Starting /dee2/code/volunteer_pipeline.sh SRR5515072 current disk space = 1523805437952 free memory = 1583191268 SRR5515072 SRAfilesize 944be2833aff80afb0e45294ec018aac SRR5515072.sra SRR5515072.sra file validated SRR5515072 is paired end SRR5515072 is conventional basespace SRR5515072 read1 length is 89-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515072_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 89-101 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.06875 15.0 15.0 27.0 15.0 33.0 2 23.392 27.0 15.0 33.0 15.0 33.0 3 24.6095 27.0 15.0 33.0 15.0 33.0 4 31.18375 37.0 27.0 37.0 15.0 37.0 5 32.548 37.0 33.0 37.0 15.0 37.0 6 32.96075 37.0 33.0 37.0 22.0 37.0 7 33.11525 37.0 33.0 37.0 22.0 37.0 8 33.02 37.0 33.0 37.0 22.0 37.0 9 33.04475 37.0 37.0 37.0 22.0 37.0 10-11 32.917125 37.0 37.0 37.0 15.0 37.0 12-13 32.753125 37.0 33.0 37.0 15.0 37.0 14-15 34.25875 40.0 35.0 40.0 15.0 40.0 16-17 34.24875 40.0 33.0 40.0 15.0 40.0 18-19 34.167249999999996 40.0 35.0 40.0 15.0 40.0 20-21 34.025125 40.0 33.0 40.0 15.0 40.0 22-23 34.035375 40.0 33.0 40.0 15.0 40.0 24-25 33.874750000000006 37.0 33.0 40.0 15.0 40.0 26-27 33.4825 37.0 33.0 40.0 10.5 40.0 28-29 33.240375 37.0 33.0 40.0 6.0 40.0 30-31 33.22425 37.0 33.0 40.0 6.0 40.0 32-33 33.137249999999995 37.0 33.0 40.0 6.0 40.0 34-35 32.9865 37.0 33.0 40.0 2.0 40.0 36-37 32.744749999999996 37.0 33.0 40.0 2.0 40.0 38-39 32.570125000000004 37.0 33.0 40.0 2.0 40.0 40-41 32.405375 37.0 33.0 40.0 2.0 40.0 42-43 32.205375000000004 37.0 33.0 40.0 2.0 40.0 44-45 31.880375 37.0 33.0 40.0 2.0 40.0 46-47 31.623625 37.0 33.0 40.0 2.0 40.0 48-49 31.786875000000002 37.0 33.0 40.0 2.0 40.0 50-51 31.810125 37.0 33.0 40.0 2.0 40.0 52-53 31.613374999999998 37.0 33.0 40.0 2.0 40.0 54-55 31.416875 37.0 33.0 40.0 2.0 40.0 56-57 31.188625000000002 37.0 33.0 38.5 2.0 40.0 58-59 30.9055 37.0 33.0 37.0 2.0 40.0 60-61 30.74575 37.0 33.0 37.0 2.0 40.0 62-63 30.511 37.0 33.0 37.0 2.0 40.0 64-65 30.392375 37.0 33.0 37.0 2.0 40.0 66-67 30.147 37.0 33.0 37.0 2.0 40.0 68-69 29.8655 37.0 27.0 37.0 2.0 38.5 70-71 29.717624999999998 37.0 27.0 37.0 2.0 37.0 72-73 29.518500000000003 35.0 27.0 37.0 2.0 37.0 74-75 29.197375 33.0 27.0 37.0 2.0 37.0 76-77 27.765375 33.0 27.0 37.0 2.0 37.0 78-79 28.761875 33.0 27.0 37.0 2.0 37.0 80-81 28.758000000000003 33.0 27.0 37.0 2.0 37.0 82-83 28.6875 33.0 27.0 37.0 2.0 37.0 84-85 28.6575 33.0 27.0 37.0 2.0 37.0 86-87 28.42525 33.0 27.0 37.0 2.0 37.0 88-89 28.20225 33.0 27.0 37.0 2.0 37.0 90-91 28.11902975743936 33.0 27.0 37.0 2.0 37.0 92-93 27.946486621655417 33.0 27.0 37.0 2.0 37.0 94-95 27.617481533965282 33.0 27.0 37.0 2.0 37.0 96-97 27.557527836029465 33.0 27.0 37.0 2.0 37.0 98-99 27.22613380105237 33.0 27.0 37.0 2.0 37.0 100-101 25.516662490603856 33.0 21.0 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 212.0 3 68.0 4 17.0 5 22.0 6 31.0 7 24.0 8 22.0 9 24.0 10 21.0 11 18.0 12 19.0 13 21.0 14 7.0 15 19.0 16 15.0 17 18.0 18 14.0 19 7.0 20 14.0 21 11.0 22 25.0 23 31.0 24 40.0 25 37.0 26 46.0 27 43.0 28 56.0 29 90.0 30 99.0 31 112.0 32 146.0 33 212.0 34 253.0 35 387.0 36 639.0 37 947.0 38 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.58439609902476 28.257064266066518 14.828707176794198 19.32983245811453 2 30.4 23.125 27.950000000000003 18.525 3 