Starting /dee2/code/volunteer_pipeline.sh SRR5456708 current disk space = 1547599630336 free memory = 1593830040 SRR5456708 SRAfilesize 3dbd124c0c4d2a180a6e93a0d8326908 SRR5456708.sra SRR5456708.sra file validated SRR5456708 is paired end SRR5456708 is conventional basespace SRR5456708 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456708_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.87 35.0 35.0 35.0 33.0 35.0 2 34.3005 35.0 35.0 35.0 33.0 35.0 3 34.33825 35.0 35.0 35.0 33.0 35.0 4 34.38225 35.0 35.0 35.0 33.0 35.0 5 34.41325 35.0 35.0 35.0 33.0 35.0 6 38.40525 39.0 39.0 40.0 36.0 40.0 7 38.713 39.0 39.0 40.0 37.0 40.0 8 38.994 40.0 39.0 40.0 38.0 40.0 9 39.03675 40.0 39.0 40.0 38.0 40.0 10-11 39.128875 40.0 39.0 40.0 38.0 40.0 12-13 39.15325 40.0 39.0 40.0 38.0 40.0 14-15 39.0975 40.0 39.0 40.0 38.0 40.0 16-17 39.113749999999996 40.0 39.0 40.0 38.0 40.0 18-19 39.081875 40.0 39.0 40.0 38.0 40.0 20-21 39.132 40.0 39.0 40.0 38.0 40.0 22-23 39.054249999999996 40.0 39.0 40.0 38.0 40.0 24-25 39.051375 40.0 39.0 40.0 38.0 40.0 26-27 39.082375 40.0 39.0 40.0 38.0 40.0 28-29 39.016625 40.0 39.0 40.0 38.0 40.0 30-31 38.9975 40.0 39.0 40.0 38.0 40.0 32-33 38.983999999999995 40.0 39.0 40.0 38.0 40.0 34-35 38.968125 40.0 39.0 40.0 38.0 40.0 36-37 39.0095 40.0 39.0 40.0 38.0 40.0 38-39 38.925 40.0 39.0 40.0 38.0 40.0 40-41 38.919125 40.0 39.0 40.0 38.0 40.0 42-43 38.851 40.0 39.0 40.0 37.0 40.0 44-45 38.953875 40.0 39.0 40.0 38.0 40.0 46-47 38.858875 40.0 39.0 40.0 38.0 40.0 48-49 38.793125 40.0 39.0 40.0 37.5 40.0 50-51 38.837125 40.0 39.0 40.0 37.5 40.0 52-53 38.841375 40.0 39.0 40.0 37.5 40.0 54-55 38.82425 40.0 39.0 40.0 37.0 40.0 56-57 38.7775 40.0 39.0 40.0 37.0 40.0 58-59 38.7325 40.0 39.0 40.0 37.0 40.0 60-61 38.825374999999994 40.0 39.0 40.0 37.0 40.0 62-63 38.718875 40.0 39.0 40.0 37.0 40.0 64-65 38.709 40.0 39.0 40.0 37.0 40.0 66-67 38.66375 40.0 39.0 40.0 37.0 40.0 68-69 38.698875 40.0 39.0 40.0 37.0 40.0 70-71 38.636250000000004 40.0 39.0 40.0 37.0 40.0 72-73 38.662375 40.0 39.0 40.0 37.0 40.0 74-75 38.636624999999995 40.0 39.0 40.0 37.0 40.0 76-77 38.574124999999995 40.0 39.0 40.0 36.0 40.0 78-79 38.493625 40.0 39.0 40.0 36.0 40.0 80-81 38.447125 40.0 39.0 40.0 36.0 40.0 82-83 38.529624999999996 40.0 39.0 40.0 36.5 40.0 84-85 38.434875000000005 40.0 39.0 40.0 36.0 40.0 86-87 38.502250000000004 40.0 39.0 40.0 36.0 40.0 88-89 38.4595 40.0 39.0 40.0 36.0 40.0 90-91 38.3895 40.0 39.0 40.0 36.0 40.0 92-93 38.409125 40.0 39.0 40.0 36.0 40.0 94-95 38.297875000000005 40.0 39.0 40.0 36.0 40.0 96-97 38.379999999999995 40.0 39.0 40.0 36.0 40.0 98-99 38.361374999999995 40.0 39.0 40.0 36.0 40.0 100 38.33975 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 1.0 20 0.0 21 3.0 22 1.0 23 1.0 24 3.0 25 8.0 26 9.0 27 9.0 28 12.0 29 13.0 30 17.0 31 24.0 32 39.0 33 47.0 34 46.0 35 86.0 36 123.0 37 210.0 38 626.0 39 2716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.92598264420623 11.81725370086779 5.844818785094437 27.411944869831544 2 22.15 12.8 36.375 28.675 3 19.459729864932466 19.634817408704354 28.68934467233617 32.21610805402702 4 24.125 27.35 23.325000000000003 