Starting /dee2/code/volunteer_pipeline.sh SRR5456710 current disk space = 1547692859392 free memory = 1597605468 SRR5456710 SRAfilesize 9d2a6caf97417cbef30aa3b68de4ba24 SRR5456710.sra SRR5456710.sra file validated SRR5456710 is paired end SRR5456710 is conventional basespace SRR5456710 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.48475 35.0 35.0 35.0 33.0 35.0 2 34.2245 35.0 35.0 35.0 32.0 35.0 3 34.3185 35.0 35.0 35.0 33.0 35.0 4 34.36 35.0 35.0 35.0 33.0 35.0 5 34.43175 35.0 35.0 35.0 33.0 35.0 6 38.33 39.0 39.0 40.0 36.0 40.0 7 38.729 39.0 39.0 40.0 37.0 40.0 8 39.0435 40.0 39.0 40.0 38.0 40.0 9 39.12225 40.0 39.0 40.0 38.0 40.0 10-11 39.147625000000005 40.0 39.0 40.0 38.0 40.0 12-13 39.142625 40.0 39.0 40.0 38.0 40.0 14-15 39.107875 40.0 39.0 40.0 38.0 40.0 16-17 39.137125 40.0 39.0 40.0 38.0 40.0 18-19 39.1035 40.0 39.0 40.0 38.0 40.0 20-21 39.14125 40.0 39.0 40.0 38.0 40.0 22-23 39.116125 40.0 39.0 40.0 38.0 40.0 24-25 39.103625 40.0 39.0 40.0 38.0 40.0 26-27 39.07275 40.0 39.0 40.0 38.0 40.0 28-29 39.032 40.0 39.0 40.0 38.0 40.0 30-31 39.04775 40.0 39.0 40.0 38.0 40.0 32-33 39.027874999999995 40.0 39.0 40.0 38.0 40.0 34-35 39.01625 40.0 39.0 40.0 38.0 40.0 36-37 39.003625 40.0 39.0 40.0 38.0 40.0 38-39 38.882999999999996 40.0 39.0 40.0 38.0 40.0 40-41 38.960875 40.0 39.0 40.0 38.0 40.0 42-43 38.998875 40.0 39.0 40.0 38.0 40.0 44-45 38.952875000000006 40.0 39.0 40.0 38.0 40.0 46-47 38.89175 40.0 39.0 40.0 37.5 40.0 48-49 38.872749999999996 40.0 39.0 40.0 38.0 40.0 50-51 38.86325 40.0 39.0 40.0 38.0 40.0 52-53 38.829 40.0 39.0 40.0 37.0 40.0 54-55 38.88675 40.0 39.0 40.0 38.0 40.0 56-57 38.777125 40.0 39.0 40.0 37.5 40.0 58-59 38.804125 40.0 39.0 40.0 37.0 40.0 60-61 38.84175 40.0 39.0 40.0 38.0 40.0 62-63 38.84675 40.0 39.0 40.0 37.0 40.0 64-65 38.838875 40.0 39.0 40.0 37.0 40.0 66-67 38.712125 40.0 39.0 40.0 37.0 40.0 68-69 38.74075 40.0 39.0 40.0 37.0 40.0 70-71 38.739000000000004 40.0 39.0 40.0 37.0 40.0 72-73 38.714875 40.0 39.0 40.0 37.0 40.0 74-75 38.690625 40.0 39.0 40.0 37.0 40.0 76-77 38.620875 40.0 39.0 40.0 36.0 40.0 78-79 38.623625000000004 40.0 39.0 40.0 36.0 40.0 80-81 38.536249999999995 40.0 39.0 40.0 36.0 40.0 82-83 38.51575 40.0 39.0 40.0 36.5 40.0 84-85 38.526375 40.0 39.0 40.0 36.0 40.0 86-87 38.583625 40.0 39.0 40.0 36.5 40.0 88-89 38.51025 40.0 39.0 40.0 36.0 40.0 90-91 38.408 40.0 39.0 40.0 36.0 40.0 92-93 38.45925 40.0 39.0 40.0 36.0 40.0 94-95 38.340875 40.0 39.0 40.0 36.0 40.0 96-97 38.40975 40.0 39.0 40.0 36.0 40.0 98-99 38.359375 40.0 39.0 40.0 36.0 40.0 100 38.36575 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 4.0 20 0.0 21 0.0 22 3.0 23 2.0 24 3.0 25 5.0 26 5.0 27 8.0 28 14.0 29 8.0 30 25.0 31 22.0 32 44.0 33 29.0 34 60.0 35 77.0 36 99.0 37 195.0 38 636.0 39 2756.