31.55 24.45 23.724999999999998 20.275000000000002 4 27.625 29.849999999999998 16.875 25.650000000000002 5 30.325000000000003 30.125 19.0 20.549999999999997 6 21.746746746746748 35.18518518518518 16.691691691691695 26.376376376376378 7 21.056584877315974 13.144717075613421 38.958437656484726 26.84026039058588 8 22.895791583166332 18.537074148296593 22.970941883767534 35.59619238476954 9 24.473947895791586 18.48697394789579 26.302605210420843 30.736472945891784 10-11 27.57670632435817 26.762680025046965 19.010644959298684 26.649968691296184 12-13 24.65856408971307 21.175291316877583 26.650795639644155 27.51534895376519 14-15 26.265030060120242 22.607715430861724 23.70991983967936 27.41733466933868 16-17 25.925925925925924 23.56106106106106 23.586086086086087 26.926926926926924 18-19 26.294721040780583 23.642732049036777 23.817863397548162 26.244683512634477 20-21 26.725862931465734 23.06153076538269 22.961480740370185 27.251125562781393 22-23 25.963945918878316 23.73560340510766 23.635453179769655 26.664997496244368 24-25 26.50043854153615 24.37037965167272 22.67886229795765 26.45031950883348 26-27 27.1039759187257 23.479242443245955 22.651448639157156 26.765332998871187 28-29 27.51753507014028 23.471943887775552 22.50751503006012 26.50300601202405 30-31 26.57815631262525 23.233967935871743 23.10871743486974 27.07915831663327 32-33 28.1136562773814 23.95794217048442 22.293153085492552 25.63524846664163 34-35 26.882124514593514 23.286984842790933 22.823499937366904 27.007390705248653 36-37 26.993480441323968 24.611334002006018 22.003510531594785 26.391675025075223 38-39 27.44926083688299 23.941368078175895 21.648709596592333 26.960661488348787 40-41 26.857071276462484 23.788049605411498 22.22222222222222 27.132656895903796 42-43 27.147508139243676 23.779113448534936 22.539444027047335 26.533934385174057 44-45 28.01152016028049 23.40345604808415 22.752316553969447 25.832707237665915 46-47 26.97318967677274 24.21698822350288 22.425457278877474 26.384364820846905 48-49 26.43447757454272 24.21698822350288 22.149837133550488 27.19869706840391 50-51 27.329659318637272 23.885270541082164 22.257014028056112 26.528056112224448 52-53 27.06295460245799 23.47629796839729 21.682969651366943 27.77777777777778 54-55 26.902344239689107 23.981446659145043 22.439513601604613 26.676695499561237 56-57 27.23175159634406 23.337924126705897 22.248654062852136 27.18167021409791 58-59 27.106318956870613 23.332497492477433 22.454864593781345 27.106318956870613 60-61 26.88306805364081 23.33625767640055 22.897606216317833 26.88306805364081 62-63 26.134369516169464 23.677613436951617 23.276510403609926 26.91150664326899 64-65 27.05926670015068 22.5891511803114 22.852837769964843 27.49874434957308 66-67 27.27386934673367 22.851758793969847 22.27386934673367 27.600502512562812 68-69 27.593569454910828 22.55714644561668 22.368751569957297 27.480532529515195 70-71 27.43029389600603 22.481788495352927 22.921376538558153 27.166541070082893 72-73 26.99748743718593 23.178391959798994 22.62562814070352 27.198492462311556 74-75 27.28413654618474 22.565261044176708 22.766064257028113 27.384538152610443 76-77 27.5671604318353 23.035400451920662 22.508159678634197 26.889279437609844 78-79 27.097989949748747 23.354271356783922 22.261306532663315 27.28643216080402 