Starting /dee2/code/volunteer_pipeline.sh SRR5515073 current disk space = 1523791273984 free memory = 1583141696 SRR5515073 SRAfilesize 64fb1a1e43715371c1feec067dd16147 SRR5515073.sra SRR5515073.sra file validated SRR5515073 is paired end SRR5515073 is conventional basespace SRR5515073 read1 length is 89-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515073_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 89-101 %GC 53 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.2385 33.0 27.0 33.0 15.0 33.0 2 28.37025 33.0 27.0 33.0 15.0 33.0 3 25.96925 27.0 15.0 33.0 15.0 33.0 4 31.68575 37.0 33.0 37.0 15.0 37.0 5 32.67675 37.0 33.0 37.0 22.0 37.0 6 32.8395 37.0 33.0 37.0 15.0 37.0 7 33.0855 37.0 33.0 37.0 22.0 37.0 8 33.2175 37.0 33.0 37.0 22.0 37.0 9 33.10675 37.0 33.0 37.0 22.0 37.0 10-11 32.95975 37.0 33.0 37.0 15.0 37.0 12-13 32.802499999999995 37.0 33.0 37.0 15.0 37.0 14-15 34.2305 40.0 33.0 40.0 15.0 40.0 16-17 34.216125000000005 37.0 33.0 40.0 15.0 40.0 18-19 34.13675 40.0 33.0 40.0 15.0 40.0 20-21 34.063500000000005 38.5 33.0 40.0 15.0 40.0 22-23 33.870875 37.0 33.0 40.0 15.0 40.0 24-25 33.782375 37.0 33.0 40.0 15.0 40.0 26-27 33.614000000000004 37.0 33.0 40.0 15.0 40.0 28-29 33.414500000000004 37.0 33.0 40.0 10.5 40.0 30-31 33.144375 37.0 33.0 40.0 6.0 40.0 32-33 32.9285 37.0 33.0 40.0 6.0 40.0 34-35 32.806375 37.0 33.0 40.0 4.0 40.0 36-37 30.917749999999998 37.0 27.0 40.0 2.0 40.0 38-39 31.4635 37.0 33.0 40.0 2.0 40.0 40-41 31.559624999999997 37.0 33.0 40.0 2.0 40.0 42-43 31.3995 37.0 33.0 40.0 2.0 40.0 44-45 31.54775 37.0 33.0 40.0 2.0 40.0 46-47 31.376125000000002 37.0 33.0 40.0 2.0 40.0 48-49 31.471125 37.0 33.0 40.0 2.0 40.0 50-51 31.596249999999998 37.0 33.0 40.0 2.0 40.0 52-53 31.117625 37.0 33.0 40.0 2.0 40.0 54-55 30.856875000000002 37.0 33.0 38.5 2.0 40.0 56-57 30.70925 37.0 33.0 37.0 2.0 40.0 58-59 30.67175 37.0 30.0 37.0 2.0 40.0 60-61 30.499125 37.0 33.0 37.0 2.0 40.0 62-63 30.000500000000002 37.0 27.0 37.0 2.0 40.0 64-65 29.70225 37.0 27.0 37.0 2.0 40.0 66-67 29.57275 37.0 27.0 37.0 2.0 40.0 68-69 29.36575 37.0 27.0 37.0 2.0 38.5 70-71 28.984875 33.0 27.0 37.0 2.0 37.0 72-73 28.802 33.0 27.0 37.0 2.0 37.0 74-75 28.517375 33.0 27.0 37.0 2.0 37.0 76-77 27.1205 33.0 24.5 35.0 2.0 37.0 78-79 28.081375 33.0 27.0 37.0 2.0 37.0 80-81 28.215375 33.0 27.0 37.0 2.0 37.0 82-83 27.849 33.0 27.0 37.0 2.0 37.0 84-85 27.657249999999998 33.0 27.0 37.0 2.0 37.0 86-87 27.589750000000002 33.0 27.0 37.0 2.0 37.0 88-89 27.421999999999997 33.0 24.5 37.0 2.0 37.0 90-91 27.091654690242294 33.0 24.5 37.0 2.0 37.0 92-93 26.93670252689517 33.0 22.0 37.0 2.0 37.0 94-95 26.918781202980202 33.0 22.0 37.0 2.0 37.0 96-97 26.7229704805266 33.0 22.0 37.0 2.0 37.0 98-99 26.458030568779755 33.0 22.0 37.0 2.0 37.0 100-101 24.644951140065146 30.0 8.5 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 177.0 3 52.0 4 45.0 5 30.0 6 28.0 7 20.0 8 21.0 9 33.0 10 28.0 11 20.0 12 29.0 13 21.0 14 20.0 15 13.0 16 23.0 17 23.0 18 19.0 19 21.0 20 21.0 21 26.0 22 23.0 23 31.0 24 41.0 25 41.0 26 54.0 27 67.0 28 70.0 29 80.0 30 95.0 31 133.0 32 136.0 33 178.0 34 250.0 35 355.0 36 592.0 37 820.0 38 364.