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.69121813031161 11.022405356682977 4.429564769508112 31.8568117434973 2 21.925 11.3 36.825 29.95 3 20.860430215107552 18.409204602301152 26.413206603301653 34.31715857928965 4 26.5 23.45 23.1 26.950000000000003 5 26.900000000000002 29.225 22.725 21.15 6 21.675 31.8 23.0 23.525 7 18.70305458187281 24.41161742613921 37.60640961442163 19.278918377566352 8 19.325 22.8 30.625000000000004 27.250000000000004 9 19.05 21.224999999999998 32.5 27.224999999999998 10-11 23.425 30.175 22.6875 23.7125 12-13 23.9875 22.4875 26.200000000000003 27.325 14-15 23.0875 25.0125 25.9875 25.912499999999998 16-17 23.8125 24.637500000000003 25.6 25.95 18-19 24.212500000000002 24.5 25.8625 25.424999999999997 20-21 24.474999999999998 25.2 25.025 25.3 22-23 23.2625 26.087500000000002 24.6 26.05 24-25 23.775 24.837500000000002 24.9125 26.474999999999998 26-27 23.3375 25.0375 25.924999999999997 25.7 28-29 22.9875 26.187500000000004 25.1 25.724999999999998 30-31 23.3 24.962500000000002 25.575 26.1625 32-33 23.0875 25.112499999999997 24.75 27.05 34-35 23.45 25.412499999999998 24.425 26.7125 36-37 23.375 25.025 25.337500000000002 26.2625 38-39 23.549999999999997 25.5 24.9875 25.9625 40-41 22.7903487935992 25.328166020752597 25.040630078759847 26.840855106888363 42-43 23.846442415905962 25.409528573214956 25.071901963236215 25.672127047642867 44-45 23.465433179147393 25.66570821352669 25.54069258657332 25.328166020752597 46-47 23.19909954977489 25.78789394697349 25.78789394697349 25.22511255627814 48-49 23.471301738151805 24.73427535325747 24.746780042515944 27.047642866074778 50-51 23.377922240280036 25.115639454931866 25.30316289536192 26.20327540942618 52-53 24.265533191648956 24.353044130516317 24.85310663832979 26.52831603950494 54-55 23.271226710016258 24.97186444916844 24.92184569213455 26.835063148680753 56-57 23.36168084042021 24.462231115557778 26.050525262631314 26.125562781390695 58-59 23.942957217913435 24.718538904178132 25.619214410808105 25.719289467100324 60-61 23.317488116087066 24.668501376032022 25.68176132099074 26.332249186890166 62-63 23.611805902951478 24.58729364682341 25.775387693846923 26.025512756378188 64-65 23.992994746059544 24.756067050287715 25.631723792844635 25.619214410808105 66-67 23.53014761070803 24.931198398799097 25.006254691018263 26.53239929947461 68-69 22.943235808952238 25.381345336334082 25.256314078519633 26.419104776194047 70-71 24.037018509254626 25.53776888444222 24.96248124062031 25.46273136568284 72-73 24.358813962216942 24.083573126485675 25.59739772300763 25.960215188289755 74-75 23.554443053817273 24.60575719649562 25.46933667083855 26.37046307884856 76-77 23.839319234138408 25.078212989613313 25.103241146289573 25.979226629958703 78-79 23.186593296648326 25.275137568784395 24.387193596798397 27.151075537768882 80-81 23.34250688016012 25.606705028771582 24.505879409557167 26.54490868151113 82-83 23.855391543657746 25.544158118588946 25.01876407305479 25.581686264698522 84-85 24.518388791593697 24.91868901676257 24.55591693770328 26.007005253940456 86-87 22.86715036277208 24.906179634726044 25.106329747310486 27.120340255191394 88-89 24.655991993995496 24.756067050287715 25.39404553415061 25.193895421566175 90-91 24.31823867900926 23.792844633475106 24.981235926945207 26.90768076057043 92-93 23.930447835876908 26.13209907430573 24.706029522141606 