Starting /dee2/code/volunteer_pipeline.sh SRR5456709 current disk space = 1547592404992 free memory = 1593348696 SRR5456709 SRAfilesize c2d72ddcef6f723346f00c09ec8096e6 SRR5456709.sra SRR5456709.sra file validated SRR5456709 is paired end SRR5456709 is conventional basespace SRR5456709 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456709_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.59475 35.0 35.0 35.0 33.0 35.0 2 34.2655 35.0 35.0 35.0 32.0 35.0 3 34.29925 35.0 35.0 35.0 33.0 35.0 4 34.354 35.0 35.0 35.0 33.0 35.0 5 34.30525 35.0 35.0 35.0 33.0 35.0 6 38.31 39.0 38.0 40.0 36.0 40.0 7 38.6895 39.0 39.0 40.0 37.0 40.0 8 38.979 40.0 39.0 40.0 37.0 40.0 9 39.02075 40.0 39.0 40.0 38.0 40.0 10-11 39.071749999999994 40.0 39.0 40.0 38.0 40.0 12-13 39.095749999999995 40.0 39.0 40.0 38.0 40.0 14-15 39.13575 40.0 39.0 40.0 38.0 40.0 16-17 39.096875 40.0 39.0 40.0 38.0 40.0 18-19 39.068625 40.0 39.0 40.0 38.0 40.0 20-21 39.021625 40.0 39.0 40.0 38.0 40.0 22-23 39.0445 40.0 39.0 40.0 38.0 40.0 24-25 39.043875 40.0 39.0 40.0 38.0 40.0 26-27 39.0465 40.0 39.0 40.0 38.0 40.0 28-29 38.978125000000006 40.0 39.0 40.0 38.0 40.0 30-31 39.03975 40.0 39.0 40.0 38.0 40.0 32-33 38.94475 40.0 39.0 40.0 38.0 40.0 34-35 38.8835 40.0 39.0 40.0 38.0 40.0 36-37 38.965875 40.0 39.0 40.0 38.0 40.0 38-39 38.910624999999996 40.0 39.0 40.0 38.0 40.0 40-41 38.951499999999996 40.0 39.0 40.0 38.0 40.0 42-43 38.891125 40.0 39.0 40.0 38.0 40.0 44-45 38.940125 40.0 39.0 40.0 38.0 40.0 46-47 38.821625 40.0 39.0 40.0 37.0 40.0 48-49 38.77675 40.0 39.0 40.0 37.0 40.0 50-51 38.794375 40.0 39.0 40.0 37.0 40.0 52-53 38.820375 40.0 39.0 40.0 37.0 40.0 54-55 38.83325000000001 40.0 39.0 40.0 37.0 40.0 56-57 38.755250000000004 40.0 39.0 40.0 37.0 40.0 58-59 38.713375 40.0 39.0 40.0 37.0 40.0 60-61 38.70925 40.0 39.0 40.0 37.0 40.0 62-63 38.767125 40.0 39.0 40.0 37.0 40.0 64-65 38.73125 40.0 39.0 40.0 37.0 40.0 66-67 38.6145 40.0 39.0 40.0 36.0 40.0 68-69 38.6255 40.0 39.0 40.0 36.5 40.0 70-71 38.624624999999995 40.0 39.0 40.0 36.5 40.0 72-73 38.593875 40.0 39.0 40.0 36.0 40.0 74-75 38.604124999999996 40.0 39.0 40.0 36.0 40.0 76-77 38.618875 40.0 39.0 40.0 36.0 40.0 78-79 38.4825 40.0 39.0 40.0 36.0 40.0 80-81 38.57575 40.0 39.0 40.0 36.0 40.0 82-83 38.491 40.0 39.0 40.0 36.0 40.0 84-85 38.386375 40.0 39.0 40.0 36.0 40.0 86-87 38.494249999999994 40.0 39.0 40.0 36.0 40.0 88-89 38.427625 40.0 39.0 40.0 36.0 40.0 90-91 38.413250000000005 40.0 39.0 40.0 36.0 40.0 92-93 38.436 40.0 39.0 40.0 36.0 40.0 94-95 38.29375 40.0 39.0 40.0 36.0 40.0 96-97 38.310125 40.0 39.0 40.0 36.0 40.0 98-99 38.341375 40.0 39.0 40.0 36.0 40.0 100 38.28275 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 2.0 23 2.0 24 4.0 25 7.0 26 7.0 27 10.0 28 13.0 29 14.0 30 18.0 31 32.0 32 29.0 33 50.0 34 59.0 35 95.0 36 119.0 37 198.0 38 627.0 39 2708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.18130457113508 10.81150487930149 3.1587057010785826 34.84848484848485 2 20.974999999999998 11.15 39.324999999999996 28.549999999999997 3 