Starting /dee2/code/volunteer_pipeline.sh SRR5456712 current disk space = 1547777110016 free memory = 1595085964 SRR5456712 SRAfilesize 8dd57b19e9c1df9afa8826139192dc96 SRR5456712.sra SRR5456712.sra file validated SRR5456712 is paired end SRR5456712 is conventional basespace SRR5456712 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456712_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5665 35.0 35.0 35.0 33.0 35.0 2 34.25 35.0 35.0 35.0 33.0 35.0 3 34.293 35.0 35.0 35.0 33.0 35.0 4 34.3635 35.0 35.0 35.0 33.0 35.0 5 34.4425 35.0 35.0 35.0 33.0 35.0 6 38.38625 39.0 39.0 40.0 36.0 40.0 7 38.75325 39.0 39.0 40.0 37.0 40.0 8 39.09125 40.0 39.0 40.0 38.0 40.0 9 39.147 40.0 39.0 40.0 38.0 40.0 10-11 39.174875 40.0 39.0 40.0 38.0 40.0 12-13 39.208 40.0 39.0 40.0 38.0 40.0 14-15 39.183625 40.0 39.0 40.0 38.0 40.0 16-17 39.227000000000004 40.0 39.0 40.0 38.0 40.0 18-19 39.179375 40.0 39.0 40.0 38.0 40.0 20-21 39.16275 40.0 39.0 40.0 38.0 40.0 22-23 39.156875 40.0 39.0 40.0 38.0 40.0 24-25 39.165875 40.0 39.0 40.0 38.0 40.0 26-27 39.180125000000004 40.0 39.0 40.0 38.0 40.0 28-29 39.096625 40.0 39.0 40.0 38.0 40.0 30-31 39.1755 40.0 39.0 40.0 38.0 40.0 32-33 39.104124999999996 40.0 39.0 40.0 38.0 40.0 34-35 39.031875 40.0 39.0 40.0 38.0 40.0 36-37 39.0255 40.0 39.0 40.0 38.0 40.0 38-39 39.02075 40.0 39.0 40.0 38.0 40.0 40-41 39.00575 40.0 39.0 40.0 38.0 40.0 42-43 38.991 40.0 39.0 40.0 38.0 40.0 44-45 38.979875 40.0 39.0 40.0 38.0 40.0 46-47 38.907624999999996 40.0 39.0 40.0 38.0 40.0 48-49 38.916 40.0 39.0 40.0 37.5 40.0 50-51 38.91975 40.0 39.0 40.0 38.0 40.0 52-53 38.882374999999996 40.0 39.0 40.0 38.0 40.0 54-55 38.910125 40.0 39.0 40.0 38.0 40.0 56-57 38.918875 40.0 39.0 40.0 38.0 40.0 58-59 38.898875000000004 40.0 39.0 40.0 37.5 40.0 60-61 38.91 40.0 39.0 40.0 37.5 40.0 62-63 38.86775 40.0 39.0 40.0 38.0 40.0 64-65 38.837374999999994 40.0 39.0 40.0 38.0 40.0 66-67 38.808875 40.0 39.0 40.0 37.5 40.0 68-69 38.738 40.0 39.0 40.0 37.0 40.0 70-71 38.825625 40.0 39.0 40.0 37.0 40.0 72-73 38.791125 40.0 39.0 40.0 37.0 40.0 74-75 38.774249999999995 40.0 39.0 40.0 37.0 40.0 76-77 38.728 40.0 39.0 40.0 37.0 40.0 78-79 38.6265 40.0 39.0 40.0 36.5 40.0 80-81 38.7025 40.0 39.0 40.0 37.0 40.0 82-83 38.63975 40.0 39.0 40.0 36.5 40.0 84-85 38.57275 40.0 39.0 40.0 36.0 40.0 86-87 38.661874999999995 40.0 39.0 40.0 37.0 40.0 88-89 38.608125 40.0 39.0 40.0 37.0 40.0 90-91 38.61275 40.0 39.0 40.0 36.5 40.0 92-93 38.545625 40.0 39.0 40.0 36.0 40.0 94-95 38.572500000000005 40.0 39.0 40.0 36.0 40.0 96-97 38.52575 40.0 39.0 40.0 36.0 40.0 98-99 38.447874999999996 40.0 39.0 40.0 36.0 40.0 100 38.50225 40.0 39.0 40.0 37.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 5.0 26 3.0 27 6.0 28 11.0 29 12.0 30 23.0 31 19.0 32 46.0 33 34.0 34 56.0 35 72.0 36 89.0 37 185.0 38 590.0 39 2837.