Starting /dee2/code/volunteer_pipeline.sh SRR5279891 current disk space = 1550592294912 free memory = 1603095372 SRR5279891 SRAfilesize 44b803bfdb5fa6ad91b60148270f6df2 SRR5279891.sra SRR5279891.sra file validated SRR5279891 is paired end SRR5279891 is conventional basespace SRR5279891 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5279891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3145 34.0 31.0 34.0 31.0 34.0 2 32.3155 34.0 31.0 34.0 30.0 34.0 3 32.39275 34.0 31.0 34.0 30.0 34.0 4 35.64025 37.0 35.0 37.0 35.0 37.0 5 35.60425 37.0 35.0 37.0 33.0 37.0 6 35.869 37.0 37.0 37.0 35.0 37.0 7 35.8085 37.0 36.0 37.0 35.0 37.0 8 35.6605 37.0 36.0 37.0 35.0 37.0 9 37.5395 39.0 38.0 39.0 35.0 39.0 10-11 37.539874999999995 39.0 38.0 39.0 35.0 39.0 12-13 37.138625 39.0 37.0 39.0 34.0 39.0 14-15 38.917625 41.0 39.0 41.0 36.0 41.0 16-17 38.8545 41.0 39.0 41.0 35.5 41.0 18-19 38.52575 40.0 38.5 41.0 34.0 41.0 20-21 38.7815 41.0 39.0 41.0 35.0 41.0 22-23 38.502250000000004 40.0 38.5 41.0 34.5 41.0 24-25 38.562125 40.0 38.5 41.0 34.5 41.0 26-27 38.702625 40.0 39.0 41.0 34.5 41.0 28-29 38.446375 40.0 38.0 41.0 34.0 41.0 30-31 38.0945 40.0 38.0 41.0 33.5 41.0 32-33 38.343875 40.0 38.0 41.0 34.0 41.0 34-35 38.190625 40.0 38.0 41.0 33.5 41.0 36-37 38.12375 40.0 38.0 41.0 33.5 41.0 38-39 38.091625 40.0 38.0 41.0 33.0 41.0 40-41 37.87325 40.0 37.5 41.0 33.0 41.0 42-43 37.7535 40.0 37.0 41.0 33.0 41.0 44-45 37.54275 40.0 37.0 41.0 33.0 41.0 46-47 37.244625 40.0 36.0 41.0 32.0 41.0 48-49 37.1145 40.0 35.5 41.0 32.0 41.0 50-51 34.992125 37.0 33.0 39.0 29.0 40.0 52-53 35.69425 38.0 34.5 39.5 30.5 40.0 54-55 36.53725 39.0 35.0 40.5 31.5 41.0 56-57 36.41475 39.0 35.0 41.0 31.0 41.0 58-59 36.128 38.0 35.0 41.0 31.0 41.0 60-61 36.012 37.5 35.0 40.5 31.0 41.0 62-63 35.762875 37.0 35.0 40.0 31.0 41.0 64-65 35.372625 36.0 35.0 40.0 30.5 41.0 66-67 35.1325 36.0 35.0 39.0 30.5 41.0 68-69 34.8125 35.0 34.0 39.0 30.0 41.0 70-71 34.36575 35.0 34.0 38.5 29.5 40.0 72-73 33.89575 35.0 34.0 37.0 29.0 39.5 74-75 33.548249999999996 35.0 34.0 37.0 28.5 39.0 76-77 33.328125 35.0 34.0 36.0 28.5 39.0 78-79 33.1035 35.0 34.0 36.0 29.0 37.5 80-81 32.944125 35.0 33.5 35.5 29.0 37.0 82-83 32.661500000000004 35.0 33.0 35.0 27.5 36.5 84-85 32.419 35.0 33.0 35.0 27.0 36.0 86-87 32.256125 35.0 33.0 35.0 27.0 36.0 88-89 32.15412499999999 35.0 33.0 35.0 27.0 36.0 90-91 31.96225 35.0 33.0 35.0 27.0 35.0 92-93 31.782875 35.0 33.0 35.0 26.5 35.0 94-95 31.394750000000002 35.0 33.0 35.0 24.5 35.0 96-97 31.171375 35.0 33.0 35.0 23.5 35.0 98-99 31.01225 35.0 33.0 35.0 23.0 35.0 100-101 29.318625 34.0 29.5 35.0 11.