.075187969924812 25.343358395989974 25.824561403508774 24.75689223057644 45-49 24.93734335839599 25.44360902255639 25.36842105263158 24.250626566416038 50-54 23.720487242468295 25.70053636773773 25.84089428041506 24.73808210937892 55-59 24.21173993683894 25.560178455060406 26.011328888666096 24.21675271943456 60-64 23.932223781832764 26.574092640866255 25.631642269901743 23.862041307399238 65-69 23.497267759562842 27.096806537323907 25.11154559582895 24.2943801072843 70-74 23.90715861239222 26.388610387006217 25.280729897734112 24.423501102867455 75-79 24.420936528627294 26.010227614559312 24.89220896420335 24.67662689261005 80-84 24.078808843435105 25.96881736601995 25.256930866797013 24.695442923747933 85-89 23.696611189091637 26.027671947062363 25.54642069380389 24.729296170042108 90-94 24.16023262809586 25.63922590995688 26.035295297302717 24.16524616464454 95-99 23.63882482703299 25.844780908452826 25.619171763762154 24.89722250075203 100-104 24.23801884900742 26.413675556446766 25.23059955885302 24.1177060356928 105-109 24.308201323440947 25.54642069380389 25.43613394826549 24.70924403448967 110-114 23.746741527972727 26.30840184479647 25.54642069380389 24.39843593342691 115-119 24.715439001153285 26.390212104497817 24.7555533269819 24.138795567366998 120-124 23.825284589539137 26.257459505541348 24.94358357153603 24.973672333383483 125-129 24.100070189511683 25.914970420134363 25.589090544470068 24.395868845883886 130-134 24.59016393442623 26.58545144633278 24.815761768687018 24.00862285055397 135-139 24.542583588149782 26.713118452052736 24.56263471853226 24.181663241265227 140-144 24.819530780028074 26.629236013635456 24.56386605173451 23.987367154601966 145-149 23.85707833592613 26.66733577558087 24.700155567822552 24.77543032067045 150 24.74304336926548 27.676109300576584 23.539734269240412 24.041113060917525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 16.0 1 9.5 2 2.5 3 2.0 4 1.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.0 24 0.5 25 1.5 26 4.0 27 5.0 28 8.0 29 8.5 30 6.5 31 10.0 32 17.5 33 22.5 34 34.0 35 42.5 36 52.0 37 64.5 38 85.0 39 113.0 40 136.0 41 148.5 42 162.0 43 180.5 44 191.5 45 207.0 46 202.0 47 184.5 48 174.0 49 173.5 50 164.5 51 148.0 52 135.5 53 111.0 54 97.0 55 97.5 56 93.0 57 88.0 58 85.5 59 81.0 60 75.5 61 83.5 62 78.5 63 60.0 64 56.0 65 49.5 66 42.5 67 43.0 68 38.5 69 29.0 70 22.0 71 17.0 72 14.5 73 11.0 74 5.5 75 2.5 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.1499999999999995 2 0.25 3 0.25 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.27 15-19 0.265 20-24 0.25 25-29 0.25 30-34 0.25 35-39 0.245 40-44 0.25 45-49 0.25 50-54 0.255 55-59 0.255 60-64 0.26 65-69 0.265 70-74 0.26 75-79 0.27 80-84 0.265 85-89 0.26 90-94 0.27 95-99 0.27 100-104 0.26 105-109 0.26 110-114 0.26 115-119 0.28500000000000003 120-124 0.295 125-129 0.27 130-134 0.265 135-139 0.255 140-144 0.26 145-149 0.365 150 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08069458631257 97.0 2 0.6894790602655771 1.35 3 0.07660878447395301 0.22499999999999998 4 0.05107252298263534 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02553626149131767 0.22499999999999998 >10 0.07660878447395301 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTCCGCATCTCGTATGC 19 0.475 TruSeq Adapter, Index 18 (100% over 50bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 10 0.25 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138 3.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGTT 10 0.006973645 144.0 7 TGTTCAA 10 0.006973645 144.0 5 CAATTAT 10 0.006973645 144.0 4 GTTCAAG 10 0.006973645 144.0 6 TGAGTTC 10 0.006973645 144.0 8 >>END_MODULE Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509975 spots for SRR5270282.sra Written 4509975 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra Read 4509973 spots for SRR5270282.sra Written 4509973 spots for SRR5270282.sra SRR ids: ['SRR5270282.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z0nxz0uf SRR5270282.sra spots: 90199462 blocks: [[1, 4509973], [4509974, 9019946], [9019947, 13529919], [13529920, 18039892], [18039893, 22549865], [22549866, 27059838], [27059839, 31569811], [31569812, 36079784], [36079785, 40589757], [40589758, 45099730], [45099731, 49609703], [49609704, 54119676], [54119677, 58629649], [58629650, 63139622], [63139623, 67649595], [67649596, 72159568], [72159569, 76669541], [76669542, 81179514], [81179515, 85689487], [85689488, 90199462]] SRR5270282 file size 33152623 SRR5270282 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5270282 SRR5270282_1.fastq Input file: SRR5270282_1.fastq trimmed: SRR5270282-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 00:28:56 2024 >> started Sat Dec 7 00:29:57 2024 >> done (60.597s) 90199462 reads processed; of these: 160690 ( 0.18%) short reads filtered out after trimming by size control 1364895 ( 1.51%) empty reads filtered out after trimming by size control 88673877 (98.31%) reads available; of these: 28839615 (32.52%) trimmed reads available after processing 59834262 (67.