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.688946015424165 11.465295629820051 4.370179948586118 35.47557840616967 2 23.35 10.25 35.15 31.25 3 20.855213803450862 16.55413853463366 25.906476619154787 36.68417104276069 4 26.0 22.25 21.175 30.575000000000003 5 28.15 27.075 22.525000000000002 22.25 6 22.35 31.6 23.0 23.05 7 18.243243243243242 24.5995995995996 37.787787787787785 19.36936936936937 8 19.35 22.75 32.15 25.75 9 19.775000000000002 20.925 33.7 25.6 10-11 22.9625 29.5375 24.2625 23.2375 12-13 24.212500000000002 23.8875 26.525 25.374999999999996 14-15 22.537499999999998 25.825 25.887500000000003 25.75 16-17 23.1 25.5125 25.087500000000002 26.3 18-19 22.625 26.4125 25.624999999999996 25.337500000000002 20-21 23.825 25.637500000000003 25.387500000000003 25.15 22-23 23.275000000000002 25.95 24.5625 26.2125 24-25 23.0375 25.224999999999998 25.937500000000004 25.8 26-27 22.975 25.587500000000002 25.1875 26.25 28-29 22.425 24.65 26.724999999999998 26.200000000000003 30-31 22.825 24.8625 25.387500000000003 26.924999999999997 32-33 22.6375 25.474999999999998 25.6 26.2875 34-35 23.0625 26.1 25.0625 25.775 36-37 22.475 25.15 25.95 26.424999999999997 38-39 22.871076653745153 25.472052019507313 25.57208953357509 26.08478179317244 40-41 23.00187617260788 25.666041275797376 25.328330206378986 26.00375234521576 42-43 23.68980612883052 25.365853658536587 25.553470919324578 25.390869293308317 44-45 22.671001625609605 25.372014505439537 25.32199574840565 26.634988120545206 46-47 23.1048286214661 25.881911433575183 25.819364523392547 25.193895421566175 48-49 23.902439024390244 24.652908067542214 25.666041275797376 25.77861163227017 50-51 22.996123546329876 25.334500437664126 25.221958234337876 26.447417781668126 52-53 24.696761285482054 24.73427535325747 24.39664874327873 26.172314617981744 54-55 23.889931207004377 25.791119449656037 25.165728580362728 25.153220762976858 56-57 22.59194395796848 25.23142356767576 25.21891418563923 26.957718288716535 58-59 22.95758788940323 24.458901538846494 26.160390341548855 26.423120230201423 60-61 23.56106106106106 24.587087087087088 25.412912912912912 26.43893893893894 62-63 23.88339797322657 25.071937945702487 24.959339421994244 26.08532465907669 64-65 23.54560240210184 24.709120480420367 26.135368447391468 25.609908670086323 66-67 22.597597597597595 25.513013013013015 25.55055055055055 26.33883883883884 68-69 23.44258193645234 25.25644233174881 25.168876657493122 26.13209907430573 70-71 22.870011259852372 25.447266358063303 25.484799199299385 26.197923182784937 72-73 23.307894407606653 24.834229951207305 25.484799199299385 26.37307644188665 74-75 23.176073082217492 26.292078588411965 24.527593542735577 26.004254786634963 76-77 23.335835835835837 25.900900900900904 24.7997997997998 25.963463463463466 78-79 23.733266608282246 25.760040035030652 24.88427373952208 25.622419617165022 80-81 23.01051051051051 25.93843843843844 25.788288288288285 25.262762762762765 82-83 23.686186186186188 24.824824824824827 24.987487487487485 26.5015015015015 84-85 23.536036036036037 25.763263263263266 24.512012012012015 26.18868868868869 86-87 23.385885885885884 25.538038038038035 24.687187187187188 26.38888888888889 88-89 22.89503315400976 25.672463405479796 26.160390341548855 25.27211309896159 90-91 23.31081081081081 23.586086086086087 25.63813813813814 27.464964964964967 92-93 23.983485549856123 24.146127861879144 25.309645940197672 26.56074064806706 94-95 23.573573573573572 