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 2.0 4 1.0 5 3.0 6 2.0 7 3.0 8 1.0 9 3.0 10 9.0 11 6.0 12 7.0 13 9.0 14 7.0 15 8.0 16 5.0 17 5.0 18 9.0 19 5.0 20 6.0 21 6.0 22 14.0 23 10.0 24 18.0 25 13.0 26 19.0 27 27.0 28 57.0 29 48.0 30 62.0 31 68.0 32 105.0 33 131.0 34 206.0 35 320.0 36 651.0 37 1011.0 38 980.0 39 133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.175 11.55 15.9 43.375 2 26.75 17.925 30.925000000000004 24.4 3 26.674999999999997 21.525 23.525 28.275 4 28.725 27.525 18.075 25.674999999999997 5 28.725 30.0 20.325 20.95 6 23.325000000000003 33.35 21.2 22.125 7 20.8 17.45 38.25 23.5 8 22.900000000000002 21.15 25.874999999999996 30.075000000000003 9 23.400000000000002 19.75 29.599999999999998 27.250000000000004 10-11 25.5125 28.999999999999996 20.599999999999998 24.887500000000003 12-13 24.3 22.3875 26.5375 26.775 14-15 25.15 24.15 24.8625 25.837500000000002 16-17 25.0 24.3 24.7375 25.9625 18-19 24.825 24.525 24.9125 25.7375 20-21 25.2125 24.9125 24.587500000000002 25.2875 22-23 24.575 25.15 23.8875 26.387500000000003 24-25 24.75 24.3125 24.725 26.2125 26-27 25.3125 24.6875 24.8 25.2 28-29 25.224999999999998 24.675 23.9 26.200000000000003 30-31 24.125 25.275 24.087500000000002 26.5125 32-33 24.712500000000002 24.825 25.025 25.4375 34-35 24.425 24.6125 25.0375 25.924999999999997 36-37 25.2 24.575 24.275 25.95 38-39 25.174999999999997 24.65 24.65 25.525 40-41 25.074999999999996 24.075 24.587500000000002 26.2625 42-43 24.9 24.712500000000002 25.174999999999997 25.2125 44-45 25.324999999999996 24.9125 24.0375 25.724999999999998 46-47 25.4875 24.962500000000002 24.8625 24.6875 48-49 25.087500000000002 24.75 24.45 25.7125 50-51 24.6625 25.35 24.3625 25.624999999999996 52-53 24.825 24.55 24.975 25.650000000000002 54-55 25.224999999999998 24.9375 23.9 25.937500000000004 56-57 25.2 25.362499999999997 24.637500000000003 24.8 58-59 24.275 24.9875 25.074999999999996 25.662499999999998 60-61 24.2375 24.5 24.4875 26.775 62-63 24.8 25.0375 24.887500000000003 25.275 64-65 24.962500000000002 25.074999999999996 24.4125 25.55 66-67 23.9 25.324999999999996 24.8 25.974999999999998 68-69 24.2 25.162499999999998 25.575 25.0625 70-71 24.975 25.5625 24.3 25.162499999999998 72-73 24.78944060339409 24.71401634192332 24.802011313639223 25.69453174104337 74-75 25.30678687703481 24.855997996493866 24.492862509391436 25.344352617079892 76-77 25.335507337263262 24.256866925874828 25.10974539069359 25.297880346168316 78-79 24.52712013027684 25.053238131028436 24.940498559438808 25.47914317925592 80-81 25.30647985989492 25.006254691018263 24.468351263447584 25.21891418563923 82-83 25.609603601350507 24.78429411029136 24.059022133299987 25.54708015505815 84-85 23.8125 24.6875 24.45 27.05 86-87 24.85 25.05 24.3125 25.7875 88-89 24.1375 25.2875 25.4875 25.087500000000002 90-91 26.072813711998 25.459777305142 24.058551232328288 24.408857750531716 92-93 25.378172271533945 25.55319414926866 24.290536317039628 24.778097262157768 94-95 25.040691123075 25.6416677100288 24.289470389382746 25.02817077751346 96-97 25.2 25.025 24.525 25.25 98-99 24.840285606914694 25.053238131028436 24.85281222598021 25.25366403607666 100-101 24.84681755658372 25.034387895460796 25.584594222833562 24.534200325121923 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 1.5 26 1.0 27 2.5 28 4.0 29 4.5 30 5.5 31 10.0 32 13.5 33 21.0 34 22.0 35 22.5 36 35.5 37 48.0 38 62.5 39 86.0 40 93.5 41 123.5 42 162.0 43 186.0 44 184.0 45 165.0 46 180.5 47 167.0 48 155.0 49 153.5 50 132.0 51 139.5 52 147.0 53 127.5 54 112.5 55 112.0 56 112.5 57 114.5 58 115.0 59 112.5 60 113.5 61 103.5 62 82.5 63 72.0 64 79.0 65 86.0 66 74.0 67 60.0 68 50.5 69 39.5 70 35.5 71 27.5 72 17.0 73 9.0 74 4.5 75 2.0 76 1.0 77 1.