Starting /dee2/code/volunteer_pipeline.sh SRR5279889 current disk space = 1516103086080 free memory = 1596729436 SRR5279889 SRAfilesize 726ab810a6da905d8b4b928d93c981b9 SRR5279889.sra SRR5279889.sra file validated SRR5279889 is paired end SRR5279889 is conventional basespace SRR5279889 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5279889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.898 34.0 31.0 34.0 31.0 34.0 2 32.97725 34.0 31.0 34.0 31.0 34.0 3 32.90775 34.0 31.0 34.0 31.0 34.0 4 36.3305 37.0 37.0 37.0 35.0 37.0 5 36.39375 37.0 37.0 37.0 35.0 37.0 6 36.392 37.0 37.0 37.0 35.0 37.0 7 36.39575 37.0 37.0 37.0 35.0 37.0 8 36.28225 37.0 37.0 37.0 35.0 37.0 9 38.0965 39.0 39.0 39.0 37.0 39.0 10-11 38.070375 39.0 38.5 39.0 35.0 39.0 12-13 37.920500000000004 39.0 38.0 39.0 35.0 39.0 14-15 39.55825 41.0 40.0 41.0 37.0 41.0 16-17 39.493375 41.0 39.0 41.0 36.5 41.0 18-19 39.503625 41.0 40.0 41.0 37.0 41.0 20-21 39.47825 41.0 39.5 41.0 37.0 41.0 22-23 39.318125 41.0 39.5 41.0 36.5 41.0 24-25 39.379125 41.0 39.0 41.0 36.0 41.0 26-27 39.15275 41.0 39.0 41.0 36.0 41.0 28-29 39.223 41.0 39.0 41.0 36.0 41.0 30-31 39.159875 41.0 39.0 41.0 35.5 41.0 32-33 39.036874999999995 40.5 39.0 41.0 35.0 41.0 34-35 38.952 40.5 38.5 41.0 35.0 41.0 36-37 38.794875000000005 40.0 38.0 41.0 35.0 41.0 38-39 38.466125000000005 40.0 38.0 41.0 34.0 41.0 40-41 38.438 40.0 38.0 41.0 34.0 41.0 42-43 38.317750000000004 40.0 37.5 41.0 34.0 41.0 44-45 38.197 40.0 37.0 41.0 33.5 41.0 46-47 37.990875 40.0 37.0 41.0 33.0 41.0 48-49 37.80225 40.0 36.0 41.0 33.0 41.0 50-51 37.566125 39.5 36.0 41.0 33.0 41.0 52-53 37.169375 39.0 35.0 41.0 32.0 41.0 54-55 36.84425 39.0 35.0 41.0 32.0 41.0 56-57 36.5165 38.0 35.0 40.5 31.0 41.0 58-59 36.424 38.0 35.0 40.0 31.5 41.0 60-61 35.86 37.0 34.5 40.0 30.5 41.0 62-63 35.6185 36.5 34.5 40.0 30.5 41.0 64-65 35.307625 36.0 34.0 39.5 30.0 41.0 66-67 35.122125 35.5 34.0 39.0 30.0 41.0 68-69 34.788125 35.0 34.0 39.0 30.0 41.0 70-71 34.22925 35.0 34.0 37.5 29.0 40.0 72-73 33.951125 35.0 33.0 37.0 29.0 39.0 74-75 33.726124999999996 35.0 33.0 36.5 29.0 39.0 76-77 30.458125000000003 32.5 29.0 34.5 24.0 35.5 78-79 33.004125 35.0 33.0 36.0 28.0 37.0 80-81 33.109125000000006 35.0 33.0 35.0 29.0 37.0 82-83 33.045625 35.0 33.5 35.0 29.0 37.0 84-85 32.832875 35.0 33.0 35.0 29.0 36.0 86-87 32.68375 35.0 33.0 35.0 29.0 36.0 88-89 32.443 35.0 33.0 35.0 28.0 36.0 90-91 32.150375 35.0 33.0 35.0 27.0 35.0 92-93 31.978125 35.0 33.0 35.0 26.5 35.0 94-95 31.765875 35.0 33.0 35.0 26.5 35.0 96-97 31.599 35.0 33.0 35.0 25.0 35.0 98-99 31.256625 35.0 32.5 35.0 24.5 35.0 100-101 29.298875000000002 33.5 28.5 34.5 12.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 2.0 13 4.0 14 6.0 15 9.0 16 6.0 17 6.0 18 6.0 19 7.0 20 6.0 21 10.0 22 7.0 23 20.0 24 18.0 25 21.0 26 30.0 27 35.0 28 33.0 29 52.0 30 53.0 31 76.0 32 115.0 33 127.0 34 196.0 35 376.0 36 677.0 37 989.0 38 977.