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.06906906906907 14.864864864864865 25.850850850850847 40.21521521521522 2 28.875 22.7 29.75 18.675 3 30.55137844611529 24.285714285714285 24.360902255639097 20.80200501253133 4 27.33866933466733 28.414207103551774 16.933466733366682 27.313656828414207 5 30.511022044088175 30.736472945891784 18.061122244488978 20.691382765531063 6 21.134538152610443 34.61345381526104 17.570281124497992 26.68172690763052 7 22.52004008016032 13.201402805611224 40.606212424849694 23.672344689378757 8 23.69146005509642 17.380415727523165 22.890057600801402 36.03806661657901 9 23.778501628664493 19.318466549736907 25.281884239538964 31.621147582059635 10-11 27.025673137132124 27.701941139636823 18.409517845961176 26.86286787726988 12-13 24.611917876815223 22.108162243365047 26.352028042063097 26.927891837756633 14-15 25.894868585732166 23.566958698372968 23.391739674593243 27.146433041301627 16-17 27.31371321227301 22.8428303068253 24.05760801502818 25.785848465873514 18-19 26.02034409142283 24.098957679266608 23.64686675875926 26.2338314705513 20-21 26.88980819857089 24.13187915256362 22.677698382850693 26.300614266014794 22-23 25.2442996742671 24.743172137308946 23.465296918065647 26.547231270358306 24-25 26.65832290362954 24.680851063829788 22.753441802252816 25.90738423028786 26-27 26.956303993990232 23.613371729059722 22.461499937398273 26.968824339551773 28-29 26.245306633291616 23.9549436795995 22.51564455569462 27.284105131414265 30-31 27.083854818523157 23.917396745932415 23.44180225281602 25.556946182728414 32-33 27.88485607008761 23.779724655819777 22.102628285356694 26.23279098873592 34-35 26.90863579474343 24.60575719649562 21.389236545682103 27.096370463078852 36-37 27.478718077115673 24.073610415623435 22.44616925388082 26.00150225338007 38-39 27.387658029790963 23.457253723870323 22.781324320941295 26.37376392539742 40-41 26.84941794968081 24.02052822631118 21.629740893728876 27.500312930279136 42-43 26.645807259073845 24.893617021276597 23.066332916145182 25.39424280350438 44-45 27.684605757196497 23.9549436795995 21.414267834793492 26.946182728410513 46-47 27.659574468085108 23.67959949937422 22.891113892365457 25.769712140175223 48-49 27.40360540811217 23.397596394591886 23.43515272909364 25.763645468202302 50-51 27.144109177413295 23.650932765744333 22.586703393013646 26.618254663828722 52-53 27.538230132865383 23.063424417147154 22.273752820255705 27.124592629731765 54-55 27.173503951825367 23.472588131978423 22.795132354786098 26.558775561410116 56-57 27.811169546706736 23.716503881793138 22.389181066867017 26.08314550463311 58-59 27.331914360836358 23.337924126705897 22.37385751846751 26.956303993990232 60-61 27.51971954425942 23.22524101665206 23.237761362213597 