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.5625 74-75 0.17500000000000002 76-77 0.3375 78-79 0.21250000000000002 80-81 0.075 82-83 0.0375 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.08750000000000001 92-93 0.0125 94-95 0.1625 96-97 0.0 98-99 0.21250000000000002 100-101 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01440485216074 97.95 2 0.9097801364670205 1.7999999999999998 3 0.050543340914834464 0.15 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5279891 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5279891_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8235 34.0 31.0 34.0 31.0 34.0 2 32.94025 34.0 31.0 34.0 31.0 34.0 3 32.82575 34.0 31.0 34.0 31.0 34.0 4 36.343 37.0 37.0 37.0 35.0 37.0 5 36.38925 37.0 37.0 37.0 35.0 37.0 6 36.30075 37.0 37.0 37.0 35.0 37.0 7 36.31275 37.0 37.0 37.0 35.0 37.0 8 36.246 37.0 37.0 37.0 35.0 37.0 9 37.94175 39.0 38.0 39.0 35.0 39.0 10-11 38.012125 39.0 38.5 39.0 35.0 39.0 12-13 37.936375 39.0 38.0 39.0 35.0 39.0 14-15 39.560500000000005 41.0 39.0 41.0 37.0 41.0 16-17 39.446125 41.0 39.0 41.0 36.5 41.0 18-19 39.41825 41.0 39.0 41.0 36.0 41.0 20-21 39.410875 41.0 39.0 41.0 36.0 41.0 22-23 39.267125 41.0 39.0 41.0 36.0 41.0 24-25 39.28075 41.0 39.0 41.0 36.0 41.0 26-27 39.033125 40.0 38.5 41.0 35.5 41.0 28-29 39.059375 40.5 39.0 41.0 35.5 41.0 30-31 39.070625 40.5 39.0 41.0 35.5 41.0 32-33 39.009125 40.0 38.5 41.0 35.0 41.0 34-35 38.92275 40.0 38.5 41.0 35.0 41.0 36-37 38.65 40.0 38.0 41.0 35.0 41.0 38-39 38.413624999999996 40.0 38.0 41.0 34.0 41.0 40-41 38.37675 40.0 38.0 41.0 34.0 41.0 42-43 38.19375 40.0 38.0 41.0 33.5 41.0 44-45 38.166125 40.0 37.0 41.0 33.0 41.0 46-47 37.948750000000004 40.0 37.0 41.0 33.0 41.0 48-49 37.791875000000005 40.0 36.0 41.0 33.0 41.0 50-51 37.548125 39.5 36.0 41.0 33.0 41.0 52-53 37.254000000000005 39.0 35.0 41.0 33.0 41.0 54-55 36.998125 39.0 35.0 41.0 32.0 41.0 56-57 36.67125 38.0 35.0 40.5 31.5 41.0 58-59 36.49875 38.0 35.0 40.0 32.0 41.0 60-61 35.931625 37.0 35.0 40.0 30.5 41.0 62-63 35.67075 36.5 34.5 40.0 30.5 41.0 64-65 35.334875 36.0 34.0 39.0 30.0 41.0 66-67 35.18625 36.0 34.0 39.0 30.0 41.0 68-69 34.811125000000004 35.0 34.0 39.0 29.5 40.0 70-71 34.258375 35.0 33.5 37.5 29.0 40.0 72-73 33.936499999999995 35.0 33.0 37.0 28.5 39.0 74-75 33.614375 35.0 33.0 36.5 29.0 39.0 76-77 30.305750000000003 32.5 29.0 34.5 22.5 35.5 78-79 32.929875 34.5 32.5 35.5 28.0 37.0 80-81 33.193375 35.0 33.0 35.0 29.0 37.0 82-83 33.138999999999996 35.0 33.0 35.0 29.0 36.5 84-85 33.0505 35.0 33.5 35.0 29.0 36.0 86-87 32.79774999999999 35.0 33.0 35.0 29.0 36.0 88-89 32.43575 35.0 33.0 35.0 27.5 36.0 90-91 32.293625 35.0 33.0 35.0 27.0 35.0 92-93 32.173375 35.0 33.0 35.0 27.0 35.0 94-95 31.992 35.0 33.0 35.0 27.0 35.0 96-97 31.81225 35.0 33.0 35.0 27.0 35.0 98-99 31.360875 35.0 32.5 35.0 24.5 35.0 100-101 29.399125 33.5 28.5 34.5 13.