20.140105078809107 18.21366024518389 26.594946209657245 35.05128846634976 4 25.0 23.849999999999998 23.200000000000003 27.950000000000003 5 26.275 31.05 24.099999999999998 18.575 6 19.375 32.875 23.625 24.125 7 17.55132699048573 24.211316975463195 39.48422633950926 18.753129694541812 8 17.525 23.549999999999997 34.125 24.8 9 18.925 21.55 34.55 24.975 10-11 23.0 30.675 24.5625 21.762500000000003 12-13 23.65 23.925 26.5 25.924999999999997 14-15 21.462500000000002 25.974999999999998 27.6 24.962500000000002 16-17 22.85 26.775 25.8 24.575 18-19 22.537499999999998 25.8 26.775 24.887500000000003 20-21 22.025 26.5875 26.35 25.0375 22-23 22.4875 26.724999999999998 26.0375 24.75 24-25 22.1 25.912499999999998 26.424999999999997 25.5625 26-27 22.400000000000002 26.187500000000004 26.525 24.887500000000003 28-29 22.5 26.6625 25.7625 25.074999999999996 30-31 22.237499999999997 26.125 26.437500000000004 25.2 32-33 22.3625 26.087500000000002 26.337500000000002 25.2125 34-35 21.925 26.5 26.4625 25.112499999999997 36-37 22.412499999999998 26.150000000000002 26.387500000000003 25.05 38-39 20.75259407425928 26.35329416177022 26.24078009751219 26.653331666458307 40-41 22.536268134067033 26.80090045022511 25.987993996998497 24.674837418709355 42-43 22.873936968484244 26.113056528264135 25.78789394697349 25.22511255627814 44-45 21.13028257064266 26.081520380095025 27.506876719179797 25.28132033008252 46-47 21.66624968726545 27.23292469352014 26.169627220415308 24.931198398799097 48-49 21.64832416208104 25.57528764382191 27.251125562781393 25.52526263131566 50-51 21.65270658832354 26.115764470558823 26.828353544193025 25.403175396924617 52-53 23.10577644411103 25.593898474618655 26.906726681670417 24.3935983995999 54-55 21.848424212106053 26.23811905952976 27.426213106553277 24.487243621810904 56-57 22.698849424712357 25.850425212606304 26.225612806403202 25.22511255627814 58-59 22.71305218370667 26.604930546865223 25.678888749843576 25.003128519584532 60-61 22.813164810411713 25.74145914153423 25.666374671505444 25.779001376548617 62-63 22.416812609457093 25.544158118588946 27.545659244433324 24.49337002752064 64-65 22.466850137603203 26.720040030022517 25.143857893420062 25.66925193895422 66-67 22.354265699274457 26.507380535401552 26.70753064798599 24.430823117338004 68-69 22.566925193895422 25.819364523392547 26.044533400050035 25.569176882662 70-71 22.83927454659162 26.07879924953096 26.35397123202001 24.72795497185741 72-73 22.312601676886498 25.2784382430234 26.717557251908396 25.691402828181705 74-75 22.590738423028785 25.632040050062578 26.958698372966204 24.81852315394243 76-77 22.525341008634715 25.916656238268054 26.629958703541483 24.92804404955575 78-79 22.854640980735553 27.007755816862648 25.956967725794343 24.180635476607456 80-81 22.12909682261696 25.794345759319487 26.319739804853644 25.756817613209908 82-83 22.631117786957066 26.98710727249969 25.497559143822755 24.88421579672049 84-85 22.40990990990991 25.83833833833834 26.614114114114113 25.13763763763764 86-87 22.992244183137352 