Starting /dee2/code/volunteer_pipeline.sh SRR5456711 current disk space = 1547770667008 free memory = 1601817052 SRR5456711 SRAfilesize 60d1f7f08b66905845b3193bf2e32406 SRR5456711.sra SRR5456711.sra file validated SRR5456711 is paired end SRR5456711 is conventional basespace SRR5456711 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.62175 35.0 35.0 35.0 33.0 35.0 2 34.2375 35.0 35.0 35.0 32.0 35.0 3 34.29425 35.0 35.0 35.0 33.0 35.0 4 34.377 35.0 35.0 35.0 33.0 35.0 5 34.37075 35.0 35.0 35.0 33.0 35.0 6 38.3905 39.0 39.0 40.0 36.0 40.0 7 38.694 39.0 39.0 40.0 37.0 40.0 8 38.9845 40.0 39.0 40.0 38.0 40.0 9 39.07875 40.0 39.0 40.0 38.0 40.0 10-11 39.073375 40.0 39.0 40.0 38.0 40.0 12-13 39.118125000000006 40.0 39.0 40.0 38.0 40.0 14-15 39.07599999999999 40.0 39.0 40.0 38.0 40.0 16-17 39.165625 40.0 39.0 40.0 38.0 40.0 18-19 39.067750000000004 40.0 39.0 40.0 38.0 40.0 20-21 39.05225 40.0 39.0 40.0 38.0 40.0 22-23 39.056875 40.0 39.0 40.0 38.0 40.0 24-25 39.09425 40.0 39.0 40.0 38.0 40.0 26-27 39.07925 40.0 39.0 40.0 38.0 40.0 28-29 39.060500000000005 40.0 39.0 40.0 38.0 40.0 30-31 38.98525 40.0 39.0 40.0 38.0 40.0 32-33 38.997 40.0 39.0 40.0 38.0 40.0 34-35 39.01925 40.0 39.0 40.0 38.0 40.0 36-37 38.963375 40.0 39.0 40.0 38.0 40.0 38-39 38.9225 40.0 39.0 40.0 38.0 40.0 40-41 38.888875 40.0 39.0 40.0 38.0 40.0 42-43 38.9435 40.0 39.0 40.0 38.0 40.0 44-45 38.937875000000005 40.0 39.0 40.0 38.0 40.0 46-47 38.84725 40.0 39.0 40.0 37.5 40.0 48-49 38.818625 40.0 39.0 40.0 37.5 40.0 50-51 38.885 40.0 39.0 40.0 37.0 40.0 52-53 38.938375 40.0 39.0 40.0 38.0 40.0 54-55 38.908125 40.0 39.0 40.0 38.0 40.0 56-57 38.851375000000004 40.0 39.0 40.0 37.5 40.0 58-59 38.7 40.0 39.0 40.0 37.0 40.0 60-61 38.74525 40.0 39.0 40.0 37.0 40.0 62-63 38.723749999999995 40.0 39.0 40.0 36.5 40.0 64-65 38.703 40.0 39.0 40.0 37.0 40.0 66-67 38.646125 40.0 39.0 40.0 37.0 40.0 68-69 38.670125 40.0 39.0 40.0 37.0 40.0 70-71 38.716875 40.0 39.0 40.0 37.0 40.0 72-73 38.68 40.0 39.0 40.0 37.0 40.0 74-75 38.704750000000004 40.0 39.0 40.0 37.0 40.0 76-77 38.675625 40.0 39.0 40.0 37.0 40.0 78-79 38.537499999999994 40.0 39.0 40.0 36.0 40.0 80-81 38.61024999999999 40.0 39.0 40.0 36.0 40.0 82-83 38.633375 40.0 39.0 40.0 36.5 40.0 84-85 38.499875 40.0 39.0 40.0 36.0 40.0 86-87 38.551625 40.0 39.0 40.0 36.0 40.0 88-89 38.556125 40.0 39.0 40.0 36.5 40.0 90-91 38.44175 40.0 39.0 40.0 36.0 40.0 92-93 38.449375 40.0 39.0 40.0 36.0 40.0 94-95 38.315 40.0 39.0 40.0 36.0 40.0 96-97 38.362625 40.0 39.0 40.0 36.0 40.0 98-99 38.35925 40.0 39.0 40.0 36.0 40.0 100 38.30725 40.0 39.0 40.0 36.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 2.0 24 6.0 25 5.0 26 9.0 27 9.0 28 14.0 29 18.0 30 19.0 31 23.0 32 37.0 33 48.0 34 54.0 35 62.0 36 111.0 37 208.0 38 571.0 39 2794.