25.2 5 24.525 31.6 24.45 19.425 6 22.650000000000002 32.6 23.325000000000003 21.425 7 18.466549736908043 23.30243046855425 39.46379353545477 18.767226259082936 8 16.975 23.599999999999998 31.3 28.125 9 18.675 20.599999999999998 33.95 26.775 10-11 23.025000000000002 30.587500000000002 23.4875 22.900000000000002 12-13 21.9 24.587500000000002 26.275 27.237499999999997 14-15 22.725 26.1 26.724999999999998 24.45 16-17 22.925 26.137500000000003 26.025 24.9125 18-19 22.3625 26.25 26.087500000000002 25.3 20-21 21.3125 26.0625 27.075 25.55 22-23 21.975 26.4625 25.5625 26.0 24-25 22.675 25.624999999999996 26.55 25.15 26-27 21.912499999999998 26.825 25.8625 25.4 28-29 21.8 26.200000000000003 26.3 25.7 30-31 22.125 26.7625 25.924999999999997 25.1875 32-33 20.7 25.624999999999996 27.3125 26.3625 34-35 21.337500000000002 27.05 26.087500000000002 25.525 36-37 22.15 26.450000000000003 26.075 25.324999999999996 38-39 21.702712839104887 26.290786348293537 27.353419177397175 24.6530816352044 40-41 21.963727329580987 26.95434646654159 26.441525953721072 24.640400250156347 42-43 21.618916551982988 25.096959839859878 26.710872013011382 26.573251595145752 44-45 22.37088908340628 26.985119419782418 26.04726772539702 24.59672377141428 46-47 22.47528469528219 26.479789763483918 25.76648729821049 25.2784382430234 48-49 22.48217190041286 26.84849243087702 24.90929563367947 25.760040035030652 50-51 22.090261282660332 25.478184773096636 26.765845730716343 25.66570821352669 52-53 22.705676419104776 26.63165791447862 26.406601650412604 24.256064016004 54-55 22.001250781738587 26.303939962476548 25.64102564102564 26.053783614759222 56-57 21.72607879924953 26.028767979987492 26.278924327704818 25.96622889305816 58-59 22.24308424083114 26.52397045938165 26.14845412442108 25.084491175366132 60-61 23.212720671090523 25.441342181044195 26.50557155377488 24.840365594090397 62-63 22.36265799023902 26.85521211362783 25.728945063196097 25.053184832937053 64-65 22.618600575791714 26.7743146826887 25.797972211791215 24.809112529728377 66-67 22.364137240170297 26.208364638116706 25.97044828449787 25.45704983721513 68-69 22.00950950950951 25.850850850850847 27.014514514514516 25.125125125125123 70-71 22.56006006006006 25.7007007007007 26.25125125125125 25.487987987987985 72-73 22.496244366549824 25.98898347521282 25.650976464697045 25.863795693540307 74-75 22.535387698860077 26.080420894400604 25.804835274959288 25.579356131780035 76-77 22.419839679358716 26.828657314629258 25.90180360721443 24.849699398797593 78-79 22.090112640801003 25.744680851063826 26.207759699624532 25.957446808510635 80-81 21.885564041567548 26.042318767997997 26.41792913484412 25.654188055590332 82-83 22.664663160530928 25.29426496368645 26.158276984723265 25.88279489105935 84-85 22.486540628521347 25.441342181044195 26.192562914736445 25.87955427569801 86-87 22.549142356329035 27.056466758482532 25.528984599974958 24.86540628521347 88-89 23.569908624358494 25.747903367129805 25.34735260983853 25.334835398673178 90-91 23.212720671090523 25.654188055590332 25.516464254413425 25.616627018905724 92-93 22.543497308799598 25.7228689447991 