24.580935701776333 26.670002501876404 25.756817613209908 88-89 23.179884913685264 26.970227670753065 25.544158118588946 24.305729296972732 90-91 22.491868901676256 26.319739804853644 25.819364523392547 25.369026770077557 92-93 22.366775081310983 25.65674255691769 26.51988991743808 25.456592444333246 94-95 22.041531148361273 26.1195896922692 26.444833625218916 25.39404553415061 96-97 22.291718789091817 26.069552164123095 25.381536152114087 26.257192894671004 98-99 22.729547160370277 26.99524643482612 25.519139354515886 24.756067050287715 100 23.455863965991497 25.431357839459867 25.93148287071768 25.18129532383096 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 3.0 28 6.0 29 9.0 30 14.0 31 16.0 32 22.0 33 27.0 34 36.0 35 49.5 36 60.5 37 82.5 38 97.5 39 111.5 40 134.5 41 155.0 42 179.5 43 204.5 44 206.0 45 203.5 46 218.0 47 210.5 48 198.5 49 185.5 50 162.5 51 154.0 52 147.0 53 138.5 54 114.5 55 96.5 56 89.0 57 79.0 58 82.0 59 72.5 60 63.0 61 56.5 62 42.5 63 40.5 64 39.0 65 40.5 66 37.0 67 32.0 68 27.0 69 16.0 70 13.0 71 9.5 72 5.0 73 3.0 74 2.0 75 0.5 76 1.5 77 1.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.15 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.05 42-43 0.05 44-45 0.025 46-47 0.075 48-49 0.05 50-51 0.0125 52-53 0.025 54-55 0.05 56-57 0.05 58-59 0.11249999999999999 60-61 0.11249999999999999 62-63 0.075 64-65 0.075 66-67 0.075 68-69 0.075 70-71 0.0625 72-73 0.11249999999999999 74-75 0.125 76-77 0.11249999999999999 78-79 0.075 80-81 0.075 82-83 0.13749999999999998 84-85 0.1 86-87 0.075 88-89 0.075 90-91 0.075 92-93 0.075 94-95 0.075 96-97 0.075 98-99 0.075 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5456709 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456709_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.6285 35.0 34.0 35.0 31.0 35.0 2 33.72125 35.0 34.0 35.0 31.0 35.0 3 33.68975 35.0 34.0 35.0 31.0 35.0 4 33.81875 35.0 34.0 35.0 32.0 35.0 5 33.89525 35.0 34.0 35.0 32.0 35.0 6 38.4235 40.0 39.0 40.0 36.0 40.0 7 38.519 40.0 39.0 40.0 37.0 40.0 8 38.358 40.0 39.0 40.0 36.0 40.0 9 38.3765 40.0 39.0 40.0 36.0 40.0 10-11 38.448625 40.0 39.0 40.0 36.0 40.0 12-13 38.40075 40.0 39.0 40.0 36.0 40.0 14-15 38.409375 40.0 39.0 40.0 36.0 40.0 16-17 38.38549999999999 40.0 39.0 40.0 36.0 40.0 18-19 38.393125 40.0 39.0 40.0 36.0 40.0 20-21 38.320125000000004 40.0 39.0 40.0 36.0 40.0 22-23 38.31675 40.0 39.0 40.0 36.0 40.0 24-25 38.3905 40.0 39.0 40.0 36.0 40.0 26-27 38.401624999999996 40.0 39.0 40.0 36.0 40.0 28-29 38.324375 40.0 39.0 40.0 36.0 40.0 30-31 38.266875 40.0 39.0 40.0 36.0 40.0 32-33 38.38975000000001 40.0 39.0 40.0 36.0 40.0 34-35 38.36275 40.0 39.0 40.0 36.0 40.0 36-37 38.111875 40.0 39.0 40.0 36.0 40.0 38-39 38.197125 40.0 39.0 40.0 36.0 40.0 40-41 38.264375 40.0 39.0 40.0 36.0 40.0 42-43 38.154624999999996 40.0 39.0 40.0 36.0 40.0 44-45 38.082750000000004 40.0 39.0 40.0 36.0 40.0 46-47 37.987625 40.0 39.0 40.0 35.5 40.0 48-49 38.085625 40.0 39.0 40.0 36.0 40.0 50-51 38.044624999999996 40.0 39.0 40.0 35.0 40.0 52-53 