Starting /dee2/code/volunteer_pipeline.sh SRR5515071 current disk space = 2792277929984 free memory = 1543661384 SRR5515071 SRAfilesize 55e8ceb0c940162b10ba9d085d22b69e SRR5515071.sra SRR5515071.sra file validated SRR5515071 is paired end SRR5515071 is conventional basespace SRR5515071 read1 length is 92-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515071_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.3595 33.0 33.0 33.0 27.0 33.0 2 30.59575 33.0 33.0 33.0 27.0 33.0 3 26.7095 33.0 22.0 33.0 15.0 33.0 4 32.79 37.0 33.0 37.0 22.0 37.0 5 33.598 37.0 33.0 37.0 27.0 37.0 6 33.72475 37.0 37.0 37.0 27.0 37.0 7 33.92925 37.0 37.0 37.0 27.0 37.0 8 33.87225 37.0 37.0 37.0 27.0 37.0 9 33.8625 37.0 37.0 37.0 27.0 37.0 10-11 33.82 37.0 37.0 37.0 27.0 37.0 12-13 33.7205 37.0 37.0 37.0 27.0 37.0 14-15 35.348 40.0 37.0 40.0 27.0 40.0 16-17 35.370625000000004 40.0 37.0 40.0 27.0 40.0 18-19 35.286 40.0 37.0 40.0 27.0 40.0 20-21 35.107124999999996 40.0 37.0 40.0 27.0 40.0 22-23 35.00625 40.0 37.0 40.0 27.0 40.0 24-25 34.885374999999996 40.0 37.0 40.0 24.5 40.0 26-27 34.80625 40.0 37.0 40.0 22.0 40.0 28-29 34.48375 38.5 35.0 40.0 22.0 40.0 30-31 34.42475 37.0 37.0 40.0 22.0 40.0 32-33 34.318875 37.0 37.0 40.0 22.0 40.0 34-35 34.189625 37.0 33.0 40.0 22.0 40.0 36-37 33.809 37.0 33.0 40.0 15.0 40.0 38-39 33.600125000000006 37.0 33.0 40.0 15.0 40.0 40-41 33.353875 37.0 33.0 40.0 15.0 40.0 42-43 33.213 37.0 33.0 40.0 15.0 40.0 44-45 32.989875 37.0 33.0 40.0 15.0 40.0 46-47 32.717749999999995 37.0 33.0 40.0 15.0 40.0 48-49 32.832750000000004 37.0 33.0 40.0 10.5 40.0 50-51 32.923874999999995 37.0 33.0 40.0 10.5 40.0 52-53 32.769875 37.0 33.0 40.0 6.0 40.0 54-55 32.539125 37.0 33.0 40.0 6.0 40.0 56-57 32.299375 37.0 33.0 40.0 4.0 40.0 58-59 32.108375 37.0 33.0 38.5 2.0 40.0 60-61 31.87225 37.0 33.0 37.0 2.0 40.0 62-63 31.605125 37.0 33.0 37.0 2.0 40.0 64-65 31.32325 37.0 33.0 37.0 2.0 40.0 66-67 31.019125000000003 37.0 33.0 37.0 2.0 40.0 68-69 30.784125 37.0 33.0 37.0 2.0 38.5 70-71 30.6025 37.0 33.0 37.0 2.0 37.0 72-73 30.245 37.0 33.0 37.0 2.0 37.0 74-75 30.10625 37.0 33.0 37.0 2.0 37.0 76-77 28.6965 33.0 27.0 37.0 2.0 37.0 78-79 29.646125 33.0 27.0 37.0 2.0 37.0 80-81 29.783499999999997 35.0 30.0 37.0 2.0 37.0 82-83 29.826125 35.0 33.0 37.0 2.0 37.0 84-85 29.6485 33.0 33.0 37.0 2.0 37.0 86-87 29.486874999999998 33.0 27.0 37.0 2.0 37.0 88-89 29.345750000000002 33.0 27.0 37.0 2.0 37.0 90-91 29.175 33.0 27.0 37.0 2.0 37.0 92-93 28.901356901725432 33.0 27.0 37.0 2.0 37.0 94-95 28.818079519879973 33.0 27.0 37.0 2.0 37.0 96-97 28.651602640310642 33.0 27.0 37.0 2.0 37.0 98-99 28.306843820506394 33.0 27.0 37.0 2.0 37.0 100-101 26.296941589370768 33.0 21.0 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 138.0 3 45.0 4 28.0 5 16.0 6 13.0 7 19.0 8 16.0 9 17.0 10 9.0 11 19.0 12 26.0 13 18.0 14 24.0 15 22.0 16 21.0 17 15.0 18 17.0 19 13.0 20 22.0 21 16.0 22 21.0 23 32.0 24 33.0 25 34.0 26 33.0 27 53.0 28 55.0 29 60.0 30 78.0 31 107.0 32 127.0 33 179.0 34 269.0 35 326.0 36 558.0 37 995.0 38 525.0 39 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.35483870967742 15.078769692423105 26.056514128532132 