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 6.0 14 8.0 15 6.0 16 4.0 17 3.0 18 7.0 19 8.0 20 2.0 21 9.0 22 11.0 23 12.0 24 8.0 25 26.0 26 36.0 27 33.0 28 34.0 29 55.0 30 59.0 31 86.0 32 96.0 33 146.0 34 195.0 35 361.0 36 683.0 37 995.0 38 1001.0 39 104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.954954954954953 11.736736736736738 15.49049049049049 42.81781781781782 2 25.124999999999996 17.525 31.75 25.6 3 26.200000000000003 21.4 23.599999999999998 28.799999999999997 4 30.075000000000003 26.424999999999997 17.75 25.75 5 29.325000000000003 29.4 20.375 20.9 6 23.35 33.825 20.525 22.3 7 20.325 17.849999999999998 38.85 22.975 8 22.0 21.95 26.55 29.5 9 22.675 20.974999999999998 28.349999999999998 28.000000000000004 10-11 25.8125 29.6875 19.875 24.625 12-13 23.825 23.275000000000002 26.637499999999996 26.2625 14-15 24.7 24.425 25.6 25.275 16-17 26.200000000000003 23.25 24.55 26.0 18-19 24.0625 25.687500000000004 25.112499999999997 25.137500000000003 20-21 25.412499999999998 24.325 25.224999999999998 25.0375 22-23 25.074999999999996 25.662499999999998 24.5625 24.7 24-25 24.525 24.9875 24.6 25.887500000000003 26-27 24.75 24.9875 25.362499999999997 24.9 28-29 25.650000000000002 24.6 24.85 24.9 30-31 24.9125 25.0625 24.5375 25.4875 32-33 24.025 25.95 24.4875 25.5375 34-35 25.35 24.275 25.2375 25.137500000000003 36-37 24.425 25.0 25.2125 25.362499999999997 38-39 24.1375 25.575 24.2625 26.025 40-41 25.2 25.674999999999997 23.599999999999998 25.525 42-43 25.2 24.337500000000002 24.9375 25.525 44-45 25.2125 25.05 24.8 24.9375 46-47 26.1625 25.275 24.0 24.5625 48-49 25.2125 24.9875 24.925 24.875 50-51 25.0125 25.662499999999998 24.4 24.925 52-53 25.5625 24.85 24.175 25.412499999999998 54-55 25.2375 24.4875 24.15 26.125 56-57 25.4625 25.5625 24.65 24.325 58-59 26.125 24.1875 25.025 24.6625 60-61 25.624999999999996 25.3 23.599999999999998 25.474999999999998 62-63 25.137500000000003 24.6875 24.375 25.8 64-65 25.224999999999998 24.6875 24.9 25.1875 66-67 25.2625 23.825 25.837500000000002 25.074999999999996 68-69 25.5625 25.8 25.0625 23.575 70-71 25.3 24.675 25.174999999999997 24.85 72-73 25.687500000000004 24.875 24.349999999999998 25.087500000000002 74-75 24.725 25.4625 25.324999999999996 24.4875 76-77 25.337500000000002 25.137500000000003 24.675 24.85 78-79 25.124999999999996 24.375 25.0375 25.4625 80-81 24.9375 24.875 25.275 24.9125 82-83 25.087500000000002 24.775 24.375 25.7625 84-85 25.3125 24.5125 25.05 25.124999999999996 86-87 25.025 25.412499999999998 24.1125 25.45 88-89 25.025 24.3 24.4 26.275 90-91 24.887500000000003 23.8875 25.637500000000003 25.587500000000002 92-93 25.887500000000003 24.675 24.2625 25.174999999999997 94-95 25.5625 24.575 24.7 25.162499999999998 96-97 25.224999999999998 24.0125 25.5125 25.25 98-99 24.962500000000002 25.0625 24.887500000000003 25.087500000000002 100-101 25.4625 24.474999999999998 24.6125 25.