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.205205205205203 10.96096096096096 14.764764764764765 44.069069069069066 2 25.025 18.525 32.375 24.075 3 27.125 21.0 23.45 28.425 4 30.275000000000002 26.700000000000003 17.75 25.275 5 28.225 30.7 20.0 21.075 6 22.15 34.35 21.45 22.05 7 19.675 16.475 39.300000000000004 24.55 8 21.875 21.725 27.1 29.299999999999997 9 21.825 20.8 29.349999999999998 28.025 10-11 25.174999999999997 28.487499999999997 21.6 24.7375 12-13 24.349999999999998 22.037499999999998 26.474999999999998 27.1375 14-15 24.349999999999998 23.825 25.85 25.974999999999998 16-17 24.9875 23.6375 24.7375 26.637499999999996 18-19 24.125 24.7375 25.4625 25.674999999999997 20-21 25.724999999999998 24.5125 24.099999999999998 25.662499999999998 22-23 25.25 23.9 24.9375 25.912499999999998 24-25 24.6 25.5375 24.7375 25.124999999999996 26-27 25.137500000000003 24.6125 25.025 25.224999999999998 28-29 25.6125 24.275 24.5375 25.575 30-31 25.324999999999996 24.65 24.175 25.85 32-33 24.462500000000002 25.637500000000003 24.5375 25.362499999999997 34-35 25.924999999999997 24.675 24.0 25.4 36-37 25.95 24.5375 25.15 24.3625 38-39 25.337500000000002 24.887500000000003 23.5625 26.2125 40-41 25.224999999999998 24.625 24.637500000000003 25.5125 42-43 24.762500000000003 25.275 24.4 25.5625 44-45 24.5375 25.424999999999997 24.087500000000002 25.95 46-47 26.450000000000003 25.137500000000003 23.7 24.712500000000002 48-49 24.625 24.7875 24.95 25.637500000000003 50-51 24.5 24.637500000000003 24.5625 26.3 52-53 25.8 24.975 23.7375 25.4875 54-55 24.575 25.337500000000002 24.837500000000002 25.25 56-57 25.2625 24.375 24.525 25.837500000000002 58-59 25.525 24.0375 25.137500000000003 25.3 60-61 24.625 25.074999999999996 24.4875 25.8125 62-63 25.1875 25.3125 24.1625 25.337500000000002 64-65 25.2375 25.0 24.7 25.0625 66-67 25.837500000000002 24.712500000000002 24.5375 24.9125 68-69 25.5 25.912499999999998 24.212500000000002 24.375 70-71 25.35 25.337500000000002 24.1125 25.2 72-73 24.6625 24.9125 24.875 25.55 74-75 24.8625 25.2875 24.875 24.975 76-77 25.6 25.087500000000002 23.8875 25.424999999999997 78-79 25.0375 25.362499999999997 24.3 25.3 80-81 24.474999999999998 24.875 25.374999999999996 25.275 82-83 25.3 25.474999999999998 24.637500000000003 24.587500000000002 84-85 25.137500000000003 25.15 24.275 25.4375 86-87 24.637500000000003 24.7375 25.4625 25.162499999999998 88-89 25.387500000000003 23.5875 25.412499999999998 25.6125 90-91 25.75 24.837500000000002 24.5375 24.875 92-93 25.8 24.8625 25.025 24.3125 94-95 25.324999999999996 26.2625 23.0375 25.374999999999996 96-97 25.2375 26.075 23.75 24.9375 98-99 25.324999999999996 25.0625 25.5125 24.099999999999998 100-101 25.85 25.05 23.65 25.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 2.0 27 1.0 28 3.0 29 6.0 30 10.0 31 12.0 32 14.0 33 23.0 34 26.0 35 26.0 36 39.5 37 54.0 38 73.5 39 100.0 40 121.5 41 125.5 42 142.5 43 156.5 44 172.5 45 184.0 46 176.0 47 170.0 48 160.5 49 158.5 50 151.0 51 133.5 52 118.5 53 125.0 54 116.0 55 96.0 56 92.0 57 96.5 58 96.0 59 95.5 60 93.5 61 91.0 62 93.0 63 88.0 64 82.5 65 76.0 66 69.5 67 61.0 68 54.5 69 51.5 70 43.0 71 33.0 72 28.5 73 20.5 74 9.5 75 6.5 76 5.5 77 2.5 78 1.0 79 1.5 80 1.