25.23142356767576 94-95 23.90542907180385 24.293219914936202 25.243932949712285 26.55741806354766 96-97 23.942957217913435 24.856142106579934 25.456592444333246 25.74430823117338 98-99 23.59929964982491 24.374687343671837 25.025012506253123 27.00100050025013 100 24.006001500375092 25.03125781445361 24.60615153788447 26.356589147286826 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 1.5 28 1.5 29 2.5 30 8.5 31 17.5 32 20.5 33 21.5 34 23.0 35 31.0 36 47.5 37 63.0 38 77.5 39 91.0 40 120.0 41 156.0 42 170.0 43 159.0 44 162.0 45 194.0 46 194.0 47 179.5 48 175.0 49 168.5 50 168.0 51 161.5 52 151.5 53 128.0 54 108.5 55 113.0 56 112.0 57 92.5 58 76.5 59 77.5 60 71.0 61 64.0 62 56.5 63 50.0 64 52.0 65 59.0 66 58.5 67 47.0 68 45.0 69 39.5 70 31.0 71 28.5 72 27.0 73 26.5 74 22.0 75 14.5 76 8.0 77 5.5 78 5.5 79 2.5 80 2.0 81 2.0 82 2.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9250000000000003 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.15 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0375 44-45 0.0125 46-47 0.05 48-49 0.0375 50-51 0.0125 52-53 0.0125 54-55 0.0375 56-57 0.05 58-59 0.075 60-61 0.075 62-63 0.05 64-65 0.075 66-67 0.075 68-69 0.025 70-71 0.05 72-73 0.08750000000000001 74-75 0.125 76-77 0.11249999999999999 78-79 0.05 80-81 0.075 82-83 0.075 84-85 0.075 86-87 0.075 88-89 0.075 90-91 0.075 92-93 0.075 94-95 0.075 96-97 0.075 98-99 0.05 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5456710 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456710_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.44875 35.0 33.0 35.0 31.0 35.0 2 33.7895 35.0 34.0 35.0 31.0 35.0 3 33.87625 35.0 35.0 35.0 32.0 35.0 4 33.752 35.0 34.0 35.0 32.0 35.0 5 33.98625 35.0 35.0 35.0 32.0 35.0 6 38.619 40.0 39.0 40.0 37.0 40.0 7 38.65175 40.0 39.0 40.0 37.0 40.0 8 38.4475 40.0 39.0 40.0 36.0 40.0 9 38.52225 40.0 39.0 40.0 37.0 40.0 10-11 38.518375 40.0 39.0 40.0 37.0 40.0 12-13 38.52475 40.0 39.0 40.0 36.5 40.0 14-15 38.543125 40.0 39.0 40.0 37.0 40.0 16-17 38.575125 40.0 39.0 40.0 37.0 40.0 18-19 38.484875 40.0 39.0 40.0 36.5 40.0 20-21 38.414500000000004 40.0 39.0 40.0 36.5 40.0 22-23 38.385875 40.0 39.0 40.0 36.5 40.0 24-25 38.401250000000005 40.0 39.0 40.0 36.5 40.0 26-27 38.485 40.0 39.0 40.0 37.0 40.0 28-29 38.46775 40.0 39.0 40.0 37.0 40.0 30-31 38.40025 40.0 39.0 40.0 36.0 40.0 32-33 38.395 40.0 39.0 40.0 37.0 40.0 34-35 38.394999999999996 40.0 39.0 40.0 36.0 40.0 36-37 38.209875 40.0 39.0 40.0 36.0 40.0 38-39 38.31425 40.0 39.0 40.0 36.0 40.0 40-41 38.349500000000006 40.0 39.0 40.0 36.0 40.0 42-43 38.289125 40.0 39.0 40.0 36.0 40.0 44-45 38.232749999999996 40.0 39.0 40.0 36.0 40.0 46-47 38.094125 40.0 39.0 40.0 36.0 40.0 48-49 38.15725 40.0 39.0 40.0 36.0 40.0 50-51 38.042625 40.0 39.0 40.0 35.5 40.0 52-53 38.02275 40.0 39.0 40.0 35.0 40.0 54-55 38.064499999999995 40.0 39.0 40.0 36.0 40.0 56-57 38.095625 40.0 39.0 40.0 36.0 40.0 58-59 38.038875000000004 40.0 39.0 40.0 35.5 40.0 60-61 38.023624999999996 40.0 39.0 40.0 35.5 40.0 62-63 37.989625000000004 40.0 39.0 40.0 35.5 40.0 64-65 37.9415 40.0 39.0 