25.538038038038035 24.286786786786788 26.601601601601605 96-97 23.80833229075441 24.671587639184285 24.308770173902165 27.211309896159143 98-99 23.608157137495308 25.634930564243714 25.096959839859878 25.659952458401104 100 24.893670252689517 24.31823867900926 24.893670252689517 25.894420815611706 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 1.5 29 4.0 30 6.0 31 10.5 32 13.5 33 17.0 34 24.5 35 34.0 36 48.0 37 63.5 38 85.5 39 109.5 40 124.5 41 141.5 42 156.5 43 180.0 44 192.0 45 187.0 46 180.5 47 185.0 48 191.0 49 171.5 50 154.5 51 147.5 52 142.0 53 129.5 54 121.5 55 118.5 56 104.5 57 95.0 58 97.5 59 85.0 60 74.5 61 72.5 62 61.0 63 57.0 64 55.0 65 53.5 66 49.5 67 37.5 68 34.5 69 37.5 70 36.0 71 27.5 72 23.0 73 17.5 74 9.5 75 7.0 76 4.0 77 2.5 78 3.5 79 3.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.1 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0375 40-41 0.0625 42-43 0.0625 44-45 0.0375 46-47 0.075 48-49 0.0625 50-51 0.0375 52-53 0.0375 54-55 0.0625 56-57 0.075 58-59 0.08750000000000001 60-61 0.1 62-63 0.08750000000000001 64-65 0.08750000000000001 66-67 0.1 68-69 0.075 70-71 0.08750000000000001 72-73 0.08750000000000001 74-75 0.11249999999999999 76-77 0.1 78-79 0.08750000000000001 80-81 0.1 82-83 0.1 84-85 0.1 86-87 0.1 88-89 0.08750000000000001 90-91 0.1 92-93 0.08750000000000001 94-95 0.1 96-97 0.08750000000000001 98-99 0.08750000000000001 100 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3518471977883891 0.7000000000000001 3 0.050263885398341285 0.15 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5456712 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456712_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.44025 35.0 33.0 35.0 31.0 35.0 2 33.415 35.0 33.0 35.0 31.0 35.0 3 33.909 35.0 34.0 35.0 32.0 35.0 4 33.8515 35.0 34.0 35.0 32.0 35.0 5 33.9335 35.0 35.0 35.0 32.0 35.0 6 38.6605 40.0 39.0 40.0 37.0 40.0 7 38.55525 40.0 39.0 40.0 37.0 40.0 8 38.506 40.0 39.0 40.0 37.0 40.0 9 38.534 40.0 39.0 40.0 37.0 40.0 10-11 38.61125 40.0 39.0 40.0 37.0 40.0 12-13 38.570499999999996 40.0 39.0 40.0 37.0 40.0 14-15 38.536 40.0 39.0 40.0 37.0 40.0 16-17 38.579625 40.0 39.0 40.0 37.0 40.0 18-19 38.464124999999996 40.0 39.0 40.0 36.5 40.0 20-21 38.45425 40.0 39.0 40.0 36.5 40.0 22-23 38.483625 40.0 39.0 40.0 37.0 40.0 24-25 38.464875 40.0 39.0 40.0 36.5 40.0 26-27 38.431250000000006 40.0 39.0 40.0 36.5 40.0 28-29 38.459625 40.0 39.0 40.0 36.5 40.0 30-31 38.459875 40.0 39.0 40.0 36.5 40.0 32-33 38.439499999999995 40.0 39.0 40.0 36.5 40.0 34-35 38.402 40.0 39.0 40.0 36.0 40.0 36-37 38.222625 40.0 39.0 40.0 36.0 40.0 38-39 38.268125 40.0 39.0 40.0 36.0 40.0 40-41 38.396249999999995 40.0 39.0 40.0 36.0 40.0 42-43 38.377125 40.0 39.0 40.0 36.0 40.0 44-45 38.36125 40.0 39.0 40.0 36.0 40.0 46-47 38.186375 40.0 39.0 40.0 36.0 40.0 48-49 38.183375 40.0 39.0 40.0 36.0 40.0 50-51 38.162875 40.0 39.0 40.0 36.0 40.0 52-53 38.23325 40.0 39.0 40.0 36.0 40.0 54-55 38.135125 40.0 39.0 40.0 36.0 40.0 56-57 38.083749999999995 40.0 39.0 40.0 35.5 40.0 58-59 38.09375 40.0 39.0 40.0 35.5 40.0 60-61 38.068 40.0 39.0 40.0 35.5 40.0 62-63 38.069374999999994 40.0 39.0 