26.073350857428967 25.660282888972336 94-95 22.21109302616752 25.666708401151872 26.705897082759485 25.41630148992112 96-97 22.581048942295656 24.871698585555137 25.797972211791215 26.749280260357995 98-99 22.465581977471842 26.545682102628287 26.29536921151439 24.69336670838548 100 22.630657664416105 25.906476619154787 25.78144536134033 25.681420355088775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.5 27 4.5 28 6.0 29 10.5 30 11.5 31 15.5 32 18.5 33 21.0 34 33.5 35 44.0 36 49.5 37 69.5 38 97.5 39 111.5 40 136.0 41 160.0 42 181.0 43 192.5 44 192.0 45 200.5 46 199.5 47 198.5 48 211.5 49 210.0 50 190.5 51 167.0 52 149.5 53 143.5 54 129.5 55 101.0 56 83.5 57 76.5 58 69.5 59 67.5 60 65.0 61 63.5 62 56.5 63 50.0 64 43.0 65 41.0 66 35.5 67 25.5 68 22.0 69 15.5 70 10.5 71 6.0 72 2.0 73 1.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.22499999999999998 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0625 42-43 0.08750000000000001 44-45 0.0375 46-47 0.11249999999999999 48-49 0.08750000000000001 50-51 0.0125 52-53 0.025 54-55 0.0625 56-57 0.0625 58-59 0.13749999999999998 60-61 0.1625 62-63 0.11249999999999999 64-65 0.13749999999999998 66-67 0.17500000000000002 68-69 0.1 70-71 0.1 72-73 0.15 74-75 0.21250000000000002 76-77 0.2 78-79 0.125 80-81 0.1625 82-83 0.17500000000000002 84-85 0.1625 86-87 0.1625 88-89 0.13749999999999998 90-91 0.1625 92-93 0.13749999999999998 94-95 0.1625 96-97 0.13749999999999998 98-99 0.125 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5456708 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456708_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.618 35.0 34.0 35.0 31.0 35.0 2 33.71925 35.0 34.0 35.0 31.0 35.0 3 33.8085 35.0 34.0 35.0 32.0 35.0 4 33.69875 35.0 34.0 35.0 32.0 35.0 5 33.80225 35.0 35.0 35.0 32.0 35.0 6 38.30075 40.0 39.0 40.0 36.0 40.0 7 38.37375 40.0 39.0 40.0 36.0 40.0 8 38.283 40.0 39.0 40.0 36.0 40.0 9 38.29675 40.0 39.0 40.0 36.0 40.0 10-11 38.33925 40.0 39.0 40.0 36.5 40.0 12-13 38.37412500000001 40.0 39.0 40.0 36.5 40.0 14-15 38.364375 40.0 39.0 40.0 36.0 40.0 16-17 38.37425 40.0 39.0 40.0 36.0 40.0 18-19 38.39325 40.0 39.0 40.0 36.5 40.0 20-21 38.295500000000004 40.0 39.0 40.0 36.5 40.0 22-23 38.288 40.0 39.0 40.0 36.0 40.0 24-25 38.318875000000006 40.0 39.0 40.0 36.0 40.0 26-27 38.292249999999996 40.0 39.0 40.0 36.0 40.0 28-29 38.246125000000006 40.0 39.0 40.0 36.0 40.0 30-31 38.294375 40.0 39.0 40.0 36.0 40.0 32-33 38.275 40.0 39.0 40.0 36.0 40.0 34-35 38.217625 40.0 39.0 40.0 36.0 40.0 36-37 38.047125 40.0 39.0 40.0 36.0 40.0 38-39 38.19975 40.0 39.0 40.0 36.0 40.0 40-41 38.222750000000005 40.0 39.0 40.0 36.0 40.0 42-43 38.074875 40.0 39.0 40.0 36.0 40.0 44-45 38.122375000000005 40.0 39.0 40.0 36.0 40.0 46-47 38.07375 40.0 39.0 40.0 36.0 40.0 48-49 38.014625 40.0 39.0 40.0 36.0 40.0 50-51 38.013000000000005 40.0 39.0 40.0 35.5 40.0 52-53 38.073125000000005 40.0 39.0 40.0 36.0 40.0 54-55 37.997749999999996 40.0 39.0 40.0 35.5 40.0 56-57 38.011250000000004 40.0 39.0 40.0 35.0 40.0 58-59 37.993375 40.0 39.0 40.0 36.0 40.0 60-61 37.895250000000004 40.0 39.0 40.0 35.0 40.0 62-63 37.846125 40.0 39.0 