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11984 0.01% 19 9318 0.01% 20 8553 0.01% 21 11177 0.01% 22 10193 0.01% 23 10958 0.01% 24 13523 0.02% 25 11966 0.01% 26 11660 0.01% 27 11428 0.01% 28 13180 0.01% 29 12787 0.01% 30 10680 0.01% 31 10528 0.01% 32 10885 0.01% 33 12376 0.01% 34 10632 0.01% 35 9605 0.01% 36 9175 0.01% 37 9359 0.01% 38 8771 0.01% 39 10959 0.01% 40 10087 0.01% 41 13891 0.02% 42 11849 0.01% 43 10864 0.01% 44 12184 0.01% 45 13429 0.02% 46 12604 0.01% 47 15096 0.02% 48 14916 0.02% 49 14937 0.02% 50 14738 0.02% 51 14817 0.02% 52 14658 0.02% 53 15856 0.02% 54 18718 0.02% 55 17175 0.02% 56 18705 0.02% 57 21370 0.02% 58 22454 0.03% 59 31442 0.04% 60 23556 0.03% 61 23191 0.03% 62 27355 0.03% 63 28056 0.03% 64 28621 0.03% 65 34919 0.04% 66 52249 0.06% 67 158199 0.18% 68 170242 0.19% 69 116938 0.13% 70 70048 0.08% 71 66009 0.07% 72 70654 0.08% 73 88542 0.10% 74 43303 0.05% 75 34853 0.04% 76 32298 0.04% 77 30533 0.03% 78 32707 0.04% 79 31090 0.04% 80 29896 0.03% 81 30615 0.03% 82 30777 0.03% 83 31890 0.04% 84 32880 0.04% 85 33138 0.04% 86 33208 0.04% 87 33919 0.04% 88 35640 0.04% 89 36688 0.04% 90 37810 0.04% 91 39827 0.04% 92 41488 0.05% 93 43762 0.05% 94 45642 0.05% 95 47168 0.05% 96 48913 0.06% 97 51642 0.06% 98 53383 0.06% 99 55481 0.06% 100 57805 0.07% 101 59294 0.07% 102 62140 0.07% 103 65146 0.07% 104 66383 0.07% 105 70315 0.08% 106 73577 0.08% 107 75616 0.09% 108 79149 0.09% 109 83890 0.09% 110 86864 0.10% 111 91060 0.10% 112 95376 0.11% 113 98984 0.11% 114 101965 0.11% 115 105865 0.12% 116 108152 0.12% 117 114936 0.13% 118 119451 0.13% 119 81666 0.09% 120 84459 0.10% 121 90218 0.10% 122 96112 0.11% 123 98041 0.11% 124 102123 0.12% 125 108991 0.12% 126 117517 0.13% 127 123562 0.14% 128 127846 0.14% 129 134954 0.15% 130 143899 0.16% 131 153596 0.17% 132 161787 0.18% 133 178974 0.20% 134 186341 0.21% 135 202609 0.23% 136 220269 0.25% 137 234534 0.26% 138 267000 0.30% 139 303045 0.34% 140 340542 0.38% 141 387640 0.44% 142 443899 0.50% 143 531406 0.60% 144 644395 0.73% 145 834841 0.94% 146 1154306 1.30% 147 1781873 2.01% 148 3101927 3.50% 149 12268658 13.84% 150 59834262 67.48% 88673877 reads passed initial QC criterion=sequence-density sequence-density=2.04 sequence-density-rank=1 fanout-score=51.32 fanout-score-rank=1 prefix-density=2.50 prefix-fanout=41.9 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=2.04 sequence-density-rank=1 fanout-score=51.32 fanout-score-rank=1 prefix-density=2.50 prefix-fanout=41.9 sequence=AGATCGGAAGAGC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 0 (0.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 1 (100.00%) aligned >1 times 100.00% overall alignment rate Potential adapter found in reference sequence. Continuing without clipping. Started job on | Dec 07 00:30:23 Started mapping on | Dec 07 00:30:24 Finished on | Dec 07 00:33:39 Mapping speed, Million of reads per hour | 1637.06 Number of input reads | 88673877 Average input read length | 145 UNIQUE READS: Uniquely mapped reads number | 84544503 Uniquely mapped reads % | 95.34% Average mapped length | 146.11 Number of splices: Total | 45242061 Number of splices: Annotated (sjdb) | 42709302 Number of splices: GT/AG | 44617421 Number of splices: GC/AG | 530223 Number of splices: AT/AC | 15055 Number of splices: Non-canonical | 79362 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.04 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1420128 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 175540 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2709246 2709246 2709246 N_multimapping 1420128 1420128 1420128 N_noFeature 3771092 43621075 43026069 N_ambiguous 1894613 107169 130479 UnstrandedReadsAssigned:78878798 PositiveStrandReadsAssigned:40816259 NegativeStrandReadsAssigned:41387955 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR5270282 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5270282-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 88,673,877 reads, 81,519,019 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR5270282.ke.tsv 35125 SRR5270282.se.tsv 88098 total ==> SRR5270282.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 73.704 1.7523 PNS24247 1044 945 199.036 4.19123 PNS24249 1928 1829 90.1782 0.981137 PNS24246 1044 945 199.036 4.19123 PNS24248 1044 945 199.036 4.19123 PNS24244 1471 1372 433.011 6.28039 PNS24243 293 194 21 2.15407 KQK14069 1603 1504 15221.6 201.397 KQK14071 474 375 882.165 46.8124 ==> SRR5270282.se.tsv <== BRADI_1g14170v3 19836 BRADI_1g53295v3 112 BRADI_1g59795v3 4653 BRADI_1g07683v3 0 BRADI_1g00485v3 60 BRADI_1g20270v3 1015 BRADI_1g74790v3 254 BRADI_1g09890v3 0 BRADI_1g77505v3 1272 BRADI_1g48960v3 2 SRR5270282 completed mapping pipeline successfully