39.509877469367346 2 30.125 22.15 29.9 17.825 3 28.299999999999997 23.525 27.400000000000002 20.775 4 28.675 28.375 15.775 27.175 5 29.45 30.65 18.325 21.575 6 21.44825858180907 34.30217990478577 17.113505387121023 27.136056126284142 7 20.732013035848585 12.985710704437203 41.3888192529456 24.893457006768614 8 23.777276147479306 18.133935289691497 21.46977677451718 36.61901178831201 9 25.733634311512414 19.187358916478555 25.30724855781289 29.771758214196137 10-11 27.183857626268953 26.97079834565735 18.71161799724276 27.13372603083093 12-13 25.363773206221772 21.562970396387357 25.175614651279478 27.89764174611139 14-15 26.611487333834965 23.08753448708302 23.927765237020317 26.373212942061702 16-17 27.649711851666247 22.387872713605613 22.90152843898772 27.060886995740418 18-19 27.210117705985475 24.06711745554721 22.276483846731782 26.446280991735538 20-21 27.130521837066702 24.31485421098736 22.09986234513828 26.454761606807658 22-23 27.39348370927318 23.370927318295738 22.69423558897243 26.54135338345865 24-25 26.373212942061702 24.166039628793577 22.786556308001003 26.674191121143714 26-27 28.092848180677542 24.127979924717692 22.082810539523212 25.696361355081553 28-29 26.946708463949843 23.962382445141067 22.206896551724135 26.884012539184955 30-31 26.901390803157497 23.518356095727352 22.791630121538653 26.788622979576495 32-33 27.191883767535067 24.37374749498998 22.49498997995992 25.93937875751503 34-35 27.247648902821314 24.238244514106583 22.307210031347964 26.20689655172414 36-37 26.135508155583437 24.07779171894605 22.258469259723963 27.52823086574655 38-39 27.73109243697479 23.253480496676282 22.588736987332247 26.42669007901668 40-41 28.270412642669008 23.44161545215101 22.2751787282077 26.01279317697228 42-43 27.118856569709127 23.721163490471415 22.981444332998997 26.178535606820464 44-45 28.281308762692742 23.492541055534662 21.850319669048517 26.37583051272408 46-47 27.526962628542762 23.401053423626784 22.94958615500376 26.122397792826686 48-49 26.573865061449712 24.053172811637825 22.272385252069224 27.10057687484324 50-51 28.168484392628805 23.25435627428858 22.22640090259496 26.35075843048765 52-53 26.655795283492225 23.858504766683392 22.202709483191168 27.282990466633215 54-55 26.379829402910186 23.31911690918214 22.880080280983442 27.420973406924237 56-57 28.029069038967545 22.71645157248465 22.08996366370129 27.16451572484651 58-59 27.057200200702457 23.68289011540391 22.36578023080783 26.894129453085803 60-61 26.1698657633923 23.924225316773303 22.87040521891858 27.035503700915818 62-63 27.937304075235108 23.00940438871473 22.018808777429467 27.034482758620687 64-65 27.33776829421363 23.509476590937616 22.31705786368771 26.83569725116104 66-67 27.082024871247327 23.35133777163673 22.58510237407361 26.981534983042334 68-69 28.625235404896422 22.900188323917135 22.033898305084744 26.440677966101696 70-71 28.39924670433145 23.52793471437539 21.89579409918393 26.17702448210923 72-73 27.281858129315754 23.515379786566225 22.548650345260516 26.6541117388575 74-75 27.7038895859473 23.186951066499372 22.45922208281054 26.649937264742785 76-77 27.039919658548833 23.173487321114738 