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34442763489663 98.5 2 0.5547150781643975 1.0999999999999999 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 8 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5279889 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5279889_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4615 34.0 31.0 34.0 31.0 34.0 2 32.454 34.0 31.0 34.0 31.0 34.0 3 32.552 34.0 31.0 34.0 31.0 34.0 4 35.8475 37.0 37.0 37.0 35.0 37.0 5 35.78025 37.0 35.0 37.0 35.0 37.0 6 35.965 37.0 37.0 37.0 35.0 37.0 7 35.936 37.0 37.0 37.0 35.0 37.0 8 35.8065 37.0 36.0 37.0 35.0 37.0 9 37.67125 39.0 38.0 39.0 35.0 39.0 10-11 37.666250000000005 39.0 38.0 39.0 35.0 39.0 12-13 37.297875000000005 39.0 37.5 39.0 34.0 39.0 14-15 39.100625 41.0 39.0 41.0 36.0 41.0 16-17 39.0285 41.0 39.0 41.0 36.0 41.0 18-19 38.63525 40.0 38.5 41.0 35.0 41.0 20-21 38.948499999999996 41.0 39.0 41.0 36.0 41.0 22-23 38.716875 40.5 38.5 41.0 35.0 41.0 24-25 38.77475 40.5 39.0 41.0 35.0 41.0 26-27 38.877875 41.0 39.0 41.0 35.5 41.0 28-29 38.647375 40.0 38.5 41.0 34.5 41.0 30-31 38.182625 40.0 38.0 41.0 33.5 41.0 32-33 38.40575 40.0 38.0 41.0 34.5 41.0 34-35 38.2825 40.0 38.0 41.0 34.0 41.0 36-37 38.1925 40.0 38.0 41.0 33.5 41.0 38-39 38.202749999999995 40.0 38.0 41.0 34.0 41.0 40-41 37.956999999999994 40.0 37.5 41.0 33.0 41.0 42-43 37.902249999999995 40.0 37.0 41.0 33.0 41.0 44-45 37.738875 40.0 37.0 41.0 33.0 41.0 46-47 37.36425 40.0 36.5 41.0 32.5 41.0 48-49 37.21725 40.0 35.5 41.0 32.5 41.0 50-51 35.044624999999996 37.0 33.0 39.0 29.0 40.0 52-53 35.742625000000004 38.5 34.5 39.5 30.0 40.0 54-55 36.6375 39.0 35.0 40.5 31.5 41.0 56-57 36.664500000000004 39.0 35.0 41.0 32.0 41.0 58-59 36.366125 38.0 35.0 41.0 31.5 41.0 60-61 36.19775 37.5 35.0 41.0 31.0 41.0 62-63 35.965125 37.0 35.0 40.0 31.0 41.0 64-65 35.573375 36.5 35.0 40.0 31.0 41.0 66-67 35.2915 36.0 35.0 39.5 30.5 41.0 68-69 34.945125000000004 35.5 34.5 39.0 30.0 41.0 70-71 34.594125 35.0 34.0 39.0 30.0 40.5 72-73 34.102999999999994 35.0 34.0 37.0 29.5 39.5 74-75 33.719 35.0 34.0 37.0 29.0 39.0 76-77 33.460625 35.0 34.0 36.0 29.0 39.0 78-79 33.242875 35.0 34.0 36.0 29.0 37.0 80-81 33.1265 35.0 34.0 35.5 29.0 37.0 82-83 32.817 35.0 33.0 35.0 29.0 36.5 84-85 32.577749999999995 35.0 33.0 35.0 28.5 36.0 86-87 32.466875 35.0 33.0 35.0 28.0 36.0 88-89 32.354124999999996 35.0 33.0 35.0 27.0 36.0 90-91 32.089 35.0 33.0 35.0 27.0 35.5 92-93 32.015875 35.0 33.0 35.0 27.0 35.0 94-95 31.62125 35.0 33.0 35.0 25.0 35.0 96-97 31.4235 35.0 33.0 35.0 25.0 35.0 98-99 31.17525 35.0 33.0 35.0 24.0 35.0 100-101 29.5695 34.0 30.0 35.0 12.