Starting /dee2/code/volunteer_pipeline.sh SRR5279890 current disk space = 1550649569280 free memory = 1599797452 SRR5279890 SRAfilesize a88dc9c23495112c34a6eeffd163a6da SRR5279890.sra SRR5279890.sra file validated SRR5279890 is paired end SRR5279890 is conventional basespace SRR5279890 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5279890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38475 34.0 31.0 34.0 31.0 34.0 2 32.38825 34.0 31.0 34.0 31.0 34.0 3 32.48375 34.0 31.0 34.0 31.0 34.0 4 35.74975 37.0 35.0 37.0 35.0 37.0 5 35.7045 37.0 35.0 37.0 35.0 37.0 6 35.8665 37.0 37.0 37.0 35.0 37.0 7 35.8245 37.0 37.0 37.0 35.0 37.0 8 35.727 37.0 36.0 37.0 35.0 37.0 9 37.5805 39.0 38.0 39.0 35.0 39.0 10-11 37.6695 39.0 38.0 39.0 35.0 39.0 12-13 37.29375 39.0 37.5 39.0 34.5 39.0 14-15 39.10025 41.0 39.0 41.0 36.0 41.0 16-17 39.043625 41.0 39.0 41.0 36.0 41.0 18-19 38.705625 40.5 38.5 41.0 35.0 41.0 20-21 38.949375 41.0 39.0 41.0 35.5 41.0 22-23 38.706125 40.5 38.5 41.0 35.0 41.0 24-25 38.78212499999999 40.5 39.0 41.0 35.5 41.0 26-27 38.870999999999995 41.0 39.0 41.0 35.5 41.0 28-29 38.720375000000004 40.0 38.5 41.0 35.0 41.0 30-31 38.299375 40.0 38.0 41.0 33.5 41.0 32-33 38.5595 40.0 38.0 41.0 35.0 41.0 34-35 38.299875 40.0 38.0 41.0 34.0 41.0 36-37 38.291125 40.0 38.0 41.0 34.0 41.0 38-39 38.313874999999996 40.0 38.0 41.0 34.0 41.0 40-41 38.14875 40.0 38.0 41.0 33.5 41.0 42-43 38.083124999999995 40.0 38.0 41.0 34.0 41.0 44-45 37.85724999999999 40.0 37.0 41.0 33.0 41.0 46-47 37.647125 40.0 37.0 41.0 33.0 41.0 48-49 37.533874999999995 40.0 36.5 41.0 33.0 41.0 50-51 35.362625 37.5 33.5 39.0 30.0 40.0 52-53 35.988749999999996 38.5 34.5 39.5 30.5 40.0 54-55 36.831374999999994 39.0 35.0 40.5 32.0 41.0 56-57 36.828125 39.0 35.0 41.0 32.0 41.0 58-59 36.451750000000004 38.5 35.0 41.0 31.5 41.0 60-61 36.348625 38.0 35.0 41.0 32.0 41.0 62-63 36.105999999999995 37.0 35.0 40.0 31.5 41.0 64-65 35.68325 37.0 35.0 40.0 31.0 41.0 66-67 35.477500000000006 36.0 35.0 39.5 31.0 41.0 68-69 35.121624999999995 36.0 35.0 39.0 30.5 41.0 70-71 34.70875 35.0 34.0 39.0 30.5 40.5 72-73 34.328625 35.0 34.0 37.5 30.0 40.0 74-75 33.89775 35.0 34.0 37.0 29.0 39.0 76-77 33.6045 35.0 34.0 36.5 29.0 39.0 78-79 33.487750000000005 35.0 34.0 36.0 29.0 37.5 80-81 33.253375000000005 35.0 34.0 36.0 29.0 37.0 82-83 32.924375 35.0 34.0 35.0 29.0 37.0 84-85 32.718625 35.0 33.5 35.0 29.0 36.0 86-87 32.669124999999994 35.0 33.5 35.0 29.0 36.0 88-89 32.571875 35.0 33.0 35.0 29.0 36.0 90-91 32.318 35.0 33.0 35.0 28.0 35.0 92-93 32.17875 35.0 33.0 35.0 27.0 35.0 94-95 31.8855 35.0 33.0 35.0 27.0 35.0 96-97 31.677875 35.0 33.0 35.0 26.0 35.0 98-99 31.517625000000002 35.0 33.0 35.0 25.0 35.0 100-101 29.898874999999997 34.0 30.