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.12820512820513 11.538461538461538 4.487179487179487 39.84615384615385 2 20.549999999999997 11.975 38.2 29.275000000000002 3 20.575 17.075000000000003 25.974999999999998 36.375 4 26.0 24.175 20.724999999999998 29.099999999999998 5 25.424999999999997 30.8 23.375 20.4 6 22.05 31.674999999999997 24.224999999999998 22.05 7 17.981467568244426 24.167292762334082 38.16679188580015 19.684447783621337 8 16.6 23.549999999999997 32.05 27.800000000000004 9 19.1 20.925 33.825 26.150000000000002 10-11 22.3625 31.0625 23.2625 23.3125 12-13 23.962500000000002 23.8625 25.674999999999997 26.5 14-15 21.3625 26.275 26.887499999999996 25.474999999999998 16-17 22.662499999999998 25.224999999999998 26.650000000000002 25.4625 18-19 23.05 25.900000000000002 25.624999999999996 25.424999999999997 20-21 23.0625 25.324999999999996 25.887500000000003 25.724999999999998 22-23 22.875 26.0375 25.7 25.387500000000003 24-25 22.7625 25.05 25.674999999999997 26.5125 26-27 22.900000000000002 25.8125 26.075 25.2125 28-29 22.690336292036505 25.565695711963997 25.95324415551944 25.790723840480062 30-31 22.175 25.6125 25.937500000000004 26.275 32-33 21.4875 25.624999999999996 27.0125 25.874999999999996 34-35 22.725 25.2875 25.85 26.137500000000003 36-37 22.402800350043755 25.353169146143266 25.95324415551944 26.290786348293537 38-39 22.80570142535634 25.756439109777446 25.79394848712178 25.64391097774444 40-41 22.236118059029515 26.43821910955478 25.3751875937969 25.950475237618807 42-43 22.236118059029515 25.65032516258129 25.937968984492244 26.17558779389695 44-45 22.996123546329876 25.872202075778418 25.847192697261473 25.28448168063024 46-47 23.555166374781088 26.019514635976982 25.04378283712785 25.381536152114087 48-49 22.05128205128205 25.303314571607256 26.053783614759222 26.59161976235147 50-51 22.61815453863466 25.081270317579396 25.581395348837212 26.71917979494874 52-53 22.345879704889335 25.872202075778418 25.75965987245217 26.02225834688008 54-55 23.299149574787396 25.03751875937969 25.275137568784395 26.388194097048522 56-57 22.83927454659162 25.853658536585368 26.00375234521576 25.303314571607256 58-59 22.30980980980981 25.988488488488485 25.775775775775777 25.925925925925924 60-61 22.8978978978979 24.93743743743744 25.312812812812812 26.851851851851855 62-63 23.170273989741023 26.097835606155385 25.359689728512446 25.372200675591145 64-65 23.232828725134492 25.509821093456775 25.522332040535467 25.73501814087326 66-67 23.704630788485606 24.49311639549437 25.957446808510635 25.844806007509387 68-69 22.88930581613508 25.515947467166978 26.604127579737337 24.9906191369606 70-71 23.176985616010008 25.67854909318324 24.72795497185741 26.416510318949342 72-73 22.56006006006006 25.738238238238235 25.7007007007007 26.001001001001 74-75 23.832770058830892 24.97183627487796 26.11090249092502 25.084491175366132 76-77 23.785678517776667 24.787180771156734 25.963945918878316 25.463194792188283 78-79 23.492619464598448 25.83187390542907 24.655991993995496 26.019514635976982 80-81 22.785285285285287 25.325325325325327 26.263763763763766 25.625625625625624 82-83 22.715894868585732 25.882352941176475 25.456821026282856 25.944931163954944 84-85 23.188587160555624 25.153297459642097 25.29095232136153 26.367163058440745 