Starting /dee2/code/volunteer_pipeline.sh SRR5456713 current disk space = 1547772116992 free memory = 1595054292 SRR5456713 SRAfilesize 6bb6f604e138f52d1e43ba447626ae72 SRR5456713.sra SRR5456713.sra file validated SRR5456713 is paired end SRR5456713 is conventional basespace SRR5456713 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456713_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.58925 35.0 35.0 35.0 33.0 35.0 2 34.206 35.0 35.0 35.0 32.0 35.0 3 34.232 35.0 35.0 35.0 32.0 35.0 4 34.29 35.0 35.0 35.0 33.0 35.0 5 34.35675 35.0 35.0 35.0 33.0 35.0 6 38.195 39.0 38.0 40.0 35.0 40.0 7 38.534 39.0 39.0 40.0 36.0 40.0 8 38.82525 40.0 39.0 40.0 37.0 40.0 9 38.9605 40.0 39.0 40.0 38.0 40.0 10-11 38.97925 40.0 39.0 40.0 38.0 40.0 12-13 38.9825 40.0 39.0 40.0 38.0 40.0 14-15 39.01375 40.0 39.0 40.0 38.0 40.0 16-17 39.03775 40.0 39.0 40.0 38.0 40.0 18-19 39.005250000000004 40.0 39.0 40.0 38.0 40.0 20-21 38.94425 40.0 39.0 40.0 37.5 40.0 22-23 38.947374999999994 40.0 39.0 40.0 38.0 40.0 24-25 38.954499999999996 40.0 39.0 40.0 38.0 40.0 26-27 38.93025 40.0 39.0 40.0 38.0 40.0 28-29 38.800875000000005 40.0 39.0 40.0 37.0 40.0 30-31 38.852875 40.0 39.0 40.0 38.0 40.0 32-33 38.89475 40.0 39.0 40.0 38.0 40.0 34-35 38.808125000000004 40.0 39.0 40.0 37.5 40.0 36-37 38.784125 40.0 39.0 40.0 37.0 40.0 38-39 38.697625 40.0 39.0 40.0 37.0 40.0 40-41 38.694625 40.0 39.0 40.0 37.0 40.0 42-43 38.729124999999996 40.0 39.0 40.0 37.0 40.0 44-45 38.71225 40.0 39.0 40.0 37.0 40.0 46-47 38.63475 40.0 39.0 40.0 37.0 40.0 48-49 38.5955 40.0 39.0 40.0 36.0 40.0 50-51 38.66825 40.0 39.0 40.0 36.5 40.0 52-53 38.64525 40.0 39.0 40.0 37.0 40.0 54-55 38.629125 40.0 39.0 40.0 36.5 40.0 56-57 38.647125 40.0 39.0 40.0 37.0 40.0 58-59 38.59725 40.0 39.0 40.0 36.5 40.0 60-61 38.616875 40.0 39.0 40.0 36.0 40.0 62-63 38.610375 40.0 39.0 40.0 36.0 40.0 64-65 38.61 40.0 39.0 40.0 36.5 40.0 66-67 38.4565 40.0 39.0 40.0 36.0 40.0 68-69 38.46875 40.0 39.0 40.0 36.0 40.0 70-71 38.450874999999996 40.0 39.0 40.0 36.0 40.0 72-73 38.468875 40.0 39.0 40.0 36.0 40.0 74-75 38.439125 40.0 39.0 40.0 36.0 40.0 76-77 38.372125 40.0 39.0 40.0 36.0 40.0 78-79 38.357875 40.0 39.0 40.0 36.0 40.0 80-81 38.32875 40.0 39.0 40.0 36.0 40.0 82-83 38.355000000000004 40.0 39.0 40.0 36.0 40.0 84-85 38.196124999999995 40.0 39.0 40.0 35.5 40.0 86-87 38.248374999999996 40.0 39.0 40.0 35.5 40.0 88-89 38.15325 40.0 39.0 40.0 35.5 40.0 90-91 38.079499999999996 40.0 39.0 40.0 35.5 40.0 92-93 38.15375 40.0 39.0 40.0 35.5 40.0 94-95 38.048625 40.0 39.0 40.0 35.0 40.0 96-97 38.074 40.0 39.0 40.0 35.5 40.0 98-99 38.09025 40.0 39.0 40.0 35.5 40.0 100 38.0775 40.0 39.0 40.0 35.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 0.0 15 3.0 16 0.0 17 0.0 18 0.0 19 3.0 20 1.0 21 1.0 22 2.0 23 4.0 24 7.0 25 12.0 26 6.0 27 10.0 28 15.0 29 23.0 30 30.0 31 29.0 32 34.0 33 43.0 34 71.0 35 85.0 36 124.0 37 242.0 38 660.0 39 2591.