40.0 35.5 40.0 64-65 38.066375 40.0 39.0 40.0 35.5 40.0 66-67 37.991875 40.0 39.0 40.0 35.0 40.0 68-69 38.023624999999996 40.0 39.0 40.0 35.5 40.0 70-71 38.026375 40.0 39.0 40.0 35.0 40.0 72-73 38.0025 40.0 39.0 40.0 35.5 40.0 74-75 38.021125 40.0 39.0 40.0 36.0 40.0 76-77 38.008375 40.0 39.0 40.0 35.5 40.0 78-79 37.95075 40.0 39.0 40.0 35.0 40.0 80-81 37.917375 40.0 39.0 40.0 35.0 40.0 82-83 37.860125 40.0 39.0 40.0 34.5 40.0 84-85 37.793875 40.0 39.0 40.0 35.0 40.0 86-87 37.8335 40.0 39.0 40.0 35.0 40.0 88-89 37.795 40.0 39.0 40.0 35.0 40.0 90-91 37.768375 40.0 39.0 40.0 35.0 40.0 92-93 37.761375 39.5 39.0 40.0 34.5 40.0 94-95 37.6315 39.0 39.0 40.0 34.5 40.0 96-97 37.6605 39.0 39.0 40.0 34.0 40.0 98-99 37.576625 39.0 39.0 40.0 34.5 40.0 100 37.37125 39.0 39.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 2.0 5 0.0 6 0.0 7 6.0 8 1.0 9 1.0 10 1.0 11 2.0 12 2.0 13 0.0 14 2.0 15 2.0 16 0.0 17 1.0 18 4.0 19 3.0 20 8.0 21 12.0 22 13.0 23 10.0 24 10.0 25 5.0 26 23.0 27 18.0 28 22.0 29 24.0 30 19.0 31 39.0 32 29.0 33 42.0 34 50.0 35 80.0 36 141.0 37 190.0 38 742.0 39 2486.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.390562248995984 20.933734939759034 7.128514056224899 30.547188755020084 2 27.125 22.275 29.349999999999998 21.25 3 21.2 22.75 31.674999999999997 24.375 4 26.700000000000003 28.15 20.974999999999998 24.175 5 27.55 33.025 20.200000000000003 19.225 6 22.27227227227227 35.21021021021021 19.26926926926927 23.24824824824825 7 22.84784784784785 19.394394394394393 34.50950950950951 23.24824824824825 8 21.537690959178562 22.364137240170297 26.947157525669923 29.151014274981218 9 25.068870523415974 21.462559479088405 25.519659403956922 27.948910593538695 10-11 25.992734560941997 29.01164975573093 20.75660779155706 24.23900789177001 12-13 25.43200601051841 23.102930127723518 24.01702980215377 27.44803405960431 14-15 25.072010018785225 25.259862241703196 24.633688165309955 25.034439574201627 16-17 25.331830703731526 25.19408965689958 23.879288755321813 25.59479088404708 18-19 25.771256583897667 24.793077501881115 23.325808878856282 26.109857035364936 20-21 25.95008152514737 25.122287721058573 24.14398595258999 24.783644801204062 22-23 25.379500690001255 25.743319533308238 23.510224564044663 25.36695521264584 24-25 24.965482615790137 24.865068407179617 24.626584661729634 25.54286431530062 26-27 24.921531701192716 24.5323289391086 24.544883866917765 26.001255492780917 28-29 24.529249309565653 24.403715792116497 23.98945518453427 27.077579713783578 30-31 24.75520964097414 25.094150138086867 24.604569420035148 25.54607080090384 32-33 26.659139380253414 25.42968259942291 23.673315769665034 24.237862250658637 34-35 25.984449460747427 24.37923250564334 24.5924253824931 25.043892651116128 36-37 25.456376683872595 25.254941457887448 23.366486214276723 25.922195643963235 38-39 25.8938652615732 25.530046418266217 24.124952954459918 24.451135365700665 40-41 26.5104036099273 24.830784657808973 22.762597142140887 25.89621459012284 42-43 26.448457486832204 25.344870830198147 23.501379483320793 24.70529219964886 44-45 25.94079277471149 25.2508780732564 23.569994982438537 25.23833416959358 