22.319859402460455 27.46673361787597 78-79 27.175687554941604 22.943614215747836 22.654778349868142 27.225919879442422 80-81 27.080979284369118 23.2015065913371 22.774639045825488 26.942875078468298 82-83 27.65289463769936 22.855707647871405 22.629662187617733 26.861735526811504 84-85 26.950621937429325 23.533107174268125 22.61590652091971 26.90036436738284 86-87 26.82069311903566 23.066298342541437 23.468106479156205 26.644902059266702 88-89 27.06842435655995 23.013182674199623 22.988072818581294 26.93032015065913 90-91 26.73279758915118 22.965846308387743 22.5891511803114 27.712204922149674 92-93 27.56845013815624 22.758100979653353 22.218035669429792 27.455413212760615 94-95 27.579713783580218 22.382626161185037 23.211147376349487 26.826512678885262 96-97 27.19166038683748 23.78799296659131 22.44410952022105 26.57623712635016 98-99 27.5480708809853 22.395375141384942 22.546185748397637 27.510368229232125 100-101 28.076343545956806 21.79809141135108 23.116524359618282 27.00904068307383 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 2.0 3 1.5 4 0.0 5 1.0 6 1.0 7 1.5 8 1.5 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 3.5 28 3.5 29 3.0 30 4.0 31 7.0 32 12.5 33 18.0 34 20.0 35 25.5 36 40.0 37 46.5 38 45.5 39 56.5 40 71.5 41 85.5 42 107.0 43 124.0 44 130.0 45 138.0 46 147.5 47 156.5 48 165.0 49 151.5 50 128.0 51 119.0 52 121.5 53 123.0 54 114.0 55 111.0 56 107.5 57 86.0 58 93.5 59 108.5 60 96.5 61 88.0 62 80.0 63 85.5 64 95.5 65 86.0 66 79.5 67 85.5 68 84.0 69 78.5 70 72.5 71 61.5 72 52.5 73 45.5 74 44.0 75 41.0 76 33.5 77 24.5 78 19.0 79 17.5 80 12.5 81 6.0 82 4.5 83 5.5 84 2.5 85 1.0 86 1.0 87 1.5 88 1.0 89 0.0 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.27499999999999997 8 0.325 9 0.325 10-11 0.2625 12-13 0.35000000000000003 14-15 0.325 16-17 0.22499999999999998 18-19 0.17500000000000002 20-21 0.11249999999999999 22-23 0.25 24-25 0.325 26-27 0.375 28-29 0.3125 30-31 0.2375 32-33 0.2 34-35 0.3125 36-37 0.375 38-39 0.3375 40-41 0.3375 42-43 0.3 44-45 0.2875 46-47 0.325 48-49 0.325 50-51 0.2875 52-53 0.35000000000000003 54-55 0.35000000000000003 56-57 0.2375 58-59 0.35000000000000003 60-61 0.36250000000000004 62-63 0.3125 64-65 0.41250000000000003 66-67 0.4875 68-69 0.43750000000000006 70-71 0.43750000000000006 72-73 0.43750000000000006 74-75 0.375 76-77 0.42500000000000004 78-79 0.46249999999999997 80-81 0.43750000000000006 82-83 0.46249999999999997 84-85 0.5125000000000001 86-87 0.44999999999999996 88-89 0.43750000000000006 90-91 0.44999999999999996 92-93 0.4625578197274659 94-95 0.4001000250062516 96-97 0.30052592036063114 98-99 0.26322386563048383 100-101 0.17548257708698922 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92 1.0 93 0.0 94 0.0 95 2.0 96 8.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3989.