26.017278076874923 62-63 28.663222880181426 22.779387677963967 22.237621267481416 26.319768174373188 64-65 26.794076699152008 23.389444374129855 22.427540817618024 27.388938109100113 66-67 27.03900709219858 23.27760891590679 22.530395136778115 27.152988855116515 68-69 27.666034155597725 24.50347881087919 21.808981657179 26.021505376344084 70-71 27.41444866920152 23.130544993662863 22.991128010139416 26.4638783269962 72-73 27.547790859602483 23.002911760982403 22.534498037726294 26.914799341688823 74-75 27.074125520899106 23.828766258365956 22.363934840257606 26.733173380477332 76-77 27.10668849981106 22.294999370197758 22.94999370197758 27.648318428013603 78-79 26.47763074984247 23.906742281033395 22.75992438563327 26.855702583490864 80-81 27.72577789020997 23.3999494055148 21.99595244118391 26.87832026309132 82-83 28.128573243552278 22.576546817431076 22.525727353576418 26.769152585440224 84-85 27.39638952453598 22.84515636918383 23.366386981947624 26.39206712433257 86-87 27.51202227284232 23.55099974689952 22.33611743862313 26.60086054163503 88-89 27.160650737163195 22.91560752414845 22.73767158108795 27.186070157600405 90-91 26.945649400357237 23.730543505996426 22.697116611380455 26.626690482265886 92-93 28.551389951542973 23.119102269829124 21.308339709257844 27.02116806937006 94-95 27.44227353463588 22.430855112915506 22.139051002283686 27.98782035016493 96-97 27.295629172439856 22.57211235671999 22.370575639249278 27.76168283159088 98-99 27.20883534136546 23.01706827309237 22.439759036144576 27.334337349397593 100-101 27.46770349931017 22.46331368368243 22.40060203185752 27.668380785149882 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 2.0 4 1.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 3.0 27 3.0 28 4.0 29 6.0 30 6.0 31 11.5 32 14.5 33 17.5 34 23.0 35 29.0 36 36.0 37 43.0 38 52.5 39 64.0 40 79.0 41 95.0 42 110.5 43 129.0 44 142.0 45 142.0 46 144.0 47 144.0 48 151.0 49 143.5 50 134.5 51 132.0 52 121.0 53 118.0 54 118.0 55 119.5 56 112.0 57 98.0 58 91.0 59 88.5 60 85.5 61 87.5 62 95.0 63 87.5 64 75.0 65 84.0 66 78.0 67 76.0 68 85.0 69 79.0 70 74.5 71 60.5 72 43.5 73 43.5 74 45.0 75 36.5 76 25.5 77 20.5 78 19.0 79 14.0 80 9.5 81 9.0 82 5.5 83 3.5 84 4.5 85 3.5 86 3.0 87 2.5 88 1.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.25 4 0.05 5 0.2 6 0.4 7 0.2 8 0.17500000000000002 9 0.22499999999999998 10-11 0.1875 12-13 0.15 14-15 0.125 16-17 0.1875 18-19 0.46249999999999997 20-21 0.2875 22-23 0.22499999999999998 24-25 0.125 26-27 0.1625 28-29 0.125 30-31 0.125 32-33 0.125 34-35 0.125 36-37 0.15 38-39 0.13749999999999998 40-41 0.13749999999999998 42-43 0.125 44-45 0.125 46-47 0.125 48-49 0.15 50-51 0.1625 52-53 0.27499999999999997 54-55 0.36250000000000004 56-57 0.17500000000000002 58-59 0.1625 60-61 0.1625 62-63 0.7875 64-65 1.2375 66-67 1.3 68-69 1.1875 70-71 1.375 72-73 1.2625000000000002 74-75 1.0125 76-77 0.7625 78-79 0.8125 80-81 1.175 82-83 1.6125 84-85 1.675 86-87 1.225 88-89 1.6500000000000001 90-91 1.963727329580988 92-93 1.901426069552164 94-95 1.3640345388562132 96-97 0.5760801502817783 98-99 0.17539463793535454 100-101 0.11275369581558506 >>END_MODULE >>Sequence Length Distribution warn #Length Count 89 2.0 90 1.0 91 0.0 92 0.0 93 1.0 94 1.0 95 1.0 96 3.