86-87 22.51001001001001 25.0 25.875875875875877 26.614114114114113 88-89 23.833354184911798 25.359689728512446 25.74752908795196 25.059426998623795 90-91 22.900763358778626 25.240896008009013 25.52871980978601 26.329620823426353 92-93 23.073073073073072 25.2002002002002 26.376376376376378 25.350350350350347 94-95 22.900763358778626 25.140783381303965 25.8540858465774 26.104367413340007 96-97 23.207806830977106 24.92180658075816 25.960215188289755 25.910171399974978 98-99 23.68980612883052 24.96560350218887 25.553470919324578 25.791119449656037 100 23.1615807903952 24.112056028014006 26.488244122061033 26.23811905952976 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.0 28 3.5 29 7.0 30 8.5 31 13.5 32 21.5 33 26.5 34 32.0 35 40.5 36 44.5 37 61.0 38 88.0 39 105.0 40 124.5 41 149.5 42 161.5 43 176.0 44 207.0 45 211.5 46 201.0 47 207.0 48 215.0 49 187.0 50 167.0 51 154.0 52 118.5 53 112.0 54 120.0 55 110.5 56 91.5 57 86.0 58 75.0 59 63.0 60 69.5 61 74.0 62 60.0 63 49.5 64 48.0 65 44.0 66 43.0 67 40.5 68 37.0 69 24.5 70 18.0 71 19.0 72 16.0 73 17.5 74 17.0 75 12.0 76 7.0 77 3.5 78 2.5 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.17500000000000002 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.025 40-41 0.05 42-43 0.05 44-45 0.0375 46-47 0.075 48-49 0.0625 50-51 0.025 52-53 0.0375 54-55 0.05 56-57 0.0625 58-59 0.1 60-61 0.1 62-63 0.08750000000000001 64-65 0.08750000000000001 66-67 0.125 68-69 0.0625 70-71 0.0625 72-73 0.1 74-75 0.13749999999999998 76-77 0.15 78-79 0.075 80-81 0.1 82-83 0.125 84-85 0.11249999999999999 86-87 0.1 88-89 0.08750000000000001 90-91 0.11249999999999999 92-93 0.1 94-95 0.11249999999999999 96-97 0.08750000000000001 98-99 0.0625 100 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.0625 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5456711 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456711_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.6235 35.0 35.0 35.0 31.0 35.0 2 33.78125 35.0 35.0 35.0 32.0 35.0 3 33.834 35.0 34.0 35.0 32.0 35.0 4 33.85925 35.0 35.0 35.0 32.0 35.0 5 33.63175 35.0 34.0 35.0 31.0 35.0 6 38.43675 40.0 39.0 40.0 36.0 40.0 7 38.45 40.0 39.0 40.0 37.0 40.0 8 38.288 40.0 39.0 40.0 36.0 40.0 9 38.3755 40.0 39.0 40.0 36.0 40.0 10-11 38.323750000000004 40.0 39.0 40.0 36.0 40.0 12-13 38.313375 40.0 39.0 40.0 36.5 40.0 14-15 38.363749999999996 40.0 39.0 40.0 36.0 40.0 16-17 38.387 40.0 39.0 40.0 36.5 40.0 18-19 38.267250000000004 40.0 39.0 40.0 36.0 40.0 20-21 38.223625 40.0 39.0 40.0 36.0 40.0 22-23 38.242125 40.0 39.0 40.0 36.0 40.0 24-25 38.28675 40.0 39.0 40.0 36.0 40.0 26-27 38.232875 40.0 39.0 40.0 36.0 40.0 28-29 38.16525 40.0 39.0 40.0 36.0 40.0 30-31 38.20725 40.0 39.0 40.0 36.0 40.0 32-33 38.177 40.0 39.0 40.0 36.0 40.0 34-35 38.178250000000006 40.0 39.0 40.0 36.0 40.0 36-37 38.014375 40.0 39.0 40.0 36.0 40.0 38-39 38.1095 40.0 39.0 40.0 36.0 40.0 40-41 38.14775 40.0 39.0 40.0 36.0 40.0 42-43 38.057125 40.0 39.0 40.0 36.0 40.0 44-45 37.986000000000004 40.0 39.0 40.0 36.0 40.0 46-47 