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0125 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5515071 read2 length is 92-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515071_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0545 33.0 33.0 33.0 27.0 33.0 2 29.9745 33.0 33.0 33.0 22.0 33.0 3 29.9445 33.0 33.0 33.0 22.0 33.0 4 33.5255 37.0 37.0 37.0 27.0 37.0 5 33.3765 37.0 37.0 37.0 27.0 37.0 6 33.2535 37.0 37.0 37.0 22.0 37.0 7 33.2275 37.0 37.0 37.0 22.0 37.0 8 33.14325 37.0 37.0 37.0 22.0 37.0 9 33.25425 37.0 37.0 37.0 27.0 37.0 10-11 33.149625 37.0 37.0 37.0 22.0 37.0 12-13 32.97125 37.0 37.0 37.0 18.5 37.0 14-15 34.525375 40.0 37.0 40.0 18.5 40.0 16-17 34.4095 40.0 37.0 40.0 15.0 40.0 18-19 34.297124999999994 40.0 35.0 40.0 15.0 40.0 20-21 34.149249999999995 37.0 33.0 40.0 15.0 40.0 22-23 34.155874999999995 38.5 33.0 40.0 15.0 40.0 24-25 33.95075 37.0 33.0 40.0 15.0 40.0 26-27 33.679874999999996 37.0 33.0 40.0 15.0 40.0 28-29 33.525125 37.0 33.0 40.0 15.0 40.0 30-31 33.376 37.0 33.0 40.0 10.5 40.0 32-33 33.2005 37.0 33.0 40.0 6.0 40.0 34-35 33.133250000000004 37.0 33.0 40.0 6.0 40.0 36-37 32.900625000000005 37.0 33.0 40.0 6.0 40.0 38-39 32.635625 37.0 33.0 40.0 2.0 40.0 40-41 32.272875 37.0 33.0 40.0 2.0 40.0 42-43 31.92725 37.0 33.0 40.0 2.0 40.0 44-45 31.942500000000003 37.0 33.0 40.0 2.0 40.0 46-47 31.759999999999998 37.0 33.0 40.0 2.0 40.0 48-49 31.803 37.0 33.0 40.0 2.0 40.0 50-51 30.84125 37.0 30.0 38.5 2.0 40.0 52-53 30.93525 37.0 33.0 37.0 2.0 40.0 54-55 31.279249999999998 37.0 33.0 40.0 2.0 40.0 56-57 31.2265 37.0 33.0 40.0 2.0 40.0 58-59 30.960125 37.0 33.0 37.0 2.0 40.0 60-61 30.892625000000002 37.0 33.0 37.0 2.0 40.0 62-63 30.634375 37.0 33.0 37.0 2.0 40.0 64-65 30.396625 37.0 33.0 37.0 2.0 40.0 66-67 30.213375 37.0 30.0 37.0 2.0 40.0 68-69 29.988375 37.0 27.0 37.0 2.0 38.5 70-71 29.660874999999997 37.0 27.0 37.0 2.0 37.0 72-73 29.478375 37.0 27.0 37.0 2.0 37.0 74-75 29.273249999999997 37.0 27.0 37.0 2.0 37.0 76-77 29.103875000000002 33.0 27.0 37.0 2.0 37.0 78-79 28.796 33.0 27.0 37.0 2.0 37.0 80-81 28.56725 33.0 27.0 37.0 2.0 37.0 82-83 28.491125 33.0 27.0 37.0 2.0 37.0 84-85 28.347749999999998 33.0 27.0 37.0 2.0 37.0 86-87 28.116999999999997 33.0 27.0 37.0 2.0 37.0 88-89 27.921 33.0 27.0 37.0 2.0 37.0 90-91 27.759375 33.0 27.0 37.0 2.0 37.0 92-93 27.524188265816456 33.0 27.0 37.0 2.0 37.0 94-95 27.45678609497297 33.0 27.0 37.0 2.0 37.0 96-97 27.20361152222222 33.0 24.5 37.0 2.0 37.0 98-99 26.84264595339514 33.0 22.0 37.0 2.0 37.0 100-101 25.075043848659483 30.0 18.5 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 210.0 3 36.0 4 29.0 5 20.0 6 29.0 7 13.0 8 28.0 9 25.0 10 22.0 11 26.0 12 19.0 13 10.0 14 20.0 15 12.0 16 18.0 17 17.0 18 14.0 19 19.0 20 21.0 21 23.0 22 25.0 23 40.0 24 34.0 25 32.0 26 47.0 27 61.0 28 66.0 29 69.0 30 84.0 31 118.0 32 148.0 33 173.0 34 222.0 35 309.0 36 536.0 37 935.0 38 490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.675 13.625000000000002 25.0 42.699999999999996 2 29.525000000000002 23.0 28.075 19.400000000000002 3 31.2 25.1 21.2 22.5 4 27.325 28.675 15.0 28.999999999999996 5 32.35 29.799999999999997 16.225 21.625 6 21.825 35.075 17.375 25.724999999999998 7 20.655163790947736 12.45311327831958 40.310077519379846 26.581645411352838 8 24.26820115086315 18.363772829622217 21.215911933950462 36.15211408556417 9 24.218163622717036 18.563922942206652 25.544158118588946 31.673755316487366 10-11 27.952952952952952 26.25125125125125 18.08058058058058 27.715215215215217 