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 59.91268618387262 9.835644581407294 4.083204930662557 26.168464304057526 2 21.15 9.775 40.300000000000004 28.775000000000002 3 20.210105052526263 16.483241620810404 28.46423211605803 34.8424212106053 4 27.025 22.525000000000002 22.6 27.85 5 26.924999999999997 29.025000000000002 23.1 20.95 6 21.099999999999998 30.75 23.25 24.9 7 18.41841841841842 24.4994994994995 37.96296296296296 19.11911911911912 8 18.4 21.2 33.300000000000004 27.1 9 19.25 20.125 33.050000000000004 27.575 10-11 24.4 28.199999999999996 23.45 23.95 12-13 24.5125 23.3875 26.375 25.724999999999998 14-15 22.925 24.587500000000002 26.450000000000003 26.0375 16-17 23.95 24.825 26.55 24.675 18-19 23.1125 24.525 25.674999999999997 26.687499999999996 20-21 23.325000000000003 24.75 25.5625 26.3625 22-23 24.1375 24.6625 25.324999999999996 25.874999999999996 24-25 23.8125 25.15 24.45 26.5875 26-27 23.549999999999997 24.7875 25.4625 26.200000000000003 28-29 24.337500000000002 24.712500000000002 24.9 26.05 30-31 23.9875 24.925 25.0375 26.05 32-33 24.1875 24.587500000000002 25.662499999999998 25.5625 34-35 23.7875 25.75 24.1125 26.35 36-37 23.875 25.2875 24.3 26.5375 38-39 23.849999999999998 24.875 25.224999999999998 26.05 40-41 24.778097262157768 24.103012876609576 25.478184773096636 25.640705088136016 42-43 23.71546443305413 24.49056132016502 25.315664458057256 26.478309788723593 44-45 23.575 25.85 24.55 26.025 46-47 23.668417104276067 25.28132033008252 24.55613903475869 26.494123530882717 48-49 24.390548818602326 24.753094136767096 24.90311288911114 25.95324415551944 50-51 23.875 24.75 25.5 25.874999999999996 52-53 23.9375 24.4875 25.174999999999997 26.400000000000002 54-55 24.66558319789974 24.440555069383674 24.74059257407176 26.153269158644832 56-57 23.902987873484186 24.065508188523566 25.153144143017876 26.878359794974372 58-59 24.296611229210953 24.58421908215581 24.559209703638864 26.559959984994375 60-61 23.271226710016258 23.77141428035513 25.30949105914718 27.64786795048143 62-63 23.980995248812203 24.44361090272568 25.018754688672168 26.556639159789945 64-65 25.03125781445361 23.768442110527634 25.893973493373345 25.30632658164541 66-67 24.512256128064035 24.287143571785894 24.69984992496248 26.500750375187593 68-69 24.243560890222557 24.868717179294826 25.581395348837212 25.30632658164541 70-71 24.6530816352044 24.94061757719715 24.290536317039628 26.115764470558823 72-73 24.496686257346507 25.196948855820935 23.59634863073653 26.710016256096036 74-75 24.66216216216216 24.66216216216216 24.774774774774773 25.900900900900904 76-77 24.618463847885916 24.080560420315237 24.043032274205654 27.257943457593193 78-79 24.60615153788447 25.23130782695674 23.95598899724931 26.206551637909474 80-81 23.93098274568642 25.18129532383096 24.843710927731934 26.04401100275069 82-83 25.387693846923458 23.761880940470235 24.337168584292147 26.513256628314156 84-85 25.209453545079402 24.134050268850817 24.634237839189694 26.02225834688008 86-87 24.14655495810929 24.73427535325747 24.484181568088033 26.634988120545206 88-89 25.196948855820935 23.88395648368138 24.471676878829562 26.447417781668126 90-91 24.246592472177067 24.546705014380393 24.284106539952482 26.92259597349006 92-93 24.14655495810929 24.096536201075402 25.09691134175316 26.65999749906215 94-95 25.4345379517319 23.908965862198325 24.534200325121923 26.12229586094785 96-97 23.330832708177045 24.731182795698924 