38.047625 40.0 39.0 40.0 35.5 40.0 54-55 37.986000000000004 40.0 39.0 40.0 35.0 40.0 56-57 37.934749999999994 39.5 39.0 40.0 35.0 40.0 58-59 37.901375 40.0 39.0 40.0 34.5 40.0 60-61 37.905 40.0 39.0 40.0 34.5 40.0 62-63 37.86275 40.0 39.0 40.0 35.0 40.0 64-65 37.905375 40.0 39.0 40.0 35.0 40.0 66-67 37.81425 40.0 39.0 40.0 35.0 40.0 68-69 37.828625 40.0 39.0 40.0 35.0 40.0 70-71 37.7855 40.0 39.0 40.0 34.5 40.0 72-73 37.810375 39.0 39.0 40.0 34.5 40.0 74-75 37.87425 40.0 39.0 40.0 35.0 40.0 76-77 37.819125 39.5 39.0 40.0 35.0 40.0 78-79 37.72825 39.0 39.0 40.0 34.0 40.0 80-81 37.760625 39.0 39.0 40.0 34.0 40.0 82-83 37.662375 39.0 38.5 40.0 34.0 40.0 84-85 37.700625 39.0 38.5 40.0 34.0 40.0 86-87 37.712 39.0 38.5 40.0 34.0 40.0 88-89 37.685125 39.0 39.0 40.0 34.0 40.0 90-91 37.63275 39.0 39.0 40.0 34.0 40.0 92-93 37.52075000000001 39.0 38.5 40.0 34.0 40.0 94-95 37.591 39.0 39.0 40.0 34.0 40.0 96-97 37.55025 39.0 39.0 40.0 34.0 40.0 98-99 37.338499999999996 39.0 38.0 40.0 34.0 40.0 100 37.32275 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 9.0 4 1.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 3.0 16 1.0 17 3.0 18 1.0 19 6.0 20 6.0 21 17.0 22 8.0 23 15.0 24 14.0 25 14.0 26 15.0 27 16.0 28 23.0 29 26.0 30 31.0 31 34.0 32 37.0 33 38.0 34 76.0 35 81.0 36 126.0 37 225.0 38 892.0 39 2270.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.238716148445334 20.887662988966902 5.742226680040121 27.13139418254764 2 27.3 19.075 35.125 18.5 3 22.05 22.650000000000002 32.425 22.875 4 25.25 30.15 21.475 23.125 5 27.950000000000003 35.525 19.375 17.150000000000002 6 21.357035553329993 36.905358037055585 19.90485728592889 21.832749123685527 7 21.4321482223335 20.40560841261893 36.57986980470706 21.58237356034051 8 20.741482965931866 22.394789579158317 29.308617234468937 27.55511022044088 9 22.851415685291908 20.922074668003006 28.263593084439993 27.962916562265093 10-11 25.482335254322226 29.416186419443747 21.911801553495362 23.18967677273866 12-13 26.218213704121258 22.535387698860077 25.491669798321432 25.75472879869723 14-15 24.95615134051616 25.419694312202456 25.532448008018036 24.09170633926334 16-17 24.95615134051616 25.482335254322226 24.592833876221498 24.968679528940115 18-19 25.733266482827776 25.444973677613437 24.216595638004513 24.605164201554274 20-21 25.2099786887301 26.150181772596216 24.984329948602234 23.655509590071453 22-23 25.272658894321175 26.488654882788015 24.25723956374577 23.981446659145043 24-25 25.100300902708124 25.977933801404212 25.012537612838514 23.909227683049146 26-27 24.968648106345622 24.91848507649862 25.470278404815648 24.642588412340103 28-29 25.454545454545453 24.777429467084637 25.278996865203762 24.489028213166144 30-31 25.313440320962886 25.175526579739216 25.263289869608823 24.247743229689068 32-33 25.63941825476429 25.150451354062188 25.125376128385156 24.084754262788366 34-35 25.068939583855602 25.33216344948609 25.169215342191027 24.429681624467285 36-37 25.898918783002262 24.264520995725423 25.64747296957506 24.18908725169726 