37.864125 40.0 39.0 40.0 35.0 40.0 48-49 37.911625 40.0 39.0 40.0 35.0 40.0 50-51 37.907 40.0 39.0 40.0 35.5 40.0 52-53 37.85425 40.0 39.0 40.0 35.5 40.0 54-55 37.85325 40.0 39.0 40.0 35.0 40.0 56-57 37.823 40.0 39.0 40.0 35.0 40.0 58-59 37.863375 40.0 39.0 40.0 35.0 40.0 60-61 37.827625 40.0 39.0 40.0 35.0 40.0 62-63 37.813 40.0 39.0 40.0 35.0 40.0 64-65 37.763999999999996 40.0 39.0 40.0 35.0 40.0 66-67 37.749750000000006 40.0 39.0 40.0 35.0 40.0 68-69 37.77375 40.0 39.0 40.0 35.0 40.0 70-71 37.83875 40.0 39.0 40.0 35.5 40.0 72-73 37.748125 40.0 39.0 40.0 35.0 40.0 74-75 37.730999999999995 40.0 39.0 40.0 35.0 40.0 76-77 37.702875000000006 40.0 39.0 40.0 34.5 40.0 78-79 37.609375 40.0 39.0 40.0 34.5 40.0 80-81 37.560375 40.0 39.0 40.0 34.5 40.0 82-83 37.542625 40.0 39.0 40.0 34.5 40.0 84-85 37.54925 39.5 39.0 40.0 34.0 40.0 86-87 37.56075 40.0 39.0 40.0 34.0 40.0 88-89 37.574375 39.0 39.0 40.0 34.5 40.0 90-91 37.53175 39.0 39.0 40.0 34.0 40.0 92-93 37.469375 39.5 39.0 40.0 34.0 40.0 94-95 37.406 39.0 39.0 40.0 34.0 40.0 96-97 37.391000000000005 39.0 39.0 40.0 34.0 40.0 98-99 37.209125 39.0 38.5 40.0 34.0 40.0 100 37.231 39.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 12.0 4 4.0 5 1.0 6 3.0 7 5.0 8 3.0 9 0.0 10 3.0 11 2.0 12 2.0 13 0.0 14 0.0 15 2.0 16 2.0 17 4.0 18 2.0 19 4.0 20 6.0 21 11.0 22 15.0 23 20.0 24 20.0 25 22.0 26 20.0 27 22.0 28 12.0 29 20.0 30 23.0 31 29.0 32 31.0 33 38.0 34 66.0 35 61.0 36 106.0 37 195.0 38 779.0 39 2446.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.58335428715112 20.417400050289164 7.618808146844355 31.380437515715364 2 27.200000000000003 20.825 31.05 20.925 3 21.425 23.225 30.825000000000003 24.525 4 25.224999999999998 29.4 20.7 24.675 5 26.900000000000002 33.4 20.125 19.575 6 20.45568352528793 35.65348022033049 20.85628442663996 23.034551827741613 7 21.888304532932633 20.210368144252442 34.510393188079135 23.39093413473579 8 20.706944096264728 22.73752820255703 27.70117824016044 28.854349461017797 9 22.322548281916227 21.570102834211184 27.2886882367695 28.818660647103084 10-11 25.291828793774318 27.57625203966361 22.04091879000879 25.09100037655328 12-13 26.222110804712962 22.850338430684385 23.95337177237403 26.97417899222863 14-15 24.498243853487207 24.98745609633718 24.899648770697443 25.614651279478174 16-17 26.140922768304915 24.799398194583752 23.37011033099298 25.689568706118354 18-19 25.587532989820282 24.556993841900212 24.531858740731433 25.32361442754807 20-21 24.927718416090507 25.380263984915146 24.311753614079194 25.380263984915146 22-23 25.18229821473473 25.06914759869248 23.937641438270052 25.81091274830274 24-25 25.603621730382294 24.55985915492958 23.792756539235413 26.043762575452718 26-27 25.18882175226586 25.440584088620344 24.546827794561935 24.823766364551865 28-29 25.69199798691495 24.73578258681429 24.35832913940614 25.213890286864622 30-31 25.465291750503017 24.748490945674046 25.100603621730382 24.685613682092555 32-33 25.345737993462407 24.85541865727936 24.59140055318079 25.207442796077444 34-35 