25.068767191797946 26.86921730432608 98-99 23.95598899724931 24.143535883970994 25.681420355088775 26.219054763690924 100 26.025 23.65 23.625 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 3.0 28 4.5 29 4.0 30 7.0 31 11.5 32 10.5 33 19.5 34 30.5 35 32.5 36 48.5 37 60.5 38 77.0 39 101.5 40 114.0 41 137.5 42 159.0 43 176.5 44 184.5 45 183.5 46 187.0 47 187.0 48 182.5 49 170.5 50 149.0 51 133.0 52 133.0 53 135.5 54 117.0 55 97.0 56 83.0 57 69.0 58 69.5 59 63.5 60 57.0 61 52.5 62 54.0 63 65.0 64 62.0 65 56.5 66 58.0 67 53.5 68 53.5 69 55.0 70 46.5 71 41.0 72 39.0 73 34.0 74 26.5 75 23.0 76 17.0 77 11.5 78 12.5 79 10.0 80 6.5 81 4.5 82 3.5 83 3.0 84 2.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.65 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.1 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0125 44-45 0.0 46-47 0.025 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0125 58-59 0.0375 60-61 0.0375 62-63 0.025 64-65 0.025 66-67 0.05 68-69 0.025 70-71 0.0125 72-73 0.0375 74-75 0.1 76-77 0.075 78-79 0.025 80-81 0.025 82-83 0.05 84-85 0.0375 86-87 0.0375 88-89 0.0375 90-91 0.0375 92-93 0.0375 94-95 0.0375 96-97 0.025 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5456713 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5456713_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.39875 35.0 34.0 35.0 31.0 35.0 2 33.269 35.0 33.0 35.0 31.0 35.0 3 33.24825 35.0 33.0 35.0 31.0 35.0 4 33.28125 35.0 33.0 35.0 31.0 35.0 5 33.262 35.0 33.0 35.0 31.0 35.0 6 37.70975 40.0 39.0 40.0 34.0 40.0 7 37.63075 40.0 39.0 40.0 34.0 40.0 8 37.48775 40.0 39.0 40.0 34.0 40.0 9 37.57825 40.0 39.0 40.0 34.0 40.0 10-11 37.58125 40.0 39.0 40.0 34.0 40.0 12-13 37.641375 40.0 39.0 40.0 34.0 40.0 14-15 37.661625 40.0 39.0 40.0 34.0 40.0 16-17 37.7475 40.0 39.0 40.0 34.0 40.0 18-19 37.602000000000004 40.0 39.0 40.0 34.0 40.0 20-21 37.546875 40.0 39.0 40.0 34.0 40.0 22-23 37.510374999999996 40.0 39.0 40.0 34.0 40.0 24-25 37.603625 40.0 39.0 40.0 34.0 40.0 26-27 37.510374999999996 40.0 39.0 40.0 34.0 40.0 28-29 37.560125 40.0 39.0 40.0 34.0 40.0 30-31 37.524125 40.0 39.0 40.0 34.0 40.0 32-33 37.587374999999994 40.0 39.0 40.0 34.0 40.0 34-35 37.49675 40.0 39.0 40.0 34.0 40.0 36-37 37.27575 40.0 39.0 40.0 34.0 40.0 38-39 37.43 40.0 39.0 40.0 34.0 40.0 40-41 37.44525 40.0 39.0 40.0 34.0 40.0 42-43 37.391375 40.0 39.0 40.0 34.0 40.0 44-45 37.238375 39.0 38.0 40.0 34.0 40.0 46-47 36.986875 39.0 38.0 40.0 31.0 40.0 48-49 37.10575 39.0 38.0 40.0 32.5 40.0 50-51 37.097 39.0 38.0 40.0 32.5 40.0 52-53 37.097375 39.0 38.0 40.0 34.0 40.0 54-55 37.02775 39.0 38.0 40.0 31.0 40.0 56-57 37.00475 39.0 38.0 40.0 31.0 40.0 58-59 36.97175 39.0 38.0 40.0 32.5 40.0 60-61 36.930125000000004 39.0 38.0 40.0 31.0 40.0 62-63 36.955124999999995 39.0 38.0 40.0 31.0 40.0 64-65 36.98425 39.0 38.0 40.0 32.5 40.0 66-67 36.937250000000006 39.0 38.0 40.0 31.0 40.0 68-69 36.75075 39.0 38.0 40.0 30.5 40.0 70-71 36.785250000000005 39.0 38.0 40.0 30.5 40.0 72-73 36.7005 39.0 38.0 40.0 29.0 40.0 74-75 36.7775 39.0 38.0 40.0 31.0 40.0 76-77 36.718625 39.0 38.0 40.0 30.5 40.0 78-79 36.635374999999996 39.0 38.0 40.0 30.0 40.0 80-81 36.488 39.0 37.0 40.0 30.0 40.0 82-83 36.486 39.0 37.0 40.0 29.0 40.0 84-85 36.479749999999996 39.0 37.0 40.0 30.0 40.0 86-87 36.37125 39.0 37.0 40.0 28.5 40.0 88-89 36.448125000000005 39.0 37.0 40.0 30.0 40.0 90-91 36.267375 39.0 37.0 40.0 28.5 40.0 92-93 36.241 39.0 37.0 40.0 27.5 40.0 94-95 36.195875 39.0 37.0 40.0 27.5 40.0 96-97 36.167375 39.0 37.0 40.0 30.0 40.0 98-99 35.957750000000004 39.0 36.0 40.0 27.0 40.0 100 35.82725 39.0 36.0 40.0 27.