40.0 35.0 40.0 64-65 37.88875 40.0 39.0 40.0 35.0 40.0 66-67 37.815375 40.0 39.0 40.0 34.5 40.0 68-69 37.762875 40.0 39.0 40.0 34.5 40.0 70-71 37.783125 40.0 39.0 40.0 34.5 40.0 72-73 37.754999999999995 40.0 39.0 40.0 34.5 40.0 74-75 37.855000000000004 40.0 39.0 40.0 35.0 40.0 76-77 37.807 40.0 39.0 40.0 35.0 40.0 78-79 37.7715 40.0 39.0 40.0 35.0 40.0 80-81 37.7705 40.0 39.0 40.0 35.0 40.0 82-83 37.693875000000006 40.0 39.0 40.0 35.0 40.0 84-85 37.695750000000004 40.0 39.0 40.0 35.0 40.0 86-87 37.6385 39.5 39.0 40.0 34.5 40.0 88-89 37.56975 40.0 39.0 40.0 34.0 40.0 90-91 37.575 39.5 39.0 40.0 34.5 40.0 92-93 37.532125 39.0 39.0 40.0 34.0 40.0 94-95 37.488 39.0 39.0 40.0 34.0 40.0 96-97 37.520875000000004 39.0 39.0 40.0 34.0 40.0 98-99 37.472875 39.5 39.0 40.0 34.0 40.0 100 37.3275 39.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 14.0 4 2.0 5 4.0 6 3.0 7 0.0 8 3.0 9 2.0 10 1.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 4.0 17 2.0 18 3.0 19 2.0 20 11.0 21 13.0 22 13.0 23 13.0 24 14.0 25 17.0 26 20.0 27 22.0 28 17.0 29 23.0 30 23.0 31 21.0 32 38.0 33 34.0 34 63.0 35 75.0 36 117.0 37 222.0 38 719.0 39 2476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.26348808030113 19.924717691342533 7.1769134253450435 22.634880803011292 2 28.1 21.05 30.8 20.05 3 22.75 24.125 31.45 21.675 4 26.724999999999998 30.825000000000003 21.475 20.974999999999998 5 26.650000000000002 34.949999999999996 19.900000000000002 18.5 6 21.398145828113254 36.40691556001002 20.245552493109496 21.949386118767226 7 21.974442495615136 18.917564520170384 36.70759208218492 22.400400902029567 8 21.43394334419654 23.564803208824266 26.146903985961394 28.854349461017797 9 23.6017055430148 22.247303737145725 26.63656884875846 27.514421871081012 10-11 26.05042016806723 28.35820895522388 22.438229022952463 23.153141853756427 12-13 25.159834524257242 24.069198946972545 24.996865989720447 25.774100539049766 14-15 25.232004013042385 25.821419613744673 24.52972159518435 24.416854778028593 16-17 25.852557673019056 25.67703109327984 24.04714142427282 24.423269809428287 18-19 25.77772202709483 24.88710486703462 24.92473657802308 24.410436527847466 20-21 25.42968259942291 24.940408982561788 25.517500940910804 24.112407477104504 22-23 26.119683853970642 25.768410488019068 23.97440722619496 24.13749843181533 24-25 26.072772898368886 25.68381430363865 24.37892095357591 23.864491844416563 26-27 25.953815261044177 26.782128514056225 23.268072289156628 23.99598393574297 28-29 25.04705734722048 26.69092734345589 24.3945287990965 23.867486510227128 30-31 25.1693851944793 25.671267252195733 24.855708908406523 24.303638644918443 32-33 25.407779171894607 25.821831869510664 25.10664993726474 23.663739021329988 34-35 25.426492724535876 25.15052684395384 24.92473657802308 24.498243853487207 36-37 25.956215400100653 25.62908907901359 24.37091092098641 24.043784599899347 38-39 25.078409233471334 26.245138627524778 25.128591142892986 23.547860996110902 40-41 24.92473657802308 26.166583040642248 24.92473657802308 23.98394380331159 42-43 25.71500250878073 25.23833416959358 24.523331660812843 24.523331660812843 44-45 