40.0 35.0 40.0 66-67 37.957375 40.0 39.0 40.0 35.0 40.0 68-69 37.827875 40.0 39.0 40.0 35.0 40.0 70-71 37.85875 40.0 39.0 40.0 35.0 40.0 72-73 37.8785 40.0 39.0 40.0 35.0 40.0 74-75 37.905249999999995 40.0 39.0 40.0 35.0 40.0 76-77 37.865125000000006 40.0 39.0 40.0 35.0 40.0 78-79 37.819 40.0 39.0 40.0 34.5 40.0 80-81 37.8765 40.0 39.0 40.0 35.0 40.0 82-83 37.787125 40.0 39.0 40.0 34.5 40.0 84-85 37.723124999999996 39.5 39.0 40.0 34.0 40.0 86-87 37.692875 39.0 39.0 40.0 34.0 40.0 88-89 37.695750000000004 39.0 39.0 40.0 34.5 40.0 90-91 37.6905 39.0 39.0 40.0 34.0 40.0 92-93 37.626000000000005 39.0 39.0 40.0 34.0 40.0 94-95 37.552875 39.0 39.0 40.0 34.0 40.0 96-97 37.557625 39.0 39.0 40.0 34.0 40.0 98-99 37.48825 39.0 38.5 40.0 34.0 40.0 100 37.4415 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 8.0 4 0.0 5 2.0 6 2.0 7 6.0 8 1.0 9 1.0 10 3.0 11 1.0 12 0.0 13 2.0 14 1.0 15 0.0 16 1.0 17 3.0 18 0.0 19 4.0 20 5.0 21 8.0 22 12.0 23 12.0 24 15.0 25 11.0 26 13.0 27 18.0 28 18.0 29 22.0 30 30.0 31 35.0 32 45.0 33 42.0 34 53.0 35 79.0 36 113.0 37 239.0 38 745.0 39 2444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.87735139202408 20.792575871582645 5.8690744920993225 26.460998244293954 2 27.950000000000003 19.55 31.424999999999997 21.075 3 22.55 22.900000000000002 30.625000000000004 23.925 4 25.575 30.175 20.849999999999998 23.400000000000002 5 27.125 33.35 19.475 20.05 6 21.151439299123904 35.5694618272841 20.200250312891114 23.078848560700877 7 22.55883825738608 19.754631947921883 34.376564847270906 23.309964947421133 8 20.811419984973703 21.93839218632607 25.820185324317556 31.43000250438267 9 23.56624092161282 20.26045579764588 27.147508139243676 29.025795141497625 10-11 26.884547958928124 27.347858752817427 20.811419984973703 24.95617330328074 12-13 26.634109691960933 22.764838467317805 24.254946155772604 26.34610568494866 14-15 24.392687202604556 24.73077886301027 25.381918357124967 25.494615577260205 16-17 26.458802905083896 24.33007763586276 23.67893814174806 25.532181317305287 18-19 25.620456254700425 24.304336926548007 23.865630483830532 26.20957633492103 20-21 24.996865989720447 24.05666290585433 24.746145167356147 26.200325937069074 22-23 24.66457680250784 25.128526645768023 23.79937304075235 26.407523510971785 24-25 25.984449460747427 23.85252069224981 23.87760220717331 26.285427639829447 26-27 25.21946325558064 25.00627037873088 24.128417356408328 25.64584900928016 28-29 25.470278404815648 24.88086280411337 23.739653875094056 25.909204915976925 30-31 26.33559066967645 24.404314020566844 24.441936292952093 24.818159016804614 32-33 25.830721003134798 23.62382445141066 24.012539184952978 26.53291536050157 34-35 26.071697167209827 25.394835798445726 23.577337678616196 24.95612935572825 36-37 26.430277882560038 24.368162957374576 22.922167735445743 26.279391424619643 38-39 25.63941825476429 25.664493480441326 24.5987963891675 24.09729187562688 40-41 26.785266850413432 24.880982209972437 22.67602104735655 25.65772989225758 42-43 26.021559288042116 24.592629731762347 24.22913010779644 25.156680872399097 44-45 