25.80118134975493 24.783209752419253 23.815508357421137 25.600100540404675 36-37 25.75107296137339 24.312042413531938 24.715980812926027 25.220903812168643 38-39 25.144581342720645 25.924063364344985 24.402816193110386 24.528539099823988 40-41 25.58110315366252 24.827239602965196 24.349792687523557 25.241864555848725 42-43 26.027397260273972 24.582128943068994 23.953751413849442 25.43672238280759 44-45 25.358490566037734 25.19496855345912 24.47798742138365 24.968553459119498 46-47 25.756244508597963 24.526170453119118 24.726998870340154 24.990586167942762 48-49 26.104920495805683 24.514836609490423 24.189307624890446 25.190935269813448 50-51 25.99823655372213 24.78901624889785 24.713439979846328 24.499307217533694 52-53 26.26427406199021 25.122349102773246 24.28159116576735 24.331785669469195 54-55 25.700640945079805 25.097398517029028 24.833479954756818 24.368480583134346 56-57 26.623049823855062 25.0880724710619 23.86763965777554 24.421238047307497 58-59 25.569397256826477 24.361394236818924 24.32364414244369 25.745564363910912 60-61 25.833228524713874 25.38045528864294 24.2485221984656 24.537793988177587 62-63 25.757385292269014 25.69453174104337 24.135763670647393 24.412319296040227 64-65 25.722543352601157 24.981151042975622 24.47851218899221 24.817793415431012 66-67 26.276087503143074 24.880563238622077 24.61654513452351 24.22680412371134 68-69 25.80118134975493 25.73834359683298 24.4313183360563 24.029156717355786 70-71 26.271505713926913 25.191510737159362 23.89802838126334 24.638955167650384 72-73 25.76347869800176 25.21050647228855 24.242805077290434 24.783209752419253 74-75 26.157523905385005 24.974836436839457 25.075490689481633 23.792148968293912 76-77 25.609756097560975 24.880563238622077 24.69197887855167 24.817701785265275 78-79 26.529071230807954 24.45255474452555 24.981122577397432 24.037251447269067 80-81 27.06000754811926 24.39300540948547 25.047175745376776 23.499811297018493 82-83 26.524965413155577 24.877373915230788 24.676141365865927 23.921519305747704 84-85 26.5601409159537 24.69803724207348 24.987418218419727 23.754403623553095 86-87 26.466884915638378 25.069252077562325 24.830017627801563 23.633845378997734 88-89 26.42317380352645 25.415617128463474 24.94962216624685 23.211586901763223 90-91 26.71621110971155 24.763824159214007 24.28517445522106 24.23479027585338 92-93 26.23756140571861 25.343242221942308 24.776420204055928 23.64277616828316 94-95 26.529071230807954 25.622954945884725 23.9617417568588 23.886232066448528 96-97 26.322418136020154 25.088161209068012 24.256926952141058 24.33249370277078 98-99 26.957945101989424 24.54041803072274 25.4973558297658 23.004281037522034 100 25.749559082892414 24.38901486520534 24.792139077853363 25.069286974048875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 2.0 3 2.5 4 2.5 5 1.5 6 2.0 7 2.5 8 2.5 9 2.5 10 1.