24.52948557089084 26.85069008782936 24.830614805520703 23.789209535759095 46-47 25.42309138773975 25.949605114704777 24.54556850946471 24.081734988090762 48-49 27.151985966670843 24.721212880591402 25.51058764565844 22.616213507079312 50-51 25.54607080090384 26.73863921667085 25.006276675872456 22.70901330655285 52-53 25.541776274583487 26.005261180007516 25.378930226731804 23.07403231867719 54-55 25.341864257935015 25.705683101242 25.517500940910804 23.434951699912183 56-57 27.192872380474338 24.83373070648764 24.670598569456644 23.302798343581376 58-59 26.731927710843372 26.455823293172692 23.84538152610442 22.966867469879517 60-61 26.662484316185697 25.457967377666247 25.01882057716437 22.86072772898369 62-63 24.90277255049555 26.57132103876553 25.27913687115795 23.24676953958098 64-65 25.965880582037133 24.711490215755145 25.57701956848971 23.74560963371801 66-67 26.3580479237235 25.128591142892986 25.24150043909171 23.271860494291808 68-69 25.8938652615732 26.445866265211393 24.80240873165224 22.857859741563168 70-71 26.6432513798294 25.72754641244355 24.523331660812843 23.1058705469142 72-73 25.990968389362767 25.539387857501257 24.698946312092325 23.77069744104365 74-75 24.683147195382105 25.636842765717155 25.912912536077297 23.767097502823443 76-77 25.693137623886592 25.228954961736292 25.868774306862374 23.20913310751474 78-79 25.589859437751006 26.40562248995984 24.761546184738954 23.2429718875502 80-81 25.370138017565875 26.386449184441656 25.094102885821833 23.14930991217064 82-83 26.624843161856965 25.49560853199498 24.07779171894605 23.801756587202007 84-85 26.436637390213303 25.7465495608532 24.40401505646173 23.41279799247177 86-87 26.245763775574243 25.21651813731643 25.16631103301117 23.371407054098157 88-89 24.767762992719057 26.16118503640472 25.320110469495354 23.75094150138087 90-91 26.148631684659808 25.897564649761485 24.905849861913133 23.047953803665578 92-93 25.985438111975895 25.83479789103691 25.119256841576703 23.060507155410495 94-95 25.91616465863454 25.414156626506024 25.589859437751006 23.079819277108435 96-97 25.64649761486317 26.16118503640472 25.53351744915893 22.658799899573186 98-99 26.559558177482113 25.944521149742688 25.54286431530062 21.953056357474583 100 27.99397439116244 23.901581722319857 25.633944263118252 22.470499623399448 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.5 3 2.5 4 3.0 5 2.0 6 1.5 7 1.0 8 1.5 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 2.0 26 2.0 27 0.5 28 1.5 29 3.5 30 6.5 31 12.5 32 15.5 33 18.0 34 25.0 35 32.5 36 46.5 37 51.0 38 64.5 39 91.0 40 112.0 41 138.5 42 163.0 43 174.0 44 183.5 45 186.0 46 200.5 47 212.5 48 194.5 49 183.0 50 168.5 51 158.0 52 138.0 53 136.5 54 148.5 55 128.5 56 100.0 57 92.5 58 92.0 59 79.0 60 73.5 61 76.0 62 75.0 63 67.5 64 65.5 65 62.5 66 48.0 67 37.0 68 34.0 69 28.5 70 23.0 71 14.0 72 7.5 73 5.0 74 1.5 75 1.