80-81 27.65636774679729 22.883697563426274 23.059532780708363 26.400401909068073 82-83 26.884422110552762 22.92713567839196 23.040201005025125 27.14824120603015 84-85 26.514199547625033 22.995727569741142 23.18421713998492 27.305855742648905 86-87 27.279577995478522 22.73298166289877 22.305953278070838 27.681487063551874 88-89 26.531893520843795 22.965846308387743 23.10396785534907 27.398292315419386 90-91 27.670268911786884 22.744408142749435 22.995727569741142 26.589595375722542 92-93 27.769404672192916 22.532027128862094 22.645064054257723 27.053504144687263 94-95 27.150571392691198 22.893381891247017 23.05663694587467 26.899409770187116 96-97 27.016179606170827 23.11551486266148 22.425686692587483 27.442618838580206 98-99 27.669720165641863 22.574978039904632 22.825950558413854 26.929351236039658 100-101 26.950087785302234 22.322548281916227 22.86180085277151 27.86556308001003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.0 26 2.0 27 1.5 28 2.0 29 3.5 30 5.0 31 8.5 32 9.5 33 10.5 34 15.0 35 19.0 36 25.0 37 39.5 38 54.5 39 71.0 40 88.5 41 102.5 42 111.0 43 126.0 44 125.0 45 117.5 46 145.5 47 166.5 48 164.0 49 155.5 50 156.0 51 136.5 52 122.5 53 129.5 54 125.5 55 110.5 56 91.0 57 86.5 58 84.5 59 84.0 60 83.5 61 90.5 62 90.0 63 74.5 64 70.0 65 82.0 66 94.0 67 93.5 68 91.5 69 86.5 70 79.0 71 65.0 72 50.5 73 44.5 74 45.0 75 36.5 76 28.0 77 24.5 78 18.5 79 15.0 80 9.5 81 6.5 82 3.5 83 1.5 84 1.0 85 2.5 86 2.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.15 8 0.2 9 0.2 10-11 0.1875 12-13 0.2375 14-15 0.2 16-17 0.1 18-19 0.075 20-21 0.05 22-23 0.15 24-25 0.2375 26-27 0.3375 28-29 0.2 30-31 0.2 32-33 0.13749999999999998 34-35 0.21250000000000002 36-37 0.3 38-39 0.22499999999999998 40-41 0.21250000000000002 42-43 0.17500000000000002 44-45 0.17500000000000002 46-47 0.22499999999999998 48-49 0.22499999999999998 50-51 0.2 52-53 0.325 54-55 0.2875 56-57 0.1625 58-59 0.3 60-61 0.2625 62-63 0.27499999999999997 64-65 0.44999999999999996 66-67 0.5 68-69 0.475 70-71 0.475 72-73 0.5 74-75 0.4 76-77 0.42500000000000004 78-79 0.5 80-81 0.475 82-83 0.5 84-85 0.525 86-87 0.475 88-89 0.44999999999999996 90-91 0.5001250312578145 92-93 0.45011252813203295 94-95 0.4251594347880455 96-97 0.175284837861525 98-99 0.16286644951140067 100-101 0.10022550739163118 >>END_MODULE >>Sequence Length Distribution warn #Length Count 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 2.0 96 5.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3991.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0125 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5515072 read2 length is 89-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515072_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 89-101 %GC 54 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.5215 33.0 33.0 33.0 6.0 33.0 2 28.575 33.0 33.0 33.0 6.0 33.0 3 28.47325 33.0 27.0 33.0 6.0 33.0 4 31.74025 37.0 33.0 37.0 6.0 37.0 5 31.72825 37.0 33.0 37.0 6.0 37.0 6 31.65125 37.0 33.0 37.0 6.0 37.0 7 31.8315 37.0 33.0 37.0 2.0 37.0 8 31.688 37.0 33.0 37.0 2.0 37.0 9 31.628 37.0 33.0 37.0 2.0 37.0 10-11 31.56325 37.0 33.0 37.0 2.0 37.0 12-13 31.414749999999998 37.0 33.0 37.0 2.0 37.0 14-15 32.708875 37.0 33.0 40.0 2.0 40.0 16-17 32.6345 37.0 33.0 40.0 2.0 40.0 18-19 