38-39 25.02193807195688 26.31315030713301 24.633320797292217 24.0315908236179 40-41 25.570318375532715 26.29731762346453 24.34194033592379 23.790423665078965 42-43 26.222110804712962 25.946352469290552 24.818250188017046 23.013286537979443 44-45 25.253918495297807 25.85579937304075 25.11598746081505 23.774294670846395 46-47 24.9624248496994 25.513527054108216 24.874749498997996 24.649298597194388 48-49 25.291098034305747 25.96719669462877 24.978089395267308 23.763615875798173 50-51 24.767879548306148 26.135508155583437 25.50815558343789 23.588456712672524 52-53 25.951903807615228 25.551102204408814 24.511523046092183 23.98547094188377 54-55 24.871505578538297 25.611132004512978 25.385483264385105 24.13187915256362 56-57 25.391849529780565 25.454545454545453 25.630094043887148 23.523510971786834 58-59 25.545522949586154 26.272886882367697 24.617506897416604 23.564083270629546 60-61 25.664493480441326 25.67703109327984 25.752256770310932 22.9062186559679 62-63 25.52337971668547 25.322803058794037 24.996865989720447 24.15695123480005 64-65 26.034093757834043 25.156680872399097 25.09400852343946 23.7152168463274 66-67 25.786636580167983 25.347875141030464 24.959257866365803 23.906230412435754 68-69 24.15695123480005 26.250470101541936 25.560987840040116 24.0315908236179 70-71 25.263157894736842 25.839598997493734 25.225563909774433 23.671679197994987 72-73 25.846076710955128 25.31962897969416 24.993732765104035 23.84056154424668 74-75 25.755485893416928 26.031347962382444 25.467084639498434 22.746081504702197 76-77 25.235050770966527 25.134762442020808 25.147298483139025 24.482888303873636 78-79 25.043892651116128 25.884123401053422 25.64584900928016 23.426134938550288 80-81 25.77733199598796 26.253761283851556 24.623871614844532 23.345035105315947 82-83 25.90270812437312 25.275827482447344 25.263289869608823 23.558174523570713 84-85 25.752256770310932 25.852557673019056 25.22567703109328 23.169508525576727 86-87 25.912454534052426 26.33889376646181 25.32296500689828 22.425686692587483 88-89 26.01605619668841 25.57701956848971 26.304565980933265 22.10235825388861 90-91 26.345502446368087 25.454773554133737 25.02822732404968 23.1714966754485 92-93 26.076044673108296 25.762329024971763 25.185092232400553 22.97653406951939 94-95 25.95936794582393 26.874843240531725 24.329069475796338 22.836719337848006 96-97 25.77164366373902 25.60853199498118 25.294855708908408 23.324968632371395 98-99 25.887369873322463 26.251097453906937 25.09720306032861 22.76432961244199 100 25.094102885821833 25.420326223337515 25.897114178168128 23.588456712672524 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 2.0 4 1.5 5 1.0 6 1.0 7 0.5 8 1.0 9 1.