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 2.0 28 3.0 29 6.0 30 6.0 31 9.5 32 16.0 33 21.0 34 24.0 35 31.0 36 51.0 37 67.5 38 75.5 39 87.5 40 101.0 41 125.5 42 147.0 43 169.0 44 189.5 45 176.0 46 163.0 47 169.0 48 166.5 49 161.5 50 152.0 51 137.5 52 129.5 53 129.5 54 123.0 55 105.5 56 101.0 57 94.0 58 90.0 59 93.0 60 79.0 61 71.0 62 76.5 63 71.5 64 68.0 65 76.5 66 76.0 67 61.0 68 54.0 69 47.5 70 37.5 71 34.0 72 32.0 73 23.5 74 12.5 75 9.5 76 7.0 77 3.5 78 2.5 79 2.0 80 0.5 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.17500000000000002 8 0.27499999999999997 9 0.325 10-11 0.41250000000000003 12-13 0.27499999999999997 14-15 0.35000000000000003 16-17 0.3 18-19 0.5375 20-21 0.5625 22-23 0.575 24-25 0.6 26-27 0.7000000000000001 28-29 0.65 30-31 0.6 32-33 0.575 34-35 0.5375 36-37 0.975 38-39 0.575 40-41 0.5125000000000001 42-43 0.5375 44-45 0.625 46-47 0.41250000000000003 48-49 0.1625 50-51 0.7625 52-53 0.3875 54-55 0.5375 56-57 0.65 58-59 0.6625 60-61 0.6125 62-63 0.5625 64-65 0.525 66-67 0.575 68-69 0.5375 70-71 0.46249999999999997 72-73 0.5375 74-75 0.65 76-77 0.575 78-79 0.675 80-81 0.6375 82-83 0.6125 84-85 0.65 86-87 0.7250000000000001 88-89 0.75 90-91 0.7625 92-93 0.7625 94-95 0.675 96-97 0.75 98-99 0.7250000000000001 100 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra Read 1334940 spots for SRR5456711.sra Written 1334940 spots for SRR5456711.sra SRR ids: ['SRR5456711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pcfvz98h SRR5456711.sra spots: 26698800 blocks: [[1, 1334940], [1334941, 2669880], [2669881, 4004820], [4004821, 5339760], [5339761, 6674700], [6674701, 8009640], [8009641, 9344580], [9344581, 10679520], [10679521, 12014460], [12014461, 13349400], [13349401, 14684340], [14684341, 16019280], [16019281, 17354220], [17354221, 18689160], [18689161, 20024100], [20024101, 21359040], [21359041, 22693980], [22693981, 24028920], [24028921, 25363860], [25363861, 26698800]] SRR5456711 file size 7302381 SRR5456711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5456711 SRR5456711_1.fastq SRR5456711_2.fastq Input file: SRR5456711_1.fastq Paired file: SRR5456711_2.fastq trimmed: SRR5456711-trimmed-pair1.fastq, SRR5456711-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:03:17 2024 >> started Sat Dec 7 00:03:40 2024 >> done (23.347s) 26698800 read pairs processed; of these: 61121 ( 0.23%) short read pairs filtered out after trimming by size control 34138 ( 0.13%) empty read pairs filtered out after trimming by size control 26603541 (99.64%) read pairs available; of these: 690958 ( 2.60%) trimmed read pairs available after processing 25912583 (97.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 14 0.00% 20 23 0.00% 21 17 0.00% 22 18 0.00% 23 13 0.00% 24 19 0.00% 25 8 0.00% 26 8 0.00% 27 16 0.00% 28 14 0.00% 29 10 0.00% 30 13 0.00% 31 19 0.00% 32 30 0.00% 33 21 0.00% 34 28 0.00% 35 26 0.00% 36 31 0.00% 37 37 0.00% 38 28 0.00% 39 28 0.00% 40 38 0.00% 41 41 0.00% 42 56 0.00% 43 54 0.00% 44 67 0.00% 45 54 0.00% 46 65 0.00% 47 74 0.00% 48 81 0.00% 49 79 0.00% 50 115 0.00% 51 120 0.00% 52 147 0.00% 53 167 0.00% 54 170 0.00% 55 194 0.00% 56 214 0.00% 57 224 0.00% 58 280 0.00% 59 2570 0.01% 60 2598 0.01% 61 2682 0.01% 62 2632 