32.450500000000005 37.0 33.0 40.0 2.0 40.0 20-21 32.4625 37.0 33.0 40.0 2.0 40.0 22-23 32.34725 37.0 33.0 40.0 2.0 40.0 24-25 32.2455 37.0 33.0 40.0 2.0 40.0 26-27 32.03175 37.0 33.0 40.0 2.0 40.0 28-29 31.79775 37.0 33.0 40.0 2.0 40.0 30-31 31.63075 37.0 33.0 40.0 2.0 40.0 32-33 31.356875000000002 37.0 33.0 40.0 2.0 40.0 34-35 31.1565 37.0 33.0 40.0 2.0 40.0 36-37 31.0885 37.0 33.0 40.0 2.0 40.0 38-39 30.80775 37.0 33.0 40.0 2.0 40.0 40-41 30.62725 37.0 33.0 40.0 2.0 40.0 42-43 30.244625 37.0 27.0 40.0 2.0 40.0 44-45 30.186875 37.0 27.0 40.0 2.0 40.0 46-47 30.186 37.0 27.0 40.0 2.0 40.0 48-49 30.28925 37.0 27.0 40.0 2.0 40.0 50-51 29.433 35.0 27.0 38.5 2.0 40.0 52-53 29.534375 37.0 27.0 37.0 2.0 40.0 54-55 29.95925 37.0 27.0 40.0 2.0 40.0 56-57 29.639875 37.0 27.0 38.5 2.0 40.0 58-59 29.516624999999998 37.0 27.0 37.0 2.0 40.0 60-61 29.369500000000002 37.0 27.0 37.0 2.0 40.0 62-63 29.19 37.0 27.0 37.0 2.0 40.0 64-65 28.987000000000002 37.0 27.0 37.0 2.0 40.0 66-67 28.928125 37.0 27.0 37.0 2.0 40.0 68-69 28.59125 37.0 27.0 37.0 2.0 38.5 70-71 28.267875 37.0 27.0 37.0 2.0 37.0 72-73 28.121875000000003 33.0 27.0 37.0 2.0 37.0 74-75 27.900750000000002 33.0 27.0 37.0 2.0 37.0 76-77 27.539375 33.0 22.0 37.0 2.0 37.0 78-79 27.475125 33.0 24.5 37.0 2.0 37.0 80-81 27.239875 33.0 22.0 37.0 2.0 37.0 82-83 27.054375 33.0 22.0 37.0 2.0 37.0 84-85 26.827125000000002 33.0 22.0 37.0 2.0 37.0 86-87 26.67525 33.0 22.0 37.0 2.0 37.0 88-89 26.568375 33.0 22.0 37.0 2.0 37.0 90-91 26.281320330082522 33.0 18.5 37.0 2.0 37.0 92-93 25.974993748437107 33.0 15.0 37.0 2.0 37.0 94-95 25.906582636154283 33.0 15.0 37.0 2.0 37.0 96-97 25.675557928268688 33.0 8.5 37.0 2.0 37.0 98-99 25.305088994735524 33.0 2.0 37.0 2.0 37.0 100-101 23.522812735021308 30.0 2.0 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 390.0 3 45.0 4 32.0 5 19.0 6 20.0 7 30.0 8 25.0 9 20.0 10 26.0 11 19.0 12 21.0 13 11.0 14 18.0 15 18.0 16 8.0 17 17.0 18 15.0 19 24.0 20 18.0 21 30.0 22 24.0 23 24.0 24 34.0 25 36.0 26 31.0 27 46.0 28 49.0 29 79.0 30 89.0 31 109.0 32 152.0 33 165.0 34 249.0 35 318.0 36 476.0 37 889.0 38 424.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.424999999999997 13.5 24.325 41.75 2 31.932983245811453 23.80595148787197 25.431357839459867 18.829707426856714 3 32.741370685342666 25.03751875937969 20.23511755877939 21.98599299649825 4 27.888944472236116 28.114057028514257 15.207603801900952 28.789394697348676 5 32.36618309154578 29.739869934967484 17.03351675837919 20.860430215107552 6 23.836918459229615 35.317658829414704 15.957978989494748 24.88744372186093 7 21.660830415207606 12.631315657828916 39.81990995497749 25.887943971985994 8 24.6558197747184 18.598247809762203 22.052565707133915 34.69336670838548 9 26.401401401401404 18.01801801801802 26.826826826826828 28.753753753753752 10-11 28.927275003129303 27.46276129678308 17.862060332957817 25.747903367129805 12-13 25.7450538442274 21.124467818682692 25.469571750563485 27.660906586526423 14-15 28.573216520650814 22.74092615769712 22.966207759699625 25.71964956195244 16-17 27.916875312969452 23.447671507260893 22.608913370055085 26.02653980971457 18-19 27.74161241862794 23.99849774661993 22.47120681021532 25.78868302453681 20-21 28.435544430538172 24.20525657071339 21.614518147684606 25.744680851063826 