46-47 26.268956009525002 24.501817270334627 24.714876550946233 24.514350169194135 48-49 25.716430984857965 26.16693780503066 23.801776999124012 24.31485421098736 50-51 26.740387031917567 24.34028650414677 23.86277959286253 25.05654687107313 52-53 25.946352469290552 25.256956630734518 24.254199047380297 24.542491852594637 54-55 26.435916729370458 24.278906445949335 24.742914472034112 24.542262352646098 56-57 25.61174551386623 25.34822436943155 24.745890325009412 24.29413979169281 58-59 26.7570281124498 24.63604417670683 23.54417670682731 25.062751004016064 60-61 26.367285499247366 25.301053687907675 23.544907175112893 24.786753637732062 62-63 26.103863522328147 25.92824887104867 23.482187656798796 24.485699949824387 64-65 26.787057938299476 24.70529219964886 24.053172811637825 24.454477050413846 66-67 26.50859365198846 25.06586375611592 24.752226822230586 23.673315769665034 68-69 26.181818181818183 25.391849529780565 24.238244514106583 24.18808777429467 70-71 27.10186693396817 25.23493296579376 24.044605939105377 23.618594161132688 72-73 26.884012539184955 24.677115987460816 24.45141065830721 23.987460815047022 74-75 26.15461847389558 23.920682730923694 25.552208835341368 24.372489959839356 76-77 25.95333667837431 25.301053687907675 24.397892624184646 24.34771700953337 78-79 25.750156936597612 24.620213433772754 24.5323289391086 25.09730069052103 80-81 26.42148864064265 25.128655704782226 23.59733902347182 24.852516631103303 82-83 26.669176706827308 24.535642570281123 24.63604417670683 24.15913654618474 84-85 26.93949284458951 24.46648255084107 23.826261611850363 24.767762992719057 86-87 26.63234555499749 25.40180813661477 24.10848819688599 23.85735811150176 88-89 26.443997990959318 24.698643897538926 24.29683576092416 24.5605223505776 90-91 26.604697902273582 25.562115312146716 23.60256249214923 24.230624293430473 92-93 26.93226090235013 24.707804448912906 24.695236898328517 23.664697750408443 94-95 26.804770872567484 24.318895166352796 24.042686754551163 24.83364720652856 96-97 26.86604674541342 24.566473988439306 23.93817542096004 24.629303845187234 98-99 26.438080884199948 25.307711630243656 24.014066817382567 24.240140668173826 100 26.46393566222669 25.383262126162354 24.805227444081428 23.34757476752953 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 1.0 5 1.0 6 1.5 7 1.5 8 0.5 9 1.5 10 1.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.5 27 2.5 28 2.5 29 3.0 30 5.5 31 12.5 32 18.5 33 21.0 34 25.5 35 32.5 36 46.5 37 49.0 38 59.0 39 85.5 40 101.5 41 115.5 42 140.0 43 159.5 44 171.5 45 172.5 46 173.0 47 180.5 48 181.5 49 161.0 50 147.0 51 150.5 52 140.0 53 123.5 54 118.0 55 123.0 56 102.5 57 90.5 58 102.5 59 100.0 60 85.0 61 72.5 62 66.0 63 64.5 64 67.5 65 64.0 66 58.5 67 65.5 68 67.5 69 54.5 70 44.0 71 43.5 72 35.5 73 20.5 74 18.0 75 15.5 76 9.5 77 4.5 78 2.