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 3.0 4 3.0 5 5.0 6 2.0 7 2.0 8 1.0 9 4.0 10 4.0 11 6.0 12 8.0 13 5.0 14 4.0 15 3.0 16 6.0 17 4.0 18 8.0 19 6.0 20 8.0 21 7.0 22 11.0 23 11.0 24 11.0 25 8.0 26 18.0 27 26.0 28 46.0 29 48.0 30 39.0 31 71.0 32 99.0 33 122.0 34 188.0 35 319.0 36 627.0 37 1008.0 38 1080.0 39 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.975 12.0 14.625 43.4 2 26.075 19.225 31.275 23.425 3 27.3 22.475 22.95 27.275 4 28.375 29.25 17.849999999999998 24.525 5 28.4 31.075000000000003 20.375 20.150000000000002 6 21.075 34.075 22.2 22.650000000000002 7 19.400000000000002 17.0 40.5 23.1 8 24.025 20.65 25.95 29.375 9 21.625 20.200000000000003 30.425 27.750000000000004 10-11 24.625 29.5375 21.5 24.337500000000002 12-13 23.9125 22.9875 26.75 26.35 14-15 23.95 24.0125 25.85 26.187500000000004 16-17 24.9875 24.55 24.25 26.2125 18-19 23.9125 25.2625 25.1875 25.637500000000003 20-21 24.462500000000002 25.5 24.9 25.137500000000003 22-23 23.7875 25.124999999999996 24.8 26.2875 24-25 24.3125 24.525 25.324999999999996 25.837500000000002 26-27 23.9375 25.724999999999998 24.5375 25.8 28-29 24.925 25.6 24.375 25.1 30-31 24.65 24.8 25.624999999999996 24.925 32-33 24.2 25.85 24.887500000000003 25.0625 34-35 24.95 24.0375 25.424999999999997 25.587500000000002 36-37 24.1875 24.637500000000003 25.924999999999997 25.25 38-39 24.95 25.3 25.0375 24.712500000000002 40-41 24.0375 24.325 25.687500000000004 25.95 42-43 24.637500000000003 24.275 25.912499999999998 25.174999999999997 44-45 25.374999999999996 25.8125 24.725 24.087500000000002 46-47 24.962500000000002 25.662499999999998 24.637500000000003 24.7375 48-49 24.3875 25.55 24.85 25.2125 50-51 24.6625 24.762500000000003 24.9375 25.637500000000003 52-53 24.962500000000002 25.4375 24.2625 25.337500000000002 54-55 24.175 25.75 25.162499999999998 24.9125 56-57 25.275 25.587500000000002 24.5125 24.625 58-59 24.099999999999998 24.7 25.55 25.650000000000002 60-61 23.8875 25.174999999999997 25.650000000000002 25.2875 62-63 24.275 25.75 23.875 26.1 64-65 24.4875 24.9125 25.4375 25.162499999999998 66-67 24.8125 25.724999999999998 24.8625 24.6 68-69 24.15 26.087500000000002 24.9375 24.825 70-71 25.5625 25.1 24.9 24.4375 72-73 23.474001507159006 25.985933182617433 25.37050992213012 25.169555388093446 74-75 24.64312546957175 25.118958176809414 25.169045830202858 25.068870523415974 76-77 25.2508780732564 25.301053687907675 24.849473156046162 24.598595082789764 78-79 24.46448703494927 26.080420894400604 24.41438055868721 25.04071151196292 80-81 24.212106053026513 25.03751875937969 26.050525262631314 24.69984992496248 82-83 24.40305038129766 25.815726965870734 25.278159769971246 24.50306288286036 84-85 23.962500000000002 25.412499999999998 25.4625 25.162499999999998 86-87 24.025 25.85 25.35 24.775 88-89 24.637500000000003 25.837500000000002 24.5 25.025 90-91 24.88122030507627 24.118529632408105 25.6064016004001 25.393848462115532 92-93 24.962500000000002 25.1875 25.0 24.85 94-95 24.84984984984985 25.287787787787785 25.212712712712715 24.64964964964965 96-97 23.9 25.4375 25.9875 24.675 98-99 24.42719419055966 25.804432202328787 24.301990734944283 25.46638287216727 100-101 