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 14.0 4 3.0 5 8.0 6 1.0 7 3.0 8 4.0 9 4.0 10 2.0 11 1.0 12 2.0 13 2.0 14 1.0 15 4.0 16 5.0 17 8.0 18 5.0 19 10.0 20 17.0 21 14.0 22 19.0 23 18.0 24 32.0 25 23.0 26 30.0 27 36.0 28 33.0 29 32.0 30 39.0 31 46.0 32 53.0 33 67.0 34 90.0 35 104.0 36 149.0 37 320.0 38 977.0 39 1813.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.89691497366441 18.133935289691497 5.8690744920993225 23.100075244544772 2 24.125 19.400000000000002 34.8 21.675 3 20.625 21.224999999999998 33.125 25.025 4 26.474999999999998 28.599999999999998 19.475 25.45 5 26.75 34.825 18.825 19.6 6 21.74130597948461 33.65023767825869 20.040030022516888 24.568426319739807 7 22.722722722722725 20.295295295295297 32.28228228228228 24.6996996996997 8 19.734535437014774 21.187077385424494 26.62158777861257 32.456799398948164 9 22.400400902029567 20.145326985717865 27.436732648459035 30.017539463793536 10-11 26.412730234306476 26.976569352211506 21.162761558701916 25.4479388547801 12-13 26.311834690043835 22.29179711959925 23.819661865998746 27.57670632435817 14-15 24.31721373089451 24.354798296166376 24.004009020295666 27.323978952643447 16-17 26.265030060120242 23.835170340681362 23.659819639278556 26.23997995991984 18-19 25.532714966156934 23.990975181749814 23.65254449736776 26.82376535472549 20-21 24.733609126237933 24.23216748150934 24.006518741381473 27.027704650871254 22-23 25.990471414242727 24.134904714142426 22.730692076228685 27.143931795386155 24-25 25.156759468271883 24.37923250564334 23.150238274391775 27.313769751693002 26-27 25.687037269419 23.491027732463294 23.74200025097252 27.07993474714519 28-29 25.639739086803814 24.435524335173106 23.557451078775713 26.367285499247366 30-31 25.92174567343867 23.739653875094056 22.974667669927264 27.363932781540008 32-33 24.874623871614844 24.912236710130394 23.219658976930795 26.993480441323968 34-35 26.184507395337175 24.442216094259212 23.113562296314864 26.259714214088742 36-37 25.591939546599495 23.929471032745592 23.41309823677582 27.065491183879093 38-39 24.937311935807422 24.360581745235706 24.009528585757273 26.692577733199595 40-41 25.43243920782151 23.50213085986463 23.13863123589872 27.92679869641514 42-43 26.44773126096766 23.451992980696918 23.075958886939084 27.02431687139634 44-45 25.72754641244355 24.03411941796287 23.99648770697441 26.24184646261917 46-47 25.992734560941997 24.301640987097585 22.74834022297382 26.957284228986595 48-49 26.288788788788786 24.474474474474476 23.54854854854855 25.68818818818819 50-51 26.10880763915065 24.827239602965196 23.31951250157055 25.744440256313606 52-53 25.886924909113702 23.291964397643223 24.42020809828256 26.400902594960513 54-55 25.899460950231916 