0.01% 63 2829 0.01% 64 3029 0.01% 65 2947 0.01% 66 3040 0.01% 67 3083 0.01% 68 3272 0.01% 69 3359 0.01% 70 3569 0.01% 71 3643 0.01% 72 3968 0.01% 73 4077 0.02% 74 4459 0.02% 75 4788 0.02% 76 5025 0.02% 77 6170 0.02% 78 5956 0.02% 79 6586 0.02% 80 6788 0.03% 81 7577 0.03% 82 8293 0.03% 83 8769 0.03% 84 9911 0.04% 85 10934 0.04% 86 13016 0.05% 87 13302 0.05% 88 15720 0.06% 89 17184 0.06% 90 17596 0.07% 91 19673 0.07% 92 25769 0.10% 93 27112 0.10% 94 29923 0.11% 95 39848 0.15% 96 43491 0.16% 97 55601 0.21% 98 80271 0.30% 99 157211 0.59% 100 25912583 97.40% 26603541 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=1.9 sequence=GTATTTAGCCTTGGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=9 fanout-score=503.98 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=34.8 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=280.85 fanout-score-rank=1 prefix-density=1.89 prefix-fanout=16.8 sequence=CGCCGCCGCCGG SRR5456711 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:04:22 Started mapping on | Dec 07 00:04:22 Finished on | Dec 07 00:06:23 Mapping speed, Million of reads per hour | 791.51 Number of input reads | 26603541 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 24861476 Uniquely mapped reads % | 93.45% Average mapped length | 199.21 Number of splices: Total | 17132356 Number of splices: Annotated (sjdb) | 15682614 Number of splices: GT/AG | 16898514 Number of splices: GC/AG | 192066 Number of splices: AT/AC | 13165 Number of splices: Non-canonical | 28611 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304731 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 67424 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 1.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1457128 1457128 1457128 N_multimapping 304731 304731 304731 N_noFeature 1190614 24131148 1476611 N_ambiguous 526371 4139 81529 UnstrandedReadsAssigned:23144491 PositiveStrandReadsAssigned:726189 NegativeStrandReadsAssigned:23303336 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR5456711 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5456711-trimmed-pair1.fastq SRR5456711-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,603,541 reads, 23,566,842 reads pseudoaligned [quant] estimated average fragment length: 300.221 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR5456711.ke.tsv 35125 SRR5456711.se.tsv 88098 total ==> SRR5456711.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 638.04 0 0 PNS24247 1044 744.779 141.45 11.5274 PNS24249 1928 1628.78 124.621 4.64392 PNS24246 1044 744.779 141.45 11.5274 PNS24248 1044 744.779 141.45 11.5274 PNS24244 1471 1171.78 246.029 12.7437 PNS24243 293 87.5376 0 0 KQK14069 1603 1303.78 5233.84 243.653 KQK14071 474 212.715 62.9048 17.949 ==> SRR5456711.se.tsv <== BRADI_1g14170v3 6000 BRADI_1g53295v3 180 BRADI_1g59795v3 910 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 1944 BRADI_1g74790v3 667 BRADI_1g09890v3 0 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR5456711 completed mapping pipeline successfully