24.684256596223584 25.497061398024258 24.884331624359135 24.934350381393024 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 3.0 28 3.5 29 2.5 30 5.5 31 9.0 32 14.0 33 22.5 34 25.5 35 33.5 36 44.5 37 59.0 38 85.0 39 94.0 40 110.0 41 144.5 42 168.0 43 174.5 44 178.5 45 183.5 46 183.0 47 171.5 48 170.0 49 172.0 50 157.0 51 142.5 52 132.5 53 128.0 54 117.5 55 102.5 56 98.0 57 100.5 58 99.5 59 102.0 60 110.0 61 103.5 62 79.0 63 70.5 64 70.5 65 63.5 66 52.5 67 48.0 68 44.0 69 37.0 70 33.5 71 21.5 72 11.0 73 8.0 74 5.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.475 74-75 0.17500000000000002 76-77 0.35000000000000003 78-79 0.21250000000000002 80-81 0.05 82-83 0.0125 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.1 96-97 0.0 98-99 0.1625 100-101 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5279890 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5279890_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.845 34.0 31.0 34.0 31.0 34.0 2 32.99675 34.0 31.0 34.0 31.0 34.0 3 32.8765 34.0 31.0 34.0 31.0 34.0 4 36.334 37.0 37.0 37.0 35.0 37.0 5 36.35275 37.0 37.0 37.0 35.0 37.0 6 36.3205 37.0 37.0 37.0 35.0 37.0 7 36.3175 37.0 37.0 37.0 35.0 37.0 8 36.2535 37.0 37.0 37.0 35.0 37.0 9 38.04775 39.0 38.0 39.0 35.0 39.0 10-11 38.06375 39.0 38.5 39.0 36.0 39.0 12-13 37.95275 39.0 38.5 39.0 35.0 39.0 14-15 39.619625 41.0 40.0 41.0 37.0 41.0 16-17 39.516125 41.0 39.5 41.0 37.0 41.0 18-19 39.509 41.0 39.0 41.0 37.0 41.0 20-21 39.480625 41.0 39.0 41.0 36.5 41.0 22-23 39.344750000000005 41.0 39.0 41.0 36.5 41.0 24-25 39.319125 41.0 39.0 41.0 36.0 41.0 26-27 39.13575 40.5 39.0 41.0 35.5 41.0 28-29 39.170500000000004 41.0 39.0 41.0 36.0 41.0 30-31 39.093875 41.0 39.0 41.0 35.5 41.0 32-33 39.047250000000005 40.0 39.0 41.0 35.5 41.0 34-35 38.898375 40.0 38.5 41.0 35.0 41.0 36-37 38.7515 40.0 38.0 41.0 35.0 41.0 38-39 38.531375 40.0 38.0 41.0 34.0 41.0 40-41 38.526624999999996 40.0 38.0 41.0 34.0 41.0 42-43 38.430625000000006 40.0 38.0 41.0 34.0 41.0 44-45 38.282875 40.0 37.5 41.0 33.5 41.0 46-47 38.089625 40.0 37.0 41.0 33.5 41.0 48-49 37.93 40.0 37.0 41.0 33.5 41.0 50-51 37.721000000000004 40.0 36.0 41.0 33.0 41.0 52-53 37.426249999999996 39.0 35.5 41.0 33.0 41.0 54-55 37.223375000000004 39.0 35.0 41.0 33.0 41.0 56-57 36.884875 39.0 35.0 41.0 32.0 41.0 58-59 36.724374999999995 38.0 35.0 41.0 32.0 41.0 60-61 36.122625 37.0 35.0 40.0 31.0 41.0 62-63 35.785875000000004 37.0 35.0 40.0 30.5 41.0 64-65 35.533249999999995 36.5 34.5 39.5 30.0 41.0 66-67 35.288624999999996 36.0 34.0 39.0 30.0 41.0 68-69 34.872749999999996 35.5 34.0 39.0 30.0 40.5 70-71 34.45725 35.0 34.0 38.5 29.0 40.0 72-73 34.172875000000005 35.0 34.0 37.0 29.0 39.0 74-75 33.879875 35.0 33.5 37.0 29.0 39.0 76-77 30.570625 32.5 29.0 34.5 23.5 36.0 78-79 33.136125 35.0 33.0 36.0 28.0 37.0 80-81 33.350375 35.0 34.0 35.5 29.0 37.0 82-83 33.271375000000006 35.0 34.0 35.0 29.5 37.0 84-85 33.123000000000005 35.0 34.0 35.0 29.5 36.0 86-87 32.947125 