25.79270585286377 24.652212056648704 24.125830304549442 25.42925178593809 46-47 25.67635270541082 24.68687374749499 23.296593186372746 26.340180360721444 48-49 25.184628864688946 25.02190511953937 24.646388784578797 25.14707723119289 50-51 25.918956216284027 24.614226571321037 24.21277129594781 25.254045916447122 52-53 26.186599874765186 24.583594239198497 23.669380087664372 25.56042579837195 54-55 26.093495425491913 25.59217947111167 23.449053766136107 24.86527133726031 56-57 25.990471414242727 24.109829488465394 24.987462387161486 24.912236710130394 58-59 26.72100313479624 24.45141065830721 24.137931034482758 24.689655172413794 60-61 26.614015293970166 24.219631440391122 24.382599974927917 24.783753290710795 62-63 26.90571715145436 24.460882647943833 23.834002006018054 24.799398194583752 64-65 26.422662321383804 24.504888443218853 23.514665329656555 25.557783905740788 66-67 25.78986960882648 24.022066198595788 24.94984954864594 25.238214643931794 68-69 27.368421052631582 24.774436090225564 23.847117794486216 24.01002506265664 70-71 26.83782091421415 23.9073262366938 24.370695053224797 24.88415779586725 72-73 26.44441659355809 24.76500814638426 24.125830304549442 24.66474495550821 74-75 25.940320962888663 24.310431293881646 24.786860581745234 24.962387161484454 76-77 27.331995987963893 23.89669007021063 23.82146439317954 24.94984954864594 78-79 25.884123401053422 24.241284173564086 25.018811136192625 24.855781289189867 80-81 26.54878354652621 24.755455229495862 23.777276147479306 24.91848507649862 82-83 26.197642337597195 24.06571356909957 25.018811136192625 24.71783295711061 84-85 27.42663656884876 24.166039628793577 23.413594181088538 24.993729621269125 86-87 26.661650363681964 24.20366190117883 24.642588412340103 24.492099322799096 88-89 26.649109606220218 24.943566591422123 23.702031602708804 24.70529219964886 90-91 26.329653788258906 23.645258404415454 24.535875564475663 25.489212242849973 92-93 26.809685108518376 24.35077154685736 24.46368084305608 24.375862501568186 94-95 27.175821419613744 23.915224479558567 24.492099322799096 24.416854778028593 96-97 27.232814851981935 24.322629202207725 23.482187656798796 24.96236828901154 98-99 26.42669007901668 25.235168694343407 24.53279819390443 23.805343032735482 100 26.499372647427855 24.742785445420328 24.893350062735255 23.864491844416563 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.5 5 2.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 2.5 28 4.0 29 4.5 30 5.0 31 9.5 32 15.5 33 17.5 34 19.5 35 29.0 36 45.0 37 60.5 38 65.5 39 79.5 40 107.5 41 125.0 42 145.5 43 156.5 44 161.5 45 169.0 46 178.5 47 176.5 48 153.0 49 154.5 50 149.5 51 139.5 52 133.0 53 129.0 54 116.0 55 104.0 56 88.0 57 80.0 58 92.5 59 85.5 60 86.0 61 86.0 62 79.5 63 76.0 64 71.0 65 67.5 66 66.5 67 63.5 68 65.0 69 57.5 70 47.5 71 47.0 72 40.0 73 33.0 74 27.5 75 21.0 76 14.0 77 10.5 78 8.5 79 2.5 80 2.5 81 3.0 82 1.