22-23 28.873591989987485 23.391739674593243 22.165206508135167 25.56946182728411 24-25 28.019021399073957 23.889375547490925 22.024777875109496 26.066825178325615 26-27 28.03457346862082 25.015658273831892 21.195039458850058 25.75472879869723 28-29 28.295980969074748 23.96394140478277 21.37222987354451 26.367847752597974 30-31 27.952410770194113 23.19348778960551 22.654978083907327 26.199123356293047 32-33 28.660904421896532 23.925842415132156 22.24727546035325 25.165977702618065 34-35 28.128516064508062 23.51543942992874 21.9777472184023 26.378297287160894 36-37 27.437499999999996 23.599999999999998 22.075 26.887499999999996 38-39 29.075 23.1875 21.9375 25.8 40-41 28.249999999999996 22.3 22.912499999999998 26.5375 42-43 27.187499999999996 23.2125 23.4125 26.187500000000004 44-45 29.599999999999998 22.5 22.0875 25.8125 46-47 27.55 23.35 22.225 26.875 48-49 27.0125 23.7125 22.6125 26.6625 50-51 28.299999999999997 22.875 22.7 26.125 52-53 28.287499999999998 23.5875 21.625 26.5 54-55 28.1375 23.575 21.6125 26.674999999999997 56-57 28.3875 23.05 21.837500000000002 26.724999999999998 58-59 28.3375 22.325 22.6875 26.650000000000002 60-61 27.762500000000003 23.025000000000002 22.4625 26.75 62-63 28.6125 23.849999999999998 21.4 26.137500000000003 64-65 28.95 23.0625 21.2375 26.75 66-67 28.199999999999996 23.1625 22.35 26.2875 68-69 28.225 23.05 21.75 26.974999999999998 70-71 28.3875 22.675 22.1875 26.75 72-73 28.449999999999996 23.325000000000003 21.525 26.700000000000003 74-75 28.512500000000003 23.825 21.5625 26.1 76-77 28.249999999999996 22.625 22.425 26.700000000000003 78-79 27.875 22.9625 22.35 26.8125 80-81 28.825 22.825 21.625 26.724999999999998 82-83 28.325 23.3875 21.637500000000003 26.650000000000002 84-85 28.15 24.4125 20.4875 26.950000000000003 86-87 27.9125 23.0375 22.575 26.474999999999998 88-89 28.9 21.8125 22.4375 26.85 90-91 28.319579894973746 22.168042010502624 22.330582645661416 27.181795448862218 92-93 28.382095523880967 23.23080770192548 22.093023255813954 26.294073518379594 94-95 27.810428910841566 22.72102038264349 22.295860947855445 27.172689758659494 96-97 28.18489289740699 23.286984842790933 22.435174746335964 26.092947513466115 98-99 28.515918776635747 22.87540737026824 22.023063424417145 26.58561042867887 100-101 28.02707445475057 23.451992980696918 22.186011531712207 26.33492103284031 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 2.5 28 3.0 29 3.5 30 6.0 31 5.5 32 9.0 33 13.5 34 15.5 35 22.0 36 29.5 37 33.5 38 51.0 39 69.5 40 74.0 41 83.0 42 103.0 43 108.0 44 128.5 45 160.5 46 163.5 47 154.0 48 138.0 49 129.0 50 133.5 51 139.0 52 138.0 53 121.0 54 106.0 55 111.0 56 100.0 57 93.0 58 91.5 59 87.0 60 92.0 61 89.0 62 86.5 63 88.0 64 93.0 65 94.5 66 85.0 67 78.0 68 73.5 69 74.5 70 80.0 71 68.5 72 54.0 73 52.0 74 44.5 75 33.0 76 28.0 77 25.0 78 22.0 79 14.5 80 13.5 81 14.0 82 6.5 83 4.0 84 6.0 85 5.5 86 2.5 87 2.0 88 0.5 89 1.5 90 3.5 91 2.5 92 1.0 93 2.0 94 2.0 95 1.5 96 3.5 97 4.0 98 2.0 99 4.5 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.125 9 0.1 10-11 0.13749999999999998 12-13 0.17500000000000002 14-15 0.125 16-17 0.15 18-19 0.15 20-21 0.125 22-23 0.125 24-25 0.11249999999999999 26-27 0.21250000000000002 28-29 0.1625 30-31 0.1875 32-33 0.21250000000000002 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 4.0 96 5.