35.0 33.5 35.0 29.0 36.0 88-89 32.642125 35.0 33.0 35.0 29.0 36.0 90-91 32.362125 35.0 33.0 35.0 27.0 35.0 92-93 32.259125 35.0 33.0 35.0 27.0 35.0 94-95 32.086875 35.0 33.0 35.0 27.0 35.0 96-97 32.018375 35.0 33.0 35.0 27.0 35.0 98-99 31.63375 35.0 33.0 35.0 26.0 35.0 100-101 29.77475 34.0 30.0 34.5 13.5 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 3.0 10 1.0 11 0.0 12 3.0 13 5.0 14 7.0 15 7.0 16 3.0 17 3.0 18 9.0 19 10.0 20 5.0 21 11.0 22 8.0 23 11.0 24 15.0 25 12.0 26 23.0 27 23.0 28 33.0 29 50.0 30 57.0 31 64.0 32 114.0 33 141.0 34 184.0 35 346.0 36 617.0 37 1041.0 38 1079.0 39 112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.711422845691384 11.848697394789578 13.326653306613226 44.11322645290581 2 25.35 19.625 31.75 23.275000000000002 3 26.224999999999998 22.2 23.974999999999998 27.6 4 28.325 28.175 18.05 25.45 5 29.599999999999998 29.225 20.775 20.4 6 22.525000000000002 33.275 21.825 22.375 7 19.175 17.45 39.550000000000004 23.825 8 22.2 20.849999999999998 26.474999999999998 30.475 9 22.35 20.7 28.7 28.249999999999996 10-11 25.825 28.6875 20.5875 24.9 12-13 24.6875 23.7125 25.7 25.900000000000002 14-15 24.5 24.587500000000002 25.9875 24.925 16-17 25.35 24.4125 24.725 25.5125 18-19 24.1625 25.4875 25.5375 24.8125 20-21 25.25 26.087500000000002 24.7875 23.875 22-23 24.6125 25.0125 25.650000000000002 24.725 24-25 24.375 25.05 25.587500000000002 24.9875 26-27 24.8 25.6 24.775 24.825 28-29 24.975 24.9 24.55 25.575 30-31 24.0375 24.9875 25.7625 25.2125 32-33 25.087500000000002 25.0625 24.95 24.9 34-35 24.925 25.0 25.412499999999998 24.6625 36-37 24.6875 24.75 25.0125 25.55 38-39 25.0625 26.0 24.975 23.962500000000002 40-41 25.2625 25.087500000000002 25.137500000000003 24.5125 42-43 24.474999999999998 25.275 25.45 24.8 44-45 24.7875 26.137500000000003 24.087500000000002 24.9875 46-47 24.875 25.8 24.825 24.5 48-49 24.7 24.625 25.575 25.1 50-51 24.6875 25.362499999999997 25.0375 24.9125 52-53 24.6875 26.0 25.087500000000002 24.224999999999998 54-55 24.125 24.675 24.85 26.35 56-57 24.3125 25.0375 26.1125 24.5375 58-59 24.337500000000002 24.5625 25.7875 25.3125 60-61 24.7375 24.6125 25.775 24.875 62-63 24.825 25.7 24.95 24.525 64-65 25.374999999999996 25.587500000000002 25.224999999999998 23.8125 66-67 25.0625 25.0125 24.9375 24.9875 68-69 24.575 25.5375 25.0 24.887500000000003 70-71 25.587500000000002 24.7 24.975 24.7375 72-73 24.3 25.7125 25.5125 24.474999999999998 74-75 24.837500000000002 24.5 25.174999999999997 25.4875 76-77 25.825 25.0375 24.6875 24.45 78-79 23.9 26.0125 25.900000000000002 24.1875 80-81 24.575 25.124999999999996 25.624999999999996 24.675 82-83 25.2125 25.650000000000002 25.5375 23.599999999999998 84-85 24.637500000000003 25.224999999999998 25.087500000000002 25.05 86-87 24.275 25.337500000000002 25.0375 25.35 88-89 24.9375 24.875 24.6875 25.5 90-91 24.9375 25.874999999999996 25.0125 24.175 92-93 25.2375 25.0375 25.025 24.7 94-95 24.337500000000002 25.412499999999998 25.7625 24.4875 96-97 24.05 25.15 25.637500000000003 25.162499999999998 98-99 25.224999999999998 25.4 24.675 24.7 100-101 26.087500000000002 25.05 24.4125 24.