12-13 25.203353772994618 21.787010386685022 25.666374671505444 27.343261168814912 14-15 26.67917448405253 23.076923076923077 23.68980612883052 26.55409631019387 16-17 27.33983983983984 23.135635635635634 21.82182182182182 27.7027027027027 18-19 26.448142124358814 24.283748279744778 23.695733767046164 25.572375828850248 20-21 26.463963963963966 23.873873873873876 22.872872872872875 26.789289289289293 22-23 26.814314314314313 23.56106106106106 22.772772772772772 26.851851851851855 24-25 27.549105467283873 23.683222819967472 21.593894657825597 27.17377705492306 26-27 27.831310224002003 23.839319234138408 21.286447253159803 27.04292328869979 28-29 27.52752752752753 23.56106106106106 22.347347347347345 26.564064064064063 30-31 26.604930546865223 23.776748842447752 23.176073082217492 26.442247528469526 32-33 27.505944187210613 24.35239644600175 21.349017644850456 26.792641721937176 34-35 27.6 23.8125 22.175 26.4125 36-37 27.525 23.3 22.237499999999997 26.937499999999996 38-39 27.737499999999997 23.25 22.037499999999998 26.974999999999998 40-41 27.85 23.2375 22.2 26.7125 42-43 26.6 23.8875 22.725 26.787499999999998 44-45 26.9125 23.7875 22.8875 26.4125 46-47 27.4125 23.0 22.7375 26.85 48-49 27.675 23.6125 22.25 26.4625 50-51 26.875 23.799999999999997 21.9375 27.3875 52-53 27.712500000000002 23.175 22.162499999999998 26.950000000000003 54-55 27.425 22.662499999999998 22.2 27.712500000000002 56-57 27.175 23.5625 22.8875 26.375 58-59 27.0125 23.2625 22.775000000000002 26.950000000000003 60-61 27.025 23.150000000000002 23.05 26.775 62-63 28.025 23.175 21.675 27.125 64-65 27.037499999999998 23.799999999999997 22.2 26.9625 66-67 27.150000000000002 22.8125 22.412499999999998 27.625 68-69 28.3375 22.5875 21.637500000000003 27.437499999999996 70-71 26.825 23.8625 22.7375 26.575 72-73 27.650000000000002 22.875 22.5875 26.887499999999996 74-75 27.750000000000004 22.775000000000002 22.3375 27.1375 76-77 27.0625 23.5125 22.1875 27.237499999999997 78-79 27.500000000000004 23.6375 22.537499999999998 26.325 80-81 28.549999999999997 23.375 21.05 27.025 82-83 28.012500000000003 23.025000000000002 21.875 27.0875 84-85 27.9125 22.925 21.925 27.237499999999997 86-87 27.1125 23.6375 21.85 27.400000000000002 88-89 27.5625 23.7375 21.9375 26.7625 90-91 27.5625 22.875 22.1875 27.375 92-93 27.84098012251531 22.727840980122515 22.215276909613703 27.21590198774847 94-95 27.72289608603226 22.308365637113916 22.095785919719894 27.872952357133922 96-97 27.30345518277416 22.183274912368553 23.322483725588384 27.190786179268905 98-99 26.885492357805063 22.037083437734903 22.95164119268354 28.125783011776495 100-101 27.91280380856928 22.400400902029567 21.748935103983964 27.93786018541719 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.0 27 0.5 28 2.0 29 2.5 30 3.0 31 4.5 32 9.5 33 16.0 34 18.5 35 16.5 36 27.0 37 36.5 38 44.0 39 56.0 40 70.5 41 89.0 42 103.0 43 120.5 44 143.5 45 146.5 46 142.5 47 151.5 48 146.0 49 145.5 50 148.5 51 140.0 52 135.0 53 131.5 54 120.5 55 103.0 56 96.0 57 94.5 58 93.5 59 93.0 60 81.0 61 90.5 62 107.0 63 93.5 64 79.5 65 82.5 66 89.5 67 83.0 68 77.5 69 73.0 70 66.0 71 64.5 72 59.5 73 51.0 74 50.5 75 46.5 76 32.0 77 27.5 78 23.0 79 18.0 80 13.5 81 10.5 82 8.5 83 4.5 84 4.0 85 2.0 86 0.5 87 1.5 88 1.