23.642973548953243 24.10680707032719 26.35075843048765 56-57 26.43332078785598 23.57295195082173 23.510224564044663 26.483502697277633 58-59 25.734002509410285 24.190715181932244 23.927227101631114 26.14805520702635 60-61 26.460998244293954 23.83997993478806 23.78981690494106 25.909204915976925 62-63 26.538799047260873 23.166603986461077 24.044126864736114 26.250470101541936 64-65 26.886437703685136 24.3920782150915 23.050889947355227 25.670594133868136 66-67 26.730190571715145 23.721163490471415 22.881143430290873 26.667502507522567 68-69 26.400902594960513 24.23216748150934 23.592829384480382 25.774100539049766 70-71 28.412081714500566 23.235994485524504 23.398922170698082 24.95300162927685 72-73 26.26300614266015 23.15406794534286 24.25723956374577 26.32568634825122 74-75 25.99422908041651 25.090954710826747 23.3596788357797 25.555137372977043 76-77 27.206619859578733 23.633400200601805 23.044132397191575 26.115847542627886 78-79 26.113690550884677 23.61651399171791 24.156104906512738 26.113690550884677 80-81 27.317195534930388 23.98093565784523 23.66737739872068 25.0344914085037 82-83 26.934169278996865 23.385579937304072 22.808777429467085 26.871473354231973 84-85 27.969396713909443 22.86466825536185 23.62975040762574 25.53618462310297 86-87 27.086732772687334 24.5136186770428 23.396510606250782 25.003137944019077 88-89 27.32295328980412 23.920140632847815 23.09141135107986 25.665494726268207 90-91 27.144831051375455 23.60256249214923 23.853787212661725 25.39881924381359 92-93 26.671694318753143 24.409250879839114 23.504273504273502 25.414781297134237 94-95 27.067386121219727 24.40707742502196 22.738110176935624 25.78742627682269 96-97 26.08695652173913 25.006282985674794 23.77481779341543 25.131942699170644 98-99 27.558066541117388 24.205900816070308 22.598870056497177 25.637162586315128 100 28.87660216134707 23.24704699673285 21.337019351595877 26.5393314903242 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.5 5 2.0 6 2.0 7 1.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 2.0 27 4.0 28 5.0 29 5.5 30 4.5 31 8.0 32 13.0 33 12.0 34 15.0 35 32.0 36 48.5 37 53.5 38 72.0 39 87.5 40 102.0 41 123.0 42 125.5 43 133.5 44 152.5 45 160.0 46 153.0 47 152.0 48 158.0 49 158.0 50 146.5 51 134.0 52 116.5 53 112.0 54 112.5 55 109.0 56 101.5 57 85.5 58 78.5 59 73.0 60 77.5 61 77.0 62 68.5 63 69.5 64 73.5 65 79.5 66 78.5 67 71.5 68 72.0 69 68.0 70 71.0 71 66.5 72 50.0 73 42.5 74 41.5 75 36.0 76 23.0 77 19.0 78 16.0 79 9.0 80 5.5 81 5.0 82 5.0 83 3.0 84 1.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.1 8 0.17500000000000002 9 0.22499999999999998 10-11 0.2375 12-13 0.1875 14-15 0.22499999999999998 16-17 0.2 18-19 0.27499999999999997 20-21 0.2875 22-23 0.3 24-25 0.325 26-27 0.3875 28-29 0.35000000000000003 30-31 0.325 32-33 0.3 34-35 0.27499999999999997 36-37 0.75 38-39 0.3 40-41 0.27499999999999997 42-43 0.27499999999999997 44-45 0.35000000000000003 46-47 0.21250000000000002 48-49 0.1 50-51 0.5125000000000001 52-53 0.2875 54-55 0.2875 56-57 0.36250000000000004 58-59 0.375 60-61 0.325 62-63 0.2875 64-65 0.27499999999999997 66-67 0.3 68-69 0.2875 70-71 0.2625 72-73 0.2875 74-75 0.36250000000000004 76-77 0.3 