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.15 8 0.17500000000000002 9 0.17500000000000002 10-11 0.17500000000000002 12-13 0.17500000000000002 14-15 0.17500000000000002 16-17 0.17500000000000002 18-19 0.27499999999999997 20-21 0.2875 22-23 0.3125 24-25 0.325 26-27 0.325 28-29 0.325 30-31 0.325 32-33 0.3125 34-35 0.27499999999999997 36-37 0.5875 38-39 0.3 40-41 0.22499999999999998 42-43 0.27499999999999997 44-45 0.2625 46-47 0.2 48-49 0.13749999999999998 50-51 0.36250000000000004 52-53 0.1875 54-55 0.2625 56-57 0.3 58-59 0.3125 60-61 0.2875 62-63 0.3 64-65 0.27499999999999997 66-67 0.3 68-69 0.25 70-71 0.1875 72-73 0.2625 74-75 0.3 76-77 0.3 78-79 0.325 80-81 0.325 82-83 0.325 84-85 0.325 86-87 0.325 88-89 0.325 90-91 0.35000000000000003 92-93 0.36250000000000004 94-95 0.325 96-97 0.35000000000000003 98-99 0.3375 100 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06257917405624 97.75 2 0.6840638459589561 1.35 3 0.177349885989359 0.525 4 0.05067139599695972 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02533569799847986 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444815 spots for SRR5456710.sra Written 1444815 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra Read 1444814 spots for SRR5456710.sra Written 1444814 spots for SRR5456710.sra SRR ids: ['SRR5456710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ugkrip0u SRR5456710.sra spots: 28896281 blocks: [[1, 1444814], [1444815, 2889628], [2889629, 4334442], [4334443, 5779256], [5779257, 7224070], [7224071, 8668884], [8668885, 10113698], [10113699, 11558512], [11558513, 13003326], [13003327, 14448140], [14448141, 15892954], [15892955, 17337768], [17337769, 18782582], [18782583, 20227396], [20227397, 21672210], [21672211, 23117024], [23117025, 24561838], [24561839, 26006652], [26006653, 27451466], [27451467, 28896281]] SRR5456710 file size 7904340 SRR5456710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5456710 SRR5456710_1.fastq SRR5456710_2.fastq Input file: SRR5456710_1.fastq Paired file: SRR5456710_2.fastq trimmed: SRR5456710-trimmed-pair1.fastq, SRR5456710-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 23:58:18 2024 >> started Fri Dec 6 23:58:45 2024 >> done (27.474s) 28896281 read pairs processed; of these: 62302 ( 0.22%) short read pairs filtered out after trimming by size control 31811 ( 0.11%) empty read pairs filtered out after trimming by size control 28802168 (99.67%) read pairs available; of these: 744311 ( 2.58%) trimmed read pairs available after processing 28057857 (97.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 17 0.00% 20 13 0.00% 21 9 0.00% 22 14 0.00% 23 19 0.00% 24 9 0.00% 25 15 0.00% 26 11 0.00% 27 15 0.00% 28 16 0.00% 29 18 0.00% 30 11 0.00% 31 17 0.00% 32 24 0.00% 33 19 0.00% 34 30 0.00% 35 17 0.00% 36 20 0.00% 37 23 0.00% 38 19 0.00% 39 26 0.00% 40 30 0.00% 41 35 0.00% 42 35 0.00% 43 46 0.00% 44 46 0.00% 45 38 0.00% 46 56 0.00% 47 59 0.00% 48 52 0.00% 49 86 0.00% 50 79 0.00% 51 87 0.00% 52 101 0.00% 53 136 0.00% 54 138 0.00% 55 154 0.00% 56 185 0.00% 57 226 0.00% 58 265 0.00% 59 2653 0.01% 60 2690 0.01% 61 2792 0.01% 62 2864 0.01% 63 2944 0.01% 64 2945 0.01% 65 2991 0.01% 66 3041 0.01% 67 3176 0.01% 68 3266 0.01% 69 3458 0.01% 70 3656 0.01% 71 3703 0.01% 72 3782 