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 4.0 4 3.0 5 2.0 6 3.0 7 2.0 8 6.0 9 2.0 10 5.0 11 3.0 12 8.0 13 4.0 14 6.0 15 8.0 16 7.0 17 8.0 18 6.0 19 9.0 20 5.0 21 10.0 22 10.0 23 7.0 24 12.0 25 13.0 26 26.0 27 32.0 28 41.0 29 39.0 30 77.0 31 64.0 32 88.0 33 137.0 34 203.0 35 348.0 36 661.0 37 944.0 38 1042.0 39 138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.125 11.475 14.7 43.7 2 26.224999999999998 18.65 31.900000000000002 23.225 3 25.924999999999997 21.725 23.7 28.65 4 28.7 26.8 18.425 26.075 5 29.299999999999997 29.925 19.825 20.95 6 23.200000000000003 33.775 20.275000000000002 22.75 7 20.200000000000003 16.8 38.574999999999996 24.425 8 22.275 22.15 25.474999999999998 30.099999999999998 9 22.2 20.575 29.599999999999998 27.625 10-11 25.45 29.15 20.125 25.275 12-13 24.5 23.4125 25.087500000000002 27.0 14-15 24.5375 24.6625 25.324999999999996 25.474999999999998 16-17 25.637500000000003 24.474999999999998 24.7875 25.1 18-19 24.1375 24.425 24.95 26.487500000000004 20-21 25.074999999999996 25.374999999999996 24.4875 25.0625 22-23 25.412499999999998 24.575 24.975 25.0375 24-25 24.15 25.1 24.349999999999998 26.400000000000002 26-27 25.087500000000002 25.074999999999996 24.05 25.7875 28-29 25.687500000000004 24.05 24.837500000000002 25.424999999999997 30-31 25.35 25.1 24.6625 24.887500000000003 32-33 24.6125 25.112499999999997 24.887500000000003 25.387500000000003 34-35 25.05 25.05 23.7125 26.187500000000004 36-37 25.45 23.775 25.3 25.474999999999998 38-39 25.025 25.1 24.775 25.1 40-41 24.7 25.424999999999997 24.462500000000002 25.412499999999998 42-43 25.1 24.2375 25.074999999999996 25.587500000000002 44-45 25.5125 25.05 23.575 25.8625 46-47 24.85 24.9 24.5 25.75 48-49 24.8125 25.387500000000003 24.762500000000003 25.0375 50-51 24.962500000000002 24.962500000000002 24.5375 25.5375 52-53 25.374999999999996 24.712500000000002 24.4125 25.5 54-55 24.587500000000002 24.25 25.3 25.8625 56-57 24.6625 24.575 25.4625 25.3 58-59 25.1 25.0 24.175 25.724999999999998 60-61 24.5125 24.6125 25.387500000000003 25.4875 62-63 25.324999999999996 24.275 25.0625 25.337500000000002 64-65 25.0375 24.887500000000003 24.2625 25.8125 66-67 24.0375 25.112499999999997 25.7125 25.137500000000003 68-69 25.412499999999998 24.95 24.8 24.837500000000002 70-71 24.875 26.087500000000002 23.8125 25.224999999999998 72-73 24.65684422616799 24.241279435839317 25.399823699785923 25.702052638206773 74-75 24.808921187821078 24.345320135321387 24.65856408971307 26.187194587144468 76-77 24.280869237532972 24.90893103881422 24.78331867855797 26.026881045094836 78-79 24.896577660774728 24.54556850946471 24.758681208474364 25.7991726212862 80-81 24.687187187187188 26.126126126126124 24.474474474474476 24.71221221221221 82-83 24.56557069633704 24.56557069633704 24.878109763720467 25.99074884360545 84-85 24.0625 24.925 24.587500000000002 26.424999999999997 86-87 24.875 25.162499999999998 25.137500000000003 24.825 88-89 25.6125 25.55 23.7375 25.1 90-91 25.103189493433398 23.939962476547844 25.178236397748595 25.77861163227017 92-93 25.128141017627204 24.803100387548444 25.17814726840855 24.8906113264158 94-95 25.42245587683064 24.25835523845287 24.208286393791465 26.11090249092502 96-97 25.0 25.5 24.3875 25.112499999999997 98-99 24.185463659147867 25.275689223057647 24.711779448621556 25.827067669172934 100-101 25.006254691018263 24.64348261195897 25.081310983237426 25.268951713785338 