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3989.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57146458280816 98.75 2 0.3781194857574994 0.75 3 0.0 0.0 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 16 0.4 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0125 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698563 spots for SRR5515072.sra Written 698563 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra Read 698549 spots for SRR5515072.sra Written 698549 spots for SRR5515072.sra SRR ids: ['SRR5515072.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c4fcchuk SRR5515072.sra spots: 13970994 blocks: [[1, 698549], [698550, 1397098], [1397099, 2095647], [2095648, 2794196], [2794197, 3492745], [3492746, 4191294], [4191295, 4889843], [4889844, 5588392], [5588393, 6286941], [6286942, 6985490], [6985491, 7684039], [7684040, 8382588], [8382589, 9081137], [9081138, 9779686], [9779687, 10478235], [10478236, 11176784], [11176785, 11875333], [11875334, 12573882], [12573883, 13272431], [13272432, 13970994]] SRR5515072 file size 3347819 SRR5515072 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5515072 SRR5515072_1.fastq SRR5515072_2.fastq Input file: SRR5515072_1.fastq Paired file: SRR5515072_2.fastq trimmed: SRR5515072-trimmed-pair1.fastq, SRR5515072-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:12:46 2024 >> started Mon Dec 9 17:13:00 2024 >> done (13.599s) 13970994 read pairs processed; of these: 354248 ( 2.54%) short read pairs filtered out after trimming by size control 859431 ( 6.15%) empty read pairs filtered out after trimming by size control 12757315 (91.31%) read pairs available; of these: 3464579 (27.16%) trimmed read pairs available after processing 9292736 (72.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 292 0.00% 19 745 0.01% 20 1153 0.01% 21 1628 0.01% 22 1993 0.02% 23 2537 0.02% 24 3019 0.02% 25 3641 0.03% 26 4155 0.03% 27 4625 0.04% 28 4984 0.04% 29 5501 0.04% 30 6097 0.05% 31 6273 0.05% 32 6569 0.05% 33 6931 0.05% 34 7106 0.06% 35 7246 0.06% 36 7479 0.06% 37 7762 0.06% 38 7887 0.06% 39 8114 0.06% 40 8752 0.07% 41 8729 0.07% 42 8869 0.07% 43 9083 0.07% 44 9169 0.07% 45 9424 0.07% 46 9478 0.07% 47 9991 0.08% 48 11446 0.09% 49 10444 0.08% 50 10740 0.08% 51 10594 0.08% 52 10883 0.09% 53 11225 0.09% 54 11580 0.09% 55 12159 0.10% 56 12855 0.10% 57 14141 0.11% 58 14510 0.11% 59 21235 0.17% 60 27279 0.21% 61 28201 0.22% 62 29759 0.23% 63 29578 0.23% 64 30782 0.24% 65 31678 0.25% 66 33068 0.26% 67 34045 0.27% 68 33964 0.27% 69 33989 0.27% 70 34635 0.27% 71 33583 0.26% 72 32913 0.26% 73 33300 0.26% 74 32019 0.25% 75 34796 0.27% 76 28572 0.22% 77 33170 0.26% 78 36053 0.28% 79 38274 0.30% 80 40456 0.32% 81 42817 0.34% 82 45296 0.36% 83 45979 0.36% 84 46829 0.37% 85 49030 0.38% 86 51540 0.40% 87 54112 0.42% 88 53237 0.42% 89 57140 0.45% 90 61797 0.48% 91 68554 0.54% 92 76675 0.60% 93 92676 0.73% 94 96353 0.76% 95 113451 0.89% 96 135785 1.06% 97 170864 1.34% 98 257594 2.02% 99 323299 2.53% 100 642979 5.04% 101 9250150 72.51% 12757315 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=3.1 