0.01% 73 4212 0.01% 74 4605 0.02% 75 4569 0.02% 76 4987 0.02% 77 5966 0.02% 78 5612 0.02% 79 6234 0.02% 80 6669 0.02% 81 7172 0.02% 82 7933 0.03% 83 8606 0.03% 84 9635 0.03% 85 10571 0.04% 86 12234 0.04% 87 12720 0.04% 88 15258 0.05% 89 16793 0.06% 90 17041 0.06% 91 19478 0.07% 92 26404 0.09% 93 27164 0.09% 94 30726 0.11% 95 42156 0.15% 96 46259 0.16% 97 61450 0.21% 98 92271 0.32% 99 191397 0.66% 100 28057857 97.42% 28802168 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=34 prefix-density=0.26 prefix-fanout=1.1 sequence=TTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=380.44 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=31.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=27 prefix-density=0.63 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=312.87 fanout-score-rank=1 prefix-density=1.51 prefix-fanout=21.2 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAG SRR5456710 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 23:59:18 Started mapping on | Dec 06 23:59:19 Finished on | Dec 07 00:01:23 Mapping speed, Million of reads per hour | 836.19 Number of input reads | 28802168 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 26296059 Uniquely mapped reads % | 91.30% Average mapped length | 199.23 Number of splices: Total | 17012601 Number of splices: Annotated (sjdb) | 15579540 Number of splices: GT/AG | 16777912 Number of splices: GC/AG | 192159 Number of splices: AT/AC | 12162 Number of splices: Non-canonical | 30368 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.47 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 272952 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 139022 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 3.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2253399 2253399 2253399 N_multimapping 272952 272952 272952 N_noFeature 1306578 25377790 1640182 N_ambiguous 677304 4738 91803 UnstrandedReadsAssigned:24312177 PositiveStrandReadsAssigned:913531 NegativeStrandReadsAssigned:24564074 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR5456710 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5456710-trimmed-pair1.fastq SRR5456710-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,802,168 reads, 24,839,429 reads pseudoaligned [quant] estimated average fragment length: 310.945 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,273 rounds 52973 SRR5456710.ke.tsv 35125 SRR5456710.se.tsv 88098 total ==> SRR5456710.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.55 0 0 PNS24247 1044 734.055 107.257 7.9585 PNS24249 1928 1618.06 204.902 6.89742 PNS24246 1044 734.055 107.257 7.9585 PNS24248 1044 734.055 107.257 7.9585 PNS24244 1471 1161.06 169.327 7.94339 PNS24243 293 81.4912 0 0 KQK14069 1603 1293.06 23800.8 1002.56 KQK14071 474 204.748 210.903 56.1043 ==> SRR5456710.se.tsv <== BRADI_1g14170v3 25812 BRADI_1g53295v3 236 BRADI_1g59795v3 1027 BRADI_1g07683v3 0 BRADI_1g00485v3 277 BRADI_1g20270v3 1666 BRADI_1g74790v3 1149 BRADI_1g09890v3 0 BRADI_1g77505v3 374 BRADI_1g48960v3 0 SRR5456710 completed mapping pipeline successfully