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.22499999999999998 8 0.27499999999999997 9 0.325 10-11 0.3375 12-13 0.2875 14-15 0.325 16-17 0.3 18-19 0.35000000000000003 20-21 0.36250000000000004 22-23 0.36250000000000004 24-25 0.375 26-27 0.4 28-29 0.3875 30-31 0.375 32-33 0.375 34-35 0.35000000000000003 36-37 0.65 38-39 0.36250000000000004 40-41 0.35000000000000003 42-43 0.35000000000000003 44-45 0.375 46-47 0.2875 48-49 0.2375 50-51 0.42500000000000004 52-53 0.21250000000000002 54-55 0.36250000000000004 56-57 0.3875 58-59 0.4 60-61 0.375 62-63 0.36250000000000004 64-65 0.35000000000000003 66-67 0.36250000000000004 68-69 0.36250000000000004 70-71 0.35000000000000003 72-73 0.35000000000000003 74-75 0.3875 76-77 0.36250000000000004 78-79 0.4 80-81 0.375 82-83 0.375 84-85 0.375 86-87 0.41250000000000003 88-89 0.42500000000000004 90-91 0.42500000000000004 92-93 0.42500000000000004 94-95 0.4 96-97 0.42500000000000004 98-99 0.41250000000000003 100 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.444724886421 98.5 2 0.40383644623927306 0.8 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0757193336698637 0.375 6 0.0 0.0 7 0.025239777889954566 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 7 0.17500000000000002 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGA 5 0.125 No Hit GGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGACGTGCTAATCTGCGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279072 spots for SRR5456708.sra Written 1279072 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra Read 1279065 spots for SRR5456708.sra Written 1279065 spots for SRR5456708.sra SRR ids: ['SRR5456708.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ap_7bdz5 SRR5456708.sra spots: 25581307 blocks: [[1, 1279065], [1279066, 2558130], [2558131, 3837195], [3837196, 5116260], [5116261, 6395325], [6395326, 7674390], [7674391, 8953455], [8953456, 10232520], [10232521, 11511585], [11511586, 12790650], [12790651, 14069715], [14069716, 15348780], [15348781, 16627845], [16627846, 17906910], [17906911, 19185975], [19185976, 20465040], [20465041, 21744105], [21744106, 23023170], [23023171, 24302235], [24302236, 25581307]] SRR5456708 file size 6996290 SRR5456708 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5456708 SRR5456708_1.fastq SRR5456708_2.fastq Input file: SRR5456708_1.fastq Paired file: SRR5456708_2.fastq trimmed: SRR5456708-trimmed-pair1.fastq, SRR5456708-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:56:01 2024 >> started Fri Dec 6 23:56:24 2024 >> done (23.789s) 25581307 read pairs processed; of these: 61240 ( 0.24%) short read pairs filtered out after trimming by size control 39529 ( 0.15%) empty read pairs filtered out after trimming by size control 25480538 (99.61%) read pairs available; of these: 563335 ( 2.21%) trimmed read pairs available after processing 24917203 (97.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 17 0.00% 20 17 0.00% 21 15 0.00% 22 16 0.00% 23 15 0.00% 24 23 0.00% 25 21 0.00% 26 9 0.00% 27 12 0.00% 28 20 0.00% 29 10 0.00% 30 17 0.00% 31 14 0.00% 32 22 0.00% 33 19 0.00% 34 9 0.00% 35 24 0.00% 36 17 0.00% 37 25 0.00% 38 22 0.00% 39 28 0.00% 40 24 0.00% 41 24 0.00% 42 44 0.00% 43 35 0.00% 44 37 0.00% 45 44 0.00% 46 38 0.00% 47 51 0.00% 48 43 0.00% 49 62 0.00% 50 73 0.00% 51 112 0.00% 52 101 0.00% 53 83 0.00% 54 123 0.00% 55 123 0.00% 56 158 0.00% 57 159 0.00% 58 