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 3.5 29 7.0 30 7.0 31 7.5 32 15.5 33 23.5 34 27.0 35 32.0 36 41.0 37 66.5 38 95.5 39 101.5 40 108.5 41 133.5 42 162.5 43 180.5 44 198.0 45 208.0 46 201.5 47 193.5 48 187.0 49 183.0 50 167.0 51 139.5 52 132.5 53 132.0 54 115.5 55 111.0 56 111.5 57 98.0 58 84.5 59 79.5 60 75.0 61 68.5 62 62.5 63 60.5 64 60.5 65 52.5 66 45.0 67 48.5 68 45.5 69 31.0 70 26.0 71 18.0 72 9.5 73 10.0 74 7.0 75 3.5 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.15 8 0.2 9 0.22499999999999998 10-11 0.22499999999999998 12-13 0.21250000000000002 14-15 0.22499999999999998 16-17 0.22499999999999998 18-19 0.27499999999999997 20-21 0.2875 22-23 0.2875 24-25 0.3 26-27 0.325 28-29 0.3125 30-31 0.3 32-33 0.3 34-35 0.27499999999999997 36-37 0.575 38-39 0.2875 40-41 0.27499999999999997 42-43 0.27499999999999997 44-45 0.3125 46-47 0.2 48-49 0.1625 50-51 0.375 52-53 0.2 54-55 0.2875 56-57 0.3125 58-59 0.325 60-61 0.3 62-63 0.2875 64-65 0.27499999999999997 66-67 0.2875 68-69 0.2875 70-71 0.25 72-73 0.27499999999999997 74-75 0.3125 76-77 0.2875 78-79 0.325 80-81 0.3 82-83 0.3 84-85 0.3 86-87 0.3375 88-89 0.35000000000000003 90-91 0.36250000000000004 92-93 0.3875 94-95 0.325 96-97 0.375 98-99 0.3375 100 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42050894431847 98.65 2 0.47871000251952633 0.95 3 0.02519526329050139 0.075 4 0.05039052658100278 0.2 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra Read 1495416 spots for SRR5456709.sra Written 1495416 spots for SRR5456709.sra SRR ids: ['SRR5456709.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_562v00co SRR5456709.sra spots: 29908320 blocks: [[1, 1495416], [1495417, 2990832], [2990833, 4486248], [4486249, 5981664], [5981665, 7477080], [7477081, 8972496], [8972497, 10467912], [10467913, 11963328], [11963329, 13458744], [13458745, 14954160], [14954161, 16449576], [16449577, 17944992], [17944993, 19440408], [19440409, 20935824], [20935825, 22431240], [22431241, 23926656], [23926657, 25422072], [25422073, 26917488], [26917489, 28412904], [28412905, 29908320]] SRR5456709 file size 8181522 SRR5456709 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5456709 SRR5456709_1.fastq SRR5456709_2.fastq Input file: SRR5456709_1.fastq Paired file: SRR5456709_2.fastq trimmed: SRR5456709-trimmed-pair1.fastq, SRR5456709-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:56:20 2024 >> started Fri Dec 6 23:56:50 2024 >> done (29.180s) 29908320 read pairs processed; of these: 58802 ( 0.20%) short read pairs filtered out after trimming by size control 31414 ( 0.11%) empty read pairs filtered out after trimming by size control 29818104 (99.70%) read pairs available; of these: 664759 ( 2.23%) trimmed read pairs available after processing 29153345 (97.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 20 0.00% 20 17 0.00% 21 13 0.00% 22 23 0.00% 23 17 0.00% 24 21 0.00% 25 17 0.00% 26 16 0.00% 27 16 0.00% 28 9 0.00% 29 14 0.00% 30 16 0.00% 31 25 0.00% 32 19 0.00% 33 19 0.00% 34 24 0.00% 35 30 0.00% 36 22 0.00% 37 26 0.00% 38 22 0.00% 39 29 0.00% 40 34 0.00% 41 36 0.00% 42 49 0.00% 43 47 0.00% 44 46 0.00% 45 46 0.00% 46 54 0.00% 47 54 0.00% 48 77 0.00% 49 70 0.00% 50 86 0.00% 51 96 0.00% 52 98 0.00% 53 108 0.00% 54 125 0.00% 55 143 0.00% 56 159 0.00% 57 183 0.00% 58 226 0.00% 59 2100 0.01% 60 2278 0.01% 61 2411 0.01% 62 2553 0.01% 63 2758 0.01% 64 