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 1.5 28 2.0 29 4.0 30 5.5 31 7.5 32 13.0 33 16.0 34 19.0 35 28.5 36 37.5 37 45.5 38 69.0 39 88.5 40 99.0 41 120.5 42 151.0 43 176.5 44 190.5 45 192.5 46 173.0 47 162.0 48 158.5 49 162.0 50 156.0 51 136.5 52 132.0 53 132.0 54 121.0 55 104.0 56 111.5 57 114.0 58 111.5 59 110.5 60 106.5 61 106.0 62 95.5 63 88.5 64 91.5 65 79.5 66 58.0 67 49.5 68 44.5 69 34.0 70 27.0 71 25.0 72 16.5 73 7.5 74 4.0 75 4.5 76 3.5 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93617021276596 97.65 2 0.9625126646403243 1.9 3 0.07598784194528875 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025329280648429587 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 7 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTTTC 15 0.009957196 47.5 32-33 >>END_MODULE Read 3286088 spots for SRR5279891.sra Written 3286088 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra Read 3286077 spots for SRR5279891.sra Written 3286077 spots for SRR5279891.sra SRR ids: ['SRR5279891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h8lr5k69 SRR5279891.sra spots: 65721551 blocks: [[1, 3286077], [3286078, 6572154], [6572155, 9858231], [9858232, 13144308], [13144309, 16430385], [16430386, 19716462], [19716463, 23002539], [23002540, 26288616], [26288617, 29574693], [29574694, 32860770], [32860771, 36146847], [36146848, 39432924], [39432925, 42719001], [42719002, 46005078], [46005079, 49291155], [49291156, 52577232], [52577233, 55863309], [55863310, 59149386], [59149387, 62435463], [62435464, 65721551]] SRR5279891 file size 17991477 SRR5279891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5279891 SRR5279891_1.fastq SRR5279891_2.fastq Input file: SRR5279891_1.fastq Paired file: SRR5279891_2.fastq trimmed: SRR5279891-trimmed-pair1.fastq, SRR5279891-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 14:29:34 2024 >> started Fri Dec 6 14:30:33 2024 >> done (59.452s) 65721551 read pairs processed; of these: 255143 ( 0.39%) short read pairs filtered out after trimming by size control 473412 ( 0.72%) empty read pairs filtered out after trimming by size control 64992996 (98.89%) read pairs available; of these: 12157315 (18.71%) trimmed read pairs available after processing 52835681 (81.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 53 0.00% 20 146 0.00% 21 280 0.00% 22 432 0.00% 23 706 0.00% 24 927 0.00% 25 1178 0.00% 26 1438 0.00% 27 1916 0.00% 28 2297 0.00% 29 2669 0.00% 30 3189 0.00% 31 3802 0.01% 32 4397 0.01% 33 5046 0.01% 34 5605 0.01% 35 6314 0.01% 36 6989 0.01% 37 7684 0.01% 38 8518 0.01% 39 9199 0.01% 40 10044 0.02% 41 10705 0.02% 42 11548 0.02% 43 12344 0.02% 44 13381 0.02% 45 14041 0.02% 46 15291 0.02% 47 16089 0.02% 48 16916 0.03% 49 17083 0.03% 50 17802 0.03% 51 18716 0.03% 52 19795 0.03% 53 21144 0.03% 54 21951 0.03% 55 23432 0.04% 56 25174 0.04% 57 27165 0.04% 58 29335 0.05% 59 39876 0.06% 60 49074 0.08% 61 51596 0.08% 62 55343 0.09% 63 59957 0.09% 