193 0.00% 59 2600 0.01% 60 2664 0.01% 61 2665 0.01% 62 2690 0.01% 63 2833 0.01% 64 2835 0.01% 65 2757 0.01% 66 2790 0.01% 67 2956 0.01% 68 2959 0.01% 69 3149 0.01% 70 3085 0.01% 71 3266 0.01% 72 3360 0.01% 73 3512 0.01% 74 3725 0.01% 75 3953 0.02% 76 4312 0.02% 77 5083 0.02% 78 4771 0.02% 79 5359 0.02% 80 5434 0.02% 81 5997 0.02% 82 6602 0.03% 83 7226 0.03% 84 7910 0.03% 85 8530 0.03% 86 10166 0.04% 87 10561 0.04% 88 12436 0.05% 89 13563 0.05% 90 13956 0.05% 91 15562 0.06% 92 21341 0.08% 93 21992 0.09% 94 24287 0.10% 95 33107 0.13% 96 35649 0.14% 97 45517 0.18% 98 65790 0.26% 99 124465 0.49% 100 24917203 97.79% 25480538 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.17 fanout-score-rank=30 prefix-density=0.16 prefix-fanout=2.1 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=471.85 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=33.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=2.5 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=217.41 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=17.1 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAG SRR5456708 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:57:03 Started mapping on | Dec 06 23:57:03 Finished on | Dec 06 23:58:42 Mapping speed, Million of reads per hour | 926.57 Number of input reads | 25480538 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 23910063 Uniquely mapped reads % | 93.84% Average mapped length | 199.23 Number of splices: Total | 17409838 Number of splices: Annotated (sjdb) | 16093462 Number of splices: GT/AG | 17177171 Number of splices: GC/AG | 193975 Number of splices: AT/AC | 11898 Number of splices: Non-canonical | 26794 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299727 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 50359 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1293108 1293108 1293108 N_multimapping 299727 299727 299727 N_noFeature 1048516 23186929 1294907 N_ambiguous 551608 3794 74772 UnstrandedReadsAssigned:22309939 PositiveStrandReadsAssigned:719340 NegativeStrandReadsAssigned:22540384 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR5456708 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5456708-trimmed-pair1.fastq SRR5456708-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,480,538 reads, 22,824,445 reads pseudoaligned [quant] estimated average fragment length: 317.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR5456708.ke.tsv 35125 SRR5456708.se.tsv 88098 total ==> SRR5456708.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 620.753 0 0 PNS24247 1044 727.172 102.452 8.80435 PNS24249 1928 1611.17 48.8757 1.89568 PNS24246 1044 727.172 102.452 8.80435 PNS24248 1044 727.172 102.452 8.80435 PNS24244 1471 1154.17 220.768 11.9531 PNS24243 293 81.1288 0 0 KQK14069 1603 1286.17 4787.2 232.593 KQK14071 474 201.435 38.6791 11.9993 ==> SRR5456708.se.tsv <== BRADI_1g14170v3 5168 BRADI_1g53295v3 142 BRADI_1g59795v3 693 BRADI_1g07683v3 0 BRADI_1g00485v3 182 BRADI_1g20270v3 1906 BRADI_1g74790v3 555 BRADI_1g09890v3 0 BRADI_1g77505v3 174 BRADI_1g48960v3 1 SRR5456708 completed mapping pipeline successfully