sequence=GCCGCCATCGCCAAGCTGCCGTCGCTGAGCCCATCCCCCCAGGTGGACGCGCTGTTCACGGAGCTGGTGACCGCGTGCGTGCCGCCGAGCCCCGTGGACGTGACGAAGCTGGGCCCGGAGGCGCAGAGGATGCGCGAGGAGCTGATCCGCCTCTGCTCCACCGCCGAGGGCCACCTGGAGGCGCACTACGCCGACAAGCTTGCCGCCTTCGACAACCCGCTGGACCACCTCGACTGCTTCCCCTACTACAGCAACTACATCAACCTGAGCAAGCTGGAGTACGACCTGCTCGCACGCTACATGCCTTCATCATCTGGCATCGAGCCGGCCCGCGTGGCGTTCGTGGGCTCCGGCCCGCTGCCGTTCACGTCGCTGGTCCTGGCGGCGCGCCACCTGCCCAACACGCTGTTCGACAACTACGACTGGAGCGAGTCGGCCAACGAGCGCGCCAGGAAGCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=370.56 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=27.0 sequence=CGCCGCCGCCACC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=3.1 sequence=GCCGCCATCGCCAAGCTGCCGTCGCTGAGCCCATCCCCCCAGGTGGACGCGCTGTTCACGGAGCTGGTGACCGCGTGCGTGCCGCCGAGCCCCGTGGACGTGACGAAGCTGGGCCCGGAGGCGCAGAGGATGCGCGAGGAGCTGATCCGCCTCTGCTCCACCGCCGAGGGCCACCTGGAGGCGCACTACGCCGACAAGCTTGCCGCCTTCGACAACCCGCTGGACCACCTCGACTGCTTCCCCTACTACAGCAACTACATCAACCTGAGCAAGCTGGAGTACGACCTGCTCGCACGCTACATGCCTTCATCATCTGGCATCGAGCCGGCCCGCGTGGCGTTCGTGGGCTCCGGCCCGCTGCCGTTCACGTCGCTGGTCCTGGCGGCGCGCCACCTGCCCAACACGCTGTTCGACAACTACGACTGGAGCGAGTCGGCCAACGAGCGCGCCAGGAAGCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=353.24 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=23.8 sequence=GGCGGCGGCGGAG SRR5515072 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:13:43 Started mapping on | Dec 09 17:13:43 Finished on | Dec 09 17:15:50 Mapping speed, Million of reads per hour | 361.62 Number of input reads | 12757315 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 11261974 Uniquely mapped reads % | 88.28% Average mapped length | 192.00 Number of splices: Total | 6213121 Number of splices: Annotated (sjdb) | 5948766 Number of splices: GT/AG | 6113408 Number of splices: GC/AG | 84911 Number of splices: AT/AC | 4197 Number of splices: Non-canonical | 10605 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.46 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 141818 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 11340 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.95% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1397627 1397627 1397627 N_multimapping 141818 141818 141818 N_noFeature 237347 5677714 5614391 N_ambiguous 232100 13943 14166 UnstrandedReadsAssigned:10792527 PositiveStrandReadsAssigned:5570317 NegativeStrandReadsAssigned:5633417 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5515072 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5515072-trimmed-pair1.fastq SRR5515072-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,757,315 reads, 11,096,457 reads pseudoaligned [quant] estimated average fragment length: 233.759 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR5515072.ke.tsv 35125 SRR5515072.se.tsv 88098 total ==> SRR5515072.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.442 0.0112536 0.00189007 PNS24247 1044 811.241 36.1222 5.26064 PNS24249 1928 1695.24 161.099 11.2273 PNS24246 1044 811.241 36.1222 5.26064 PNS24248 1044 811.241 36.1222 5.26064 PNS24244 1471 1238.24 65.5228 6.25175 PNS24243 293 62.9964 16 30.0068 KQK14069 1603 1370.24 7474.82 644.493 KQK14071 474 243.163 742.863 360.933 ==> SRR5515072.se.tsv <== BRADI_1g14170v3 8485 BRADI_1g53295v3 22 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 635 BRADI_1g74790v3 222 BRADI_1g09890v3 0 BRADI_1g77505v3 112 BRADI_1g48960v3 0 SRR5515072 completed mapping pipeline successfully