2777 0.01% 65 2876 0.01% 66 2882 0.01% 67 3011 0.01% 68 3076 0.01% 69 3042 0.01% 70 3208 0.01% 71 3378 0.01% 72 3528 0.01% 73 3733 0.01% 74 4001 0.01% 75 4106 0.01% 76 4525 0.02% 77 5539 0.02% 78 5309 0.02% 79 5662 0.02% 80 6030 0.02% 81 6704 0.02% 82 7243 0.02% 83 7852 0.03% 84 8760 0.03% 85 9703 0.03% 86 11667 0.04% 87 11797 0.04% 88 14545 0.05% 89 15772 0.05% 90 16092 0.05% 91 18194 0.06% 92 24384 0.08% 93 25472 0.09% 94 28075 0.09% 95 39076 0.13% 96 42199 0.14% 97 55205 0.19% 98 81200 0.27% 99 159878 0.54% 100 29153345 97.77% 29818104 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=2.2 sequence=AAGATCTGCATGCCACCACG criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=404.39 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=33.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=26 prefix-density=0.36 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=170.89 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=17.5 sequence=CGCCGCCGCCGTC SRR5456709 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:57:34 Started mapping on | Dec 06 23:57:34 Finished on | Dec 07 00:00:24 Mapping speed, Million of reads per hour | 631.44 Number of input reads | 29818104 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 27763331 Uniquely mapped reads % | 93.11% Average mapped length | 199.25 Number of splices: Total | 19771661 Number of splices: Annotated (sjdb) | 18150770 Number of splices: GT/AG | 19495601 Number of splices: GC/AG | 230538 Number of splices: AT/AC | 13182 Number of splices: Non-canonical | 32340 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290242 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 37869 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1783697 1783697 1783697 N_multimapping 290242 290242 290242 N_noFeature 1464267 26872750 1788355 N_ambiguous 662367 4437 95612 UnstrandedReadsAssigned:25636697 PositiveStrandReadsAssigned:886144 NegativeStrandReadsAssigned:25879364 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR5456709 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5456709-trimmed-pair1.fastq SRR5456709-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,818,104 reads, 26,130,040 reads pseudoaligned [quant] estimated average fragment length: 312.366 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR5456709.ke.tsv 35125 SRR5456709.se.tsv 88098 total ==> SRR5456709.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 625.89 0 0 PNS24247 1044 732.634 128.377 9.75833 PNS24249 1928 1616.63 40.0856 1.38087 PNS24246 1044 732.634 128.377 9.75833 PNS24248 1044 732.634 128.377 9.75833 PNS24244 1471 1159.63 245.783 11.8034 PNS24243 293 80.3622 2 1.38597 KQK14069 1603 1291.63 14494.1 624.923 KQK14071 474 202.014 89.9598 24.7994 ==> SRR5456709.se.tsv <== BRADI_1g14170v3 16245 BRADI_1g53295v3 244 BRADI_1g59795v3 1004 BRADI_1g07683v3 0 BRADI_1g00485v3 101 BRADI_1g20270v3 1377 BRADI_1g74790v3 653 BRADI_1g09890v3 0 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR5456709 completed mapping pipeline successfully