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.0 26 2.0 27 2.5 28 2.0 29 5.5 30 7.5 31 5.0 32 8.5 33 14.0 34 19.5 35 27.0 36 36.5 37 59.0 38 80.5 39 95.5 40 107.5 41 135.5 42 165.5 43 165.5 44 167.0 45 172.5 46 175.0 47 177.5 48 173.5 49 162.0 50 154.0 51 136.0 52 122.0 53 119.5 54 105.0 55 103.0 56 101.5 57 100.0 58 102.0 59 99.5 60 103.5 61 97.0 62 91.5 63 88.0 64 80.0 65 72.0 66 60.0 67 53.5 68 53.0 69 49.5 70 42.5 71 34.5 72 22.0 73 13.0 74 10.5 75 5.5 76 2.5 77 2.0 78 1.0 79 0.5 80 1.5 81 2.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.7374999999999999 74-75 0.2375 76-77 0.4875 78-79 0.2875 80-81 0.1 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0625 92-93 0.0125 94-95 0.13749999999999998 96-97 0.0 98-99 0.25 100-101 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374413 spots for SRR5279889.sra Written 3374413 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra Read 3374397 spots for SRR5279889.sra Written 3374397 spots for SRR5279889.sra SRR ids: ['SRR5279889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_juagp68p SRR5279889.sra spots: 67487956 blocks: [[1, 3374397], [3374398, 6748794], [6748795, 10123191], [10123192, 13497588], [13497589, 16871985], [16871986, 20246382], [20246383, 23620779], [23620780, 26995176], [26995177, 30369573], [30369574, 33743970], [33743971, 37118367], [37118368, 40492764], [40492765, 43867161], [43867162, 47241558], [47241559, 50615955], [50615956, 53990352], [53990353, 57364749], [57364750, 60739146], [60739147, 64113543], [64113544, 67487956]] SRR5279889 file size 18475330 SRR5279889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5279889 SRR5279889_1.fastq SRR5279889_2.fastq Input file: SRR5279889_1.fastq Paired file: SRR5279889_2.fastq trimmed: SRR5279889-trimmed-pair1.fastq, SRR5279889-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:35:32 2024 >> started Thu Dec 12 02:47:20 2024 >> done (707.333s) 67487956 read pairs processed; of these: 263295 ( 0.39%) short read pairs filtered out after trimming by size control 427951 ( 0.63%) empty read pairs filtered out after trimming by size control 66796710 (98.98%) read pairs available; of these: 12738047 (19.07%) trimmed read pairs available after processing 54058663 (80.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 83 0.00% 19 118 0.00% 20 192 0.00% 21 348 0.00% 22 564 0.00% 23 843 0.00% 24 1148 0.00% 25 1387 0.00% 26 1764 0.00% 27 2110 0.00% 28 2642 0.00% 29 3118 0.00% 30 3638 0.01% 31 4184 0.01% 32 4920 0.01% 33 5573 0.01% 34 6192 0.01% 35 6926 0.01% 36 7713 0.01% 37 8428 0.01% 38 9157 0.01% 39 10044 0.02% 40 10692 0.02% 41 11782 0.02% 42 12337 0.02% 43 13001 0.02% 44 14155 0.02% 45 14945 0.02% 46 15972 0.02% 47 16727 0.03% 48 17292 0.03% 49 18261 0.03% 50 18833 0.03% 51 19861 0.03% 52 21078 0.03% 53 22414 0.03% 54 23552 0.04% 55 25125 0.04% 56 26872 0.04% 57 29180 0.04% 58 31229 0.05% 59 42173 0.06% 60 52335 0.08% 61 54454 0.08% 62 58950 0.09% 63 64110 0.10% 64 69180 0.10% 65 73774 0.11% 66 78302 0.12% 67 82623 0.12% 68 88271 0.13% 69 