64 65242 0.10% 65 70282 0.11% 66 74286 0.11% 67 78658 0.12% 68 84481 0.13% 69 87796 0.14% 70 91497 0.14% 71 97066 0.15% 72 100136 0.15% 73 102460 0.16% 74 107382 0.17% 75 113286 0.17% 76 84721 0.13% 77 101013 0.16% 78 111518 0.17% 79 117793 0.18% 80 121683 0.19% 81 127954 0.20% 82 133106 0.20% 83 140760 0.22% 84 149115 0.23% 85 156959 0.24% 86 166913 0.26% 87 178777 0.28% 88 180104 0.28% 89 174663 0.27% 90 205571 0.32% 91 230546 0.35% 92 257093 0.40% 93 298844 0.46% 94 351480 0.54% 95 424727 0.65% 96 534896 0.82% 97 688903 1.06% 98 987848 1.52% 99 1409206 2.17% 100 3079945 4.74% 101 52835681 81.29% 64992996 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.74 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.7 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=23.66 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR5279891 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 14:31:06 Started mapping on | Dec 06 14:31:06 Finished on | Dec 06 14:37:13 Mapping speed, Million of reads per hour | 637.53 Number of input reads | 64992996 Average input read length | 198 UNIQUE READS: Uniquely mapped reads number | 61320069 Uniquely mapped reads % | 94.35% Average mapped length | 197.43 Number of splices: Total | 46035703 Number of splices: Annotated (sjdb) | 43869513 Number of splices: GT/AG | 45291106 Number of splices: GC/AG | 602187 Number of splices: AT/AC | 19844 Number of splices: Non-canonical | 122566 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 1.90 Insertion rate per base | 0.02% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674531 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 35148 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3045890 3045890 3045890 N_multimapping 674531 674531 674531 N_noFeature 1916775 31007790 30819077 N_ambiguous 1648176 123529 125417 UnstrandedReadsAssigned:57755118 PositiveStrandReadsAssigned:30188750 NegativeStrandReadsAssigned:30375575 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5279891 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5279891-trimmed-pair1.fastq SRR5279891-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 64,992,996 reads, 59,720,584 reads pseudoaligned [quant] estimated average fragment length: 219.236 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52973 SRR5279891.ke.tsv 35125 SRR5279891.se.tsv 88098 total ==> SRR5279891.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.857 0 0 PNS24247 1044 825.764 145.653 4.11277 PNS24249 1928 1709.76 137.848 1.8799 PNS24246 1044 825.764 145.653 4.11277 PNS24248 1044 825.764 145.653 4.11277 PNS24244 1471 1252.76 166.193 3.09325 PNS24243 293 93.9158 54 13.4068 KQK14069 1603 1384.76 2955.85 49.7712 KQK14071 474 259.282 49.7507 4.47403 ==> SRR5279891.se.tsv <== BRADI_1g14170v3 3189 BRADI_1g53295v3 693 BRADI_1g59795v3 1096 BRADI_1g07683v3 0 BRADI_1g00485v3 126 BRADI_1g20270v3 982 BRADI_1g74790v3 515 BRADI_1g09890v3 0 BRADI_1g77505v3 480 BRADI_1g48960v3 0 SRR5279891 completed mapping pipeline successfully