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 1.5 28 2.0 29 3.5 30 5.0 31 7.5 32 12.0 33 14.0 34 20.0 35 33.0 36 47.0 37 57.0 38 74.0 39 95.0 40 115.0 41 144.5 42 168.0 43 174.0 44 173.5 45 183.5 46 185.0 47 190.0 48 197.0 49 168.5 50 148.0 51 151.0 52 134.5 53 118.5 54 117.0 55 98.5 56 100.5 57 114.0 58 102.5 59 98.0 60 102.0 61 101.5 62 88.5 63 76.0 64 68.0 65 60.0 66 50.5 67 48.0 68 46.0 69 33.0 70 23.5 71 15.5 72 12.0 73 8.0 74 4.5 75 4.0 76 1.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7070707070707071 1.4000000000000001 3 0.15151515151515152 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407722 spots for SRR5279890.sra Written 3407722 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra Read 3407714 spots for SRR5279890.sra Written 3407714 spots for SRR5279890.sra SRR ids: ['SRR5279890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ubz4atfc SRR5279890.sra spots: 68154288 blocks: [[1, 3407714], [3407715, 6815428], [6815429, 10223142], [10223143, 13630856], [13630857, 17038570], [17038571, 20446284], [20446285, 23853998], [23853999, 27261712], [27261713, 30669426], [30669427, 34077140], [34077141, 37484854], [37484855, 40892568], [40892569, 44300282], [44300283, 47707996], [47707997, 51115710], [51115711, 54523424], [54523425, 57931138], [57931139, 61338852], [61338853, 64746566], [64746567, 68154288]] SRR5279890 file size 18657792 SRR5279890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5279890 SRR5279890_1.fastq SRR5279890_2.fastq Input file: SRR5279890_1.fastq Paired file: SRR5279890_2.fastq trimmed: SRR5279890-trimmed-pair1.fastq, SRR5279890-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:23:41 2024 >> started Fri Dec 6 14:24:48 2024 >> done (67.016s) 68154288 read pairs processed; of these: 246227 ( 0.36%) short read pairs filtered out after trimming by size control 420027 ( 0.62%) empty read pairs filtered out after trimming by size control 67488034 (99.02%) read pairs available; of these: 12125254 (17.97%) trimmed read pairs available after processing 55362780 (82.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 49 0.00% 20 114 0.00% 21 256 0.00% 22 424 0.00% 23 640 0.00% 24 850 0.00% 25 1076 0.00% 26 1439 0.00% 27 1689 0.00% 28 2041 0.00% 29 2376 0.00% 30 2924 0.00% 31 3470 0.01% 32 4033 0.01% 33 4569 0.01% 34 5332 0.01% 35 5688 0.01% 36 6574 0.01% 37 7406 0.01% 38 7878 0.01% 39 8620 0.01% 40 9409 0.01% 41 9984 0.01% 42 10746 0.02% 43 11627 0.02% 44 12323 0.02% 45 13277 0.02% 46 14089 0.02% 47 15155 0.02% 48 15956 0.02% 49 16330 0.02% 50 16773 0.02% 51 17704 0.03% 52 18785 0.03% 53 19916 0.03% 54 20926 0.03% 55 22344 0.03% 56 24362 0.04% 57 26061 0.04% 58 28416 0.04% 59 38016 0.06% 60 47459 0.07% 61 49511 0.07% 62 54175 0.08% 63 58819 0.09% 64 63349 0.09% 65 67648 0.10% 66 72587 