93224 0.14% 70 97105 0.15% 71 103304 0.15% 72 106345 0.16% 73 108548 0.16% 74 113884 0.17% 75 119579 0.18% 76 90163 0.13% 77 107969 0.16% 78 119042 0.18% 79 124718 0.19% 80 129744 0.19% 81 135711 0.20% 82 141984 0.21% 83 150780 0.23% 84 158014 0.24% 85 168445 0.25% 86 177721 0.27% 87 191307 0.29% 88 190739 0.29% 89 184415 0.28% 90 218027 0.33% 91 242856 0.36% 92 270156 0.40% 93 311724 0.47% 94 369101 0.55% 95 443277 0.66% 96 554285 0.83% 97 722594 1.08% 98 1024345 1.53% 99 1461424 2.19% 100 3198945 4.79% 101 54058663 80.93% 66796710 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=4 prefix-density=0.53 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=16.51 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.7 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=3 prefix-density=0.51 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=26 fanout-score=4.21 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=1.4 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC SRR5279889 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:51:38 Started mapping on | Dec 12 02:51:39 Finished on | Dec 12 04:18:43 Mapping speed, Million of reads per hour | 46.03 Number of input reads | 66796710 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 64171668 Uniquely mapped reads % | 96.07% Average mapped length | 197.31 Number of splices: Total | 48161514 Number of splices: Annotated (sjdb) | 45895596 Number of splices: GT/AG | 47403630 Number of splices: GC/AG | 630312 Number of splices: AT/AC | 20952 Number of splices: Non-canonical | 106620 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 649884 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 38425 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2023891 2023891 2023891 N_multimapping 649884 649884 649884 N_noFeature 1994503 32326588 32502869 N_ambiguous 1571403 124381 122131 UnstrandedReadsAssigned:60605762 PositiveStrandReadsAssigned:31720699 NegativeStrandReadsAssigned:31546668 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5279889 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5279889-trimmed-pair1.fastq SRR5279889-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 66,796,710 reads, 62,412,075 reads pseudoaligned [quant] estimated average fragment length: 221.77 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR5279889.ke.tsv 35125 SRR5279889.se.tsv 88098 total ==> SRR5279889.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 715.496 0 0 PNS24247 1044 823.23 97.792 2.67509 PNS24249 1928 1707.23 130.181 1.71717 PNS24246 1044 823.23 97.792 2.67509 PNS24248 1044 823.23 97.792 2.67509 PNS24244 1471 1250.23 246.443 4.43898 PNS24243 293 93.2568 59 14.2472 KQK14069 1603 1382.23 2908.45 47.3847 KQK14071 474 257.338 48.8678 4.27638 ==> SRR5279889.se.tsv <== BRADI_1g14170v3 3132 BRADI_1g53295v3 2511 BRADI_1g59795v3 906 BRADI_1g07683v3 1 BRADI_1g00485v3 94 BRADI_1g20270v3 903 BRADI_1g74790v3 618 BRADI_1g09890v3 0 BRADI_1g77505v3 791 BRADI_1g48960v3 2 SRR5279889 completed mapping pipeline successfully