78-79 0.3875 80-81 0.3375 82-83 0.3125 84-85 0.3375 86-87 0.41250000000000003 88-89 0.44999999999999996 90-91 0.4875 92-93 0.5499999999999999 94-95 0.3875 96-97 0.525 98-99 0.43750000000000006 100 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.7826306488260539 1.55 3 0.10098459984852311 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0125 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.025 0.025 0.0 0.0 0.0 18-19 0.025 0.025 0.0 0.0 0.0 20-21 0.025 0.025 0.0 0.0 0.0 22-23 0.025 0.025 0.0 0.0 0.0 24-25 0.025 0.025 0.0 0.0 0.0 26-27 0.025 0.025 0.0 0.0 0.0 28-29 0.025 0.025 0.0 0.0 0.0 30-31 0.025 0.025 0.0 0.0 0.0 32-33 0.025 0.025 0.0 0.0 0.0 34-35 0.025 0.025 0.0 0.0 0.0 36-37 0.025 0.025 0.0 0.0 0.0 38-39 0.025 0.025 0.0 0.0 0.0 40-41 0.025 0.025 0.0 0.0 0.0 42-43 0.025 0.025 0.0 0.0 0.0 44-45 0.025 0.025 0.0 0.0 0.0 46-47 0.025 0.025 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.025 0.025 0.0 0.0 0.0 54-55 0.025 0.025 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.05 0.025 0.0 0.0 0.0 86-87 0.1 0.025 0.0 0.0 0.0 88 0.125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293874 spots for SRR5456713.sra Written 1293874 spots for SRR5456713.sra Read 1293875 spots for SRR5456713.sra Written 1293875 spots for SRR5456713.sra SRR ids: ['SRR5456713.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ej62ibs2 SRR5456713.sra spots: 25877481 blocks: [[1, 1293874], [1293875, 2587748], [2587749, 3881622], [3881623, 5175496], [5175497, 6469370], [6469371, 7763244], [7763245, 9057118], [9057119, 10350992], [10350993, 11644866], [11644867, 12938740], [12938741, 14232614], [14232615, 15526488], [15526489, 16820362], [16820363, 18114236], [18114237, 19408110], [19408111, 20701984], [20701985, 21995858], [21995859, 23289732], [23289733, 24583606], [24583607, 25877481]] SRR5456713 file size 7077395 SRR5456713 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5456713 SRR5456713_1.fastq SRR5456713_2.fastq Input file: SRR5456713_1.fastq Paired file: SRR5456713_2.fastq trimmed: SRR5456713-trimmed-pair1.fastq, SRR5456713-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:03:26 2024 >> started Sat Dec 7 00:03:50 2024 >> done (23.893s) 25877481 read pairs processed; of these: 90403 ( 0.35%) short read pairs filtered out after trimming by size control 66866 ( 0.26%) empty read pairs filtered out after trimming by size control 25720212 (99.39%) read pairs available; of these: 1062835 ( 4.13%) trimmed read pairs available after processing 24657377 (95.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 13 0.00% 20 25 0.00% 21 14 0.00% 22 33 0.00% 23 24 0.00% 24 30 0.00% 25 27 0.00% 26 37 0.00% 27 27 0.00% 28 21 0.00% 29 37 0.00% 30 28 0.00% 31 22 0.00% 32 32 0.00% 33 28 0.00% 34 52 0.00% 35 44 0.00% 36 41 0.00% 37 51 0.00% 38 60 0.00% 39 49 0.00% 40 50 0.00% 41 61 0.00% 42 62 0.00% 43 66 0.00% 44 86 0.00% 45 96 0.00% 46 86 0.00% 47 118 0.00% 48 133 0.00% 49 112 0.00% 50 127 0.00% 51 173 0.00% 52 203 0.00% 53 212 0.00% 54 229 0.00% 55 285 0.00% 56 270 0.00% 57 374 0.00% 58 459 0.00% 59 5384 0.02% 60 5556 0.02% 61 5917 0.02% 62 6006 0.02% 63 6464 0.03% 64 6631 0.03% 65 6289 0.02% 66 6522 0.03% 