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.1 8 0.17500000000000002 9 0.17500000000000002 10-11 0.21250000000000002 12-13 0.17500000000000002 14-15 0.1875 16-17 0.17500000000000002 18-19 0.325 20-21 0.3375 22-23 0.36250000000000004 24-25 0.41250000000000003 26-27 0.43750000000000006 28-29 0.42500000000000004 30-31 0.42500000000000004 32-33 0.36250000000000004 34-35 0.325 36-37 0.7125 38-39 0.36250000000000004 40-41 0.27499999999999997 42-43 0.325 44-45 0.35000000000000003 46-47 0.2625 48-49 0.11249999999999999 50-51 0.525 52-53 0.27499999999999997 54-55 0.325 56-57 0.3875 58-59 0.4 60-61 0.35000000000000003 62-63 0.35000000000000003 64-65 0.325 66-67 0.36250000000000004 68-69 0.3125 70-71 0.2375 72-73 0.3125 74-75 0.4 76-77 0.35000000000000003 78-79 0.43750000000000006 80-81 0.41250000000000003 82-83 0.4 84-85 0.42500000000000004 86-87 0.44999999999999996 88-89 0.44999999999999996 90-91 0.4875 92-93 0.5375 94-95 0.43750000000000006 96-97 0.525 98-99 0.475 100 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5542957923910304 1.0999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435269 spots for SRR5456712.sra Written 1435269 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra Read 1435260 spots for SRR5456712.sra Written 1435260 spots for SRR5456712.sra SRR ids: ['SRR5456712.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lp4czx7s SRR5456712.sra spots: 28705209 blocks: [[1, 1435260], [1435261, 2870520], [2870521, 4305780], [4305781, 5741040], [5741041, 7176300], [7176301, 8611560], [8611561, 10046820], [10046821, 11482080], [11482081, 12917340], [12917341, 14352600], [14352601, 15787860], [15787861, 17223120], [17223121, 18658380], [18658381, 20093640], [20093641, 21528900], [21528901, 22964160], [22964161, 24399420], [24399421, 25834680], [25834681, 27269940], [27269941, 28705209]] SRR5456712 file size 7852000 SRR5456712 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5456712 SRR5456712_1.fastq SRR5456712_2.fastq Input file: SRR5456712_1.fastq Paired file: SRR5456712_2.fastq trimmed: SRR5456712-trimmed-pair1.fastq, SRR5456712-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:04:48 2024 >> started Sat Dec 7 00:05:17 2024 >> done (29.207s) 28705209 read pairs processed; of these: 53070 ( 0.18%) short read pairs filtered out after trimming by size control 27231 ( 0.09%) empty read pairs filtered out after trimming by size control 28624908 (99.72%) read pairs available; of these: 645896 ( 2.26%) trimmed read pairs available after processing 27979012 (97.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 4 0.00% 22 11 0.00% 23 15 0.00% 24 8 0.00% 25 12 0.00% 26 9 0.00% 27 7 0.00% 28 8 0.00% 29 14 0.00% 30 4 0.00% 31 10 0.00% 32 9 0.00% 33 15 0.00% 34 10 0.00% 35 11 0.00% 36 14 0.00% 37 30 0.00% 38 26 0.00% 39 28 0.00% 40 30 0.00% 41 31 0.00% 42 28 0.00% 43 36 0.00% 44 29 0.00% 45 38 0.00% 46 34 0.00% 47 50 0.00% 48 59 0.00% 49 67 0.00% 50 69 0.00% 51 105 0.00% 52 91 0.00% 53 96 0.00% 54 114 0.00% 55 159 0.00% 56 136 0.00% 57 190 0.00% 58 195 0.00% 59 1929 0.01% 60 1935 0.01% 61 2031 0.01% 62 2063 0.01% 63 2065 0.01% 64 2268 0.01% 65 2314 0.01% 66 2319 0.01% 67 2408 0.01% 68 2445 0.01% 69 2562 0.01% 70 2711 0.01% 71 2882 0.01% 72 3152 0.01% 73 3248 0.01% 74 3632 0.01% 75 3724 0.01% 76 4026 0.01% 77 5119 0.02% 78 4863 0.02% 79 5155 0.02% 80 5582 0.02% 81 6030 0.02% 82 6759 0.02% 83 7524 0.03% 84 8404 0.03% 85 9292 0.03% 86 11090 0.04% 87 11410 