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.075 9 0.075 10-11 0.1 12-13 0.11249999999999999 14-15 0.0625 16-17 0.1 18-19 0.08750000000000001 20-21 0.1 22-23 0.1 24-25 0.08750000000000001 26-27 0.11249999999999999 28-29 0.1 30-31 0.11249999999999999 32-33 0.11249999999999999 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92 1.0 93 0.0 94 1.0 95 1.0 96 6.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3991.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595930 spots for SRR5515071.sra Written 595930 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra Read 595929 spots for SRR5515071.sra Written 595929 spots for SRR5515071.sra SRR ids: ['SRR5515071.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6kngffqw SRR5515071.sra spots: 11918581 blocks: [[1, 595929], [595930, 1191858], [1191859, 1787787], [1787788, 2383716], [2383717, 2979645], [2979646, 3575574], [3575575, 4171503], [4171504, 4767432], [4767433, 5363361], [5363362, 5959290], [5959291, 6555219], [6555220, 7151148], [7151149, 7747077], [7747078, 8343006], [8343007, 8938935], [8938936, 9534864], [9534865, 10130793], [10130794, 10726722], [10726723, 11322651], [11322652, 11918581]] SRR5515071 file size 2852911 SRR5515071 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5515071 SRR5515071_1.fastq SRR5515071_2.fastq Input file: SRR5515071_1.fastq Paired file: SRR5515071_2.fastq trimmed: SRR5515071-trimmed-pair1.fastq, SRR5515071-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Mar 17 01:49:55 2025 >> started Mon Mar 17 01:50:08 2025 >> done (13.195s) 11918581 read pairs processed; of these: 315319 ( 2.65%) short read pairs filtered out after trimming by size control 727727 ( 6.11%) empty read pairs filtered out after trimming by size control 10875535 (91.25%) read pairs available; of these: 3040169 (27.95%) trimmed read pairs available after processing 7835366 (72.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 254 0.00% 19 628 0.01% 20 1002 0.01% 21 1354 0.01% 22 1895 0.02% 23 2345 0.02% 24 2844 0.03% 25 3304 0.03% 26 3733 0.03% 27 4239 0.04% 28 4481 0.04% 29 4861 0.04% 30 5370 0.05% 31 5877 0.05% 32 5987 0.06% 33 6203 0.06% 34 6354 0.06% 35 6587 0.06% 36 6723 0.06% 37 7048 0.06% 38 7086 0.07% 39 7381 0.07% 40 7814 0.07% 41 8050 0.07% 42 7990 0.07% 43 8256 0.08% 44 8368 0.08% 45 8422 0.08% 46 8737 0.08% 47 8829 0.08% 48 10264 0.09% 49 9348 0.09% 50 9646 0.09% 51 9626 0.09% 52 9776 0.09% 53 9988 0.09% 54 10648 0.10% 55 10868 0.10% 56 11485 0.11% 57 12507 0.12% 58 12999 0.12% 59 19119 0.18% 60 24467 0.22% 61 25125 0.23% 62 27058 0.25% 63 26562 0.24% 64 27179 0.25% 65 28302 0.26% 66 29708 0.27% 67 30284 0.28% 68 30197 0.28% 69 30252 0.28% 70 30876 0.28% 71 30061 0.28% 72 29134 0.27% 73 28946 0.27% 74 28301 0.26% 75 30985 0.28% 76 25385 0.23% 77 29739 0.27% 78 32050 0.29% 79 33819 0.31% 80 35136 0.32% 81 37664 0.35% 82 39795 0.37% 83 40515 0.37% 84 41071 0.38% 85 43263 0.40% 86 45270 0.42% 87 47702 0.44% 88 46732 0.43% 89 49458 0.45% 90 53990 0.50% 91 59779 0.55% 92 67083 0.62% 93 80486 0.74% 94 