67 6314 0.02% 68 6698 0.03% 69 6539 0.03% 70 6655 0.03% 71 6881 0.03% 72 7127 0.03% 73 7274 0.03% 74 7578 0.03% 75 7903 0.03% 76 8610 0.03% 77 9394 0.04% 78 9278 0.04% 79 10100 0.04% 80 10361 0.04% 81 11250 0.04% 82 12250 0.05% 83 12813 0.05% 84 14121 0.05% 85 15284 0.06% 86 17271 0.07% 87 17972 0.07% 88 20815 0.08% 89 22633 0.09% 90 24095 0.09% 91 26957 0.10% 92 34156 0.13% 93 36637 0.14% 94 42430 0.16% 95 55716 0.22% 96 63304 0.25% 97 84439 0.33% 98 125603 0.49% 99 261693 1.02% 100 24657377 95.87% 25720212 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=167.46 fanout-score-rank=10 prefix-density=0.74 prefix-fanout=24.2 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=298.94 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=27.8 sequence=TCTTCTTCTTGTC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=35 prefix-density=0.38 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=33 fanout-score=616.46 fanout-score-rank=1 prefix-density=1.89 prefix-fanout=19.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5456713 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:04:25 Started mapping on | Dec 07 00:04:25 Finished on | Dec 07 00:06:00 Mapping speed, Million of reads per hour | 974.66 Number of input reads | 25720212 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 23780028 Uniquely mapped reads % | 92.46% Average mapped length | 198.78 Number of splices: Total | 15303197 Number of splices: Annotated (sjdb) | 14136862 Number of splices: GT/AG | 15090786 Number of splices: GC/AG | 168620 Number of splices: AT/AC | 11952 Number of splices: Non-canonical | 31839 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283333 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 64983 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.50% % of reads unmapped: other | 1.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1704968 1704968 1704968 N_multimapping 283333 283333 283333 N_noFeature 1019386 23163579 1263825 N_ambiguous 446586 4619 73832 UnstrandedReadsAssigned:22314056 PositiveStrandReadsAssigned:611830 NegativeStrandReadsAssigned:22442371 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR5456713 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5456713-trimmed-pair1.fastq SRR5456713-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,720,212 reads, 22,808,795 reads pseudoaligned [quant] estimated average fragment length: 329.217 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR5456713.ke.tsv 35125 SRR5456713.se.tsv 88098 total ==> SRR5456713.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 609.479 0 0 PNS24247 1044 715.783 86.6906 7.30784 PNS24249 1928 1599.78 454.692 17.1496 PNS24246 1044 715.783 86.6906 7.30784 PNS24248 1044 715.783 86.6906 7.30784 PNS24244 1471 1142.78 105.236 5.55648 PNS24243 293 79.7435 3 2.26999 KQK14069 1603 1274.78 1950.49 92.322 KQK14071 474 195.357 5.72162 1.76722 ==> SRR5456713.se.tsv <== BRADI_1g14170v3 2140 BRADI_1g53295v3 122 BRADI_1g59795v3 427 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 2503 BRADI_1g74790v3 723 BRADI_1g09890v3 0 BRADI_1g77505v3 302 BRADI_1g48960v3 0 SRR5456713 completed mapping pipeline successfully