0.11% 67 77232 0.11% 68 82048 0.12% 69 86057 0.13% 70 90242 0.13% 71 95698 0.14% 72 98862 0.15% 73 101996 0.15% 74 106261 0.16% 75 112899 0.17% 76 84786 0.13% 77 100459 0.15% 78 111527 0.17% 79 116690 0.17% 80 121616 0.18% 81 126750 0.19% 82 132866 0.20% 83 140766 0.21% 84 147960 0.22% 85 156954 0.23% 86 167163 0.25% 87 179382 0.27% 88 181701 0.27% 89 175185 0.26% 90 206345 0.31% 91 230659 0.34% 92 257547 0.38% 93 296447 0.44% 94 353747 0.52% 95 424333 0.63% 96 529903 0.79% 97 693182 1.03% 98 988027 1.46% 99 1414377 2.10% 100 3092384 4.58% 101 55362780 82.03% 67488034 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=16 prefix-density=0.57 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=21.15 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=17 prefix-density=0.57 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=23.02 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR5279890 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:25:31 Started mapping on | Dec 06 14:25:31 Finished on | Dec 06 14:30:16 Mapping speed, Million of reads per hour | 852.48 Number of input reads | 67488034 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 64980966 Uniquely mapped reads % | 96.29% Average mapped length | 197.65 Number of splices: Total | 49081885 Number of splices: Annotated (sjdb) | 46821260 Number of splices: GT/AG | 48347929 Number of splices: GC/AG | 641353 Number of splices: AT/AC | 21063 Number of splices: Non-canonical | 71540 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 649841 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 28960 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1907172 1907172 1907172 N_multimapping 649841 649841 649841 N_noFeature 2119980 32951539 32857745 N_ambiguous 1531741 125925 126926 UnstrandedReadsAssigned:61329245 PositiveStrandReadsAssigned:31903502 NegativeStrandReadsAssigned:31996295 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5279890 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5279890-trimmed-pair1.fastq SRR5279890-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 67,488,034 reads, 63,138,022 reads pseudoaligned [quant] estimated average fragment length: 217.688 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52973 SRR5279890.ke.tsv 35125 SRR5279890.se.tsv 88098 total ==> SRR5279890.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.464 0 0 PNS24247 1044 827.312 144.112 3.93322 PNS24249 1928 1711.31 116.837 1.54159 PNS24246 1044 827.312 144.112 3.93322 PNS24248 1044 827.312 144.112 3.93322 PNS24244 1471 1254.31 245.828 4.4253 PNS24243 293 95.1506 55 13.0518 KQK14069 1603 1386.31 3498.84 56.9876 KQK14071 474 260.497 47.0841 4.08122 ==> SRR5279890.se.tsv <== BRADI_1g14170v3 3799 BRADI_1g53295v3 705 BRADI_1g59795v3 930 BRADI_1g07683v3 0 BRADI_1g00485v3 109 BRADI_1g20270v3 872 BRADI_1g74790v3 634 BRADI_1g09890v3 0 BRADI_1g77505v3 822 BRADI_1g48960v3 1 SRR5279890 completed mapping pipeline successfully