83817 0.77% 95 98662 0.91% 96 117344 1.08% 97 147823 1.36% 98 224868 2.07% 99 278968 2.57% 100 555511 5.11% 101 7803872 71.76% 10875535 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=220.65 fanout-score-rank=11 prefix-density=1.02 prefix-fanout=26.7 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=392.99 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=26.7 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.9 sequence=GCCGCCATCGCCAAGCTGCCGTCGCTGAGCCCATCCCCCCAGGTGGACGCGCTGTTCACGGAGCTGGTGACCGCGTGCGTGCCGCCGAGCCCCGTGGACGTGACGAAGCTGGGCCCGGAGGCGCAGAGGATGCGCGAGGAGCTGATCCGCCTCTGCTCCACCGCCGAGGGCCACCTGGAGGCGCACTACGCCGACAAGCTTGCCGCCTTCGACAACCCGCTGGACCACCTCGACTGCTTCCCCTACTACAGCAACTACATCAACCTGAGCAAGCTGGAGTACGACCTGCTCGCACGCTACATGCCTTCATCATCTGGCATCGAGCCGGCCCGCGTGGCGTTCGTGGGCTCCGGCCCGCTGCCGTTCACGTCGCTGGTCCTGGCGGCGCGCCACCTGCCCAACACGCTGTTCGACAACTACGACTGGAGCGAGTCGGCCAACGAGCGCGCCAGGAAGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=367.60 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=25.5 sequence=CGGCGGCGGCGA SRR5515071 testing PE reads STAR mapping to Ensembl genome Started job on | Mar 17 01:50:56 Started mapping on | Mar 17 01:50:57 Finished on | Mar 17 01:52:55 Mapping speed, Million of reads per hour | 331.80 Number of input reads | 10875535 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 9487638 Uniquely mapped reads % | 87.24% Average mapped length | 191.42 Number of splices: Total | 5122365 Number of splices: Annotated (sjdb) | 4907531 Number of splices: GT/AG | 5039056 Number of splices: GC/AG | 70180 Number of splices: AT/AC | 3374 Number of splices: Non-canonical | 9755 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128944 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 11655 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.71% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1301115 1301115 1301115 N_multimapping 128944 128944 128944 N_noFeature 194410 4792064 4720726 N_ambiguous 189770 11558 11923 UnstrandedReadsAssigned:9103458 PositiveStrandReadsAssigned:4684016 NegativeStrandReadsAssigned:4754989 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5515071 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5515071-trimmed-pair1.fastq SRR5515071-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,875,535 reads, 9,356,887 reads pseudoaligned [quant] estimated average fragment length: 236.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52973 SRR5515071.ke.tsv 35125 SRR5515071.se.tsv 88098 total ==> SRR5515071.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.497 31.9838 6.44892 PNS24247 1044 808.337 19.3831 3.38684 PNS24249 1928 1692.34 148.709 12.4112 PNS24246 1044 808.337 19.3831 3.38684 PNS24248 1044 808.337 19.3831 3.38684 PNS24244 1471 1235.34 37.1583 4.24848 PNS24243 293 59.8877 5 11.7922 KQK14069 1603 1367.34 6083.8 628.439 KQK14071 474 240.035 652.801 384.123 ==> SRR5515071.se.tsv <== BRADI_1g14170v3 6978 BRADI_1g53295v3 25 BRADI_1g59795v3 52 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 514 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 88 BRADI_1g48960v3 0 SRR5515071 completed mapping pipeline successfully