0.04% 88 13954 0.05% 89 15296 0.05% 90 15442 0.05% 91 17565 0.06% 92 23707 0.08% 93 24138 0.08% 94 27053 0.09% 95 38210 0.13% 96 40638 0.14% 97 53997 0.19% 98 80357 0.28% 99 164778 0.58% 100 27979012 97.74% 28624908 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=30 prefix-density=0.36 prefix-fanout=2.0 sequence=GTATTTAGCCTTGGAGGATGGTCCCCCCATATTCAGACAGGATACCACGTGTCCCGCCCTACTCATCGAGCTCACAGCATGTGCATTTTTGTGTACGGGGCTGTCACCCTGTATCGCGCGCCTTTCCAGACGCTTCCACTAACACACACACTGATTCAGGCTCTGGGCTGCTCCCCGTTCGCTCGCCGCTACTGGGGGAATCTCGGTTGATTTCTTTTCCTCGGGGTACTTAGATGTTTCAGTTCCCCCGGTTCGCCTCATTAACCTATGGATTCAGTTAATGATAGTGTGTCGAAACACACTGGGTTTCCCCATTCGGAAATCGCCGGTTATAACGGTTCATATCACCTTACCGACGCTTATCGCAGATTAGCACGTCCTTCATCGCCTCTGACTGCCAGGGCATCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=484.87 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=35.2 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=288.68 fanout-score-rank=1 prefix-density=1.56 prefix-fanout=20.4 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5456712 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:05:53 Started mapping on | Dec 07 00:05:56 Finished on | Dec 07 00:09:19 Mapping speed, Million of reads per hour | 507.63 Number of input reads | 28624908 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 25942643 Uniquely mapped reads % | 90.63% Average mapped length | 199.30 Number of splices: Total | 17684259 Number of splices: Annotated (sjdb) | 16267642 Number of splices: GT/AG | 17439110 Number of splices: GC/AG | 203034 Number of splices: AT/AC | 13086 Number of splices: Non-canonical | 29029 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 303838 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 98351 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.04% % of reads unmapped: other | 1.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2392596 2392596 2392596 N_multimapping 303838 303838 303838 N_noFeature 1250087 25187833 1536302 N_ambiguous 554892 4250 85804 UnstrandedReadsAssigned:24137664 PositiveStrandReadsAssigned:750560 NegativeStrandReadsAssigned:24320537 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR5456712 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5456712-trimmed-pair1.fastq SRR5456712-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,624,908 reads, 24,606,009 reads pseudoaligned [quant] estimated average fragment length: 313.431 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR5456712.ke.tsv 35125 SRR5456712.se.tsv 88098 total ==> SRR5456712.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 624.805 0 0 PNS24247 1044 731.569 131.336 10.2316 PNS24249 1928 1615.57 206.651 7.28999 PNS24246 1044 731.569 131.336 10.2316 PNS24248 1044 731.569 131.336 10.2316 PNS24244 1471 1158.57 197.342 9.7076 PNS24243 293 78.2739 0 0 KQK14069 1603 1290.57 10588.3 467.585 KQK14071 474 199.153 114.763 32.842 ==> SRR5456712.se.tsv <== BRADI_1g14170v3 11690 BRADI_1g53295v3 177 BRADI_1g59795v3 895 BRADI_1g07683v3 0 BRADI_1g00485v3 76 BRADI_1g20270v3 1880 BRADI_1g74790v3 849 BRADI_1g09890v3 0 BRADI_1g77505v3 289 BRADI_1g48960v3 1 SRR5456712 completed mapping pipeline successfully