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3991.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5515073 read2 length is 89-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515073_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 89-101 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.58825 33.0 27.0 33.0 15.0 33.0 2 28.52075 33.0 27.0 33.0 15.0 33.0 3 28.55475 33.0 27.0 33.0 15.0 33.0 4 31.762 37.0 33.0 37.0 15.0 37.0 5 31.53475 37.0 33.0 37.0 15.0 37.0 6 31.6215 37.0 33.0 37.0 6.0 37.0 7 31.599 37.0 33.0 37.0 6.0 37.0 8 31.572 37.0 33.0 37.0 2.0 37.0 9 31.4575 37.0 33.0 37.0 2.0 37.0 10-11 31.31125 37.0 33.0 37.0 2.0 37.0 12-13 31.0875 37.0 33.0 37.0 2.0 37.0 14-15 32.361125 37.0 33.0 40.0 2.0 40.0 16-17 32.154875000000004 37.0 33.0 40.0 2.0 40.0 18-19 32.026375 37.0 33.0 40.0 2.0 40.0 20-21 31.90525 37.0 33.0 40.0 2.0 40.0 22-23 31.651875 37.0 33.0 40.0 2.0 40.0 24-25 31.6815 37.0 33.0 40.0 2.0 40.0 26-27 31.285249999999998 37.0 33.0 40.0 2.0 40.0 28-29 31.31425 37.0 33.0 40.0 2.0 40.0 30-31 31.064375 37.0 33.0 40.0 2.0 40.0 32-33 30.6335 37.0 33.0 40.0 2.0 40.0 34-35 30.637875 37.0 30.0 40.0 2.0 40.0 36-37 30.181874999999998 37.0 27.0 40.0 2.0 40.0 38-39 29.95375 37.0 27.0 40.0 2.0 40.0 40-41 29.601374999999997 37.0 27.0 40.0 2.0 40.0 42-43 29.269 37.0 27.0 40.0 2.0 40.0 44-45 28.959 37.0 22.0 40.0 2.0 40.0 46-47 29.134 37.0 27.0 40.0 2.0 40.0 48-49 29.078625000000002 37.0 27.0 40.0 2.0 40.0 50-51 28.20525 35.0 22.0 38.5 2.0 38.5 52-53 28.4405 35.0 24.5 37.0 2.0 40.0 54-55 28.7 37.0 27.0 37.0 2.0 40.0 56-57 28.61825 37.0 24.5 37.0 2.0 40.0 58-59 28.393375 37.0 27.0 37.0 2.0 40.0 60-61 28.102375 37.0 22.0 37.0 2.0 40.0 62-63 28.018250000000002 37.0 22.0 37.0 2.0 40.0 64-65 27.853625 37.0 22.0 37.0 2.0 40.0 66-67 27.58925 33.0 22.0 37.0 2.0 40.0 68-69 27.274 33.0 22.0 37.0 2.0 37.0 70-71 27.012999999999998 33.0 22.0 37.0 2.0 37.0 72-73 26.640625 33.0 15.0 37.0 2.0 37.0 74-75 26.420625 33.0 15.0 37.0 2.0 37.0 76-77 26.453125 33.0 22.0 37.0 2.0 37.0 78-79 26.343 33.0 18.5 37.0 2.0 37.0 80-81 26.048125 33.0 15.0 37.0 2.0 37.0 82-83 25.881375 33.0 15.0 37.0 2.0 37.0 84-85 25.661625 33.0 10.5 37.0 2.0 37.0 86-87 25.4595 33.0 6.0 37.0 2.0 37.0 88-89 25.228875000000002 33.0 2.0 37.0 2.0 37.0 90-91 25.037774735503852 33.0 2.0 37.0 2.0 37.0 92-93 24.89967475606705 33.0 2.0 37.0 2.0 37.0 94-95 24.58479697017366 33.0 2.0 37.0 2.0 37.0 96-97 24.276859409888026 33.0 2.0 37.0 2.0 37.0 98-99 23.95408931259408 33.0 2.0 37.0 2.0 37.0 100-101 22.431259407927747 30.0 2.0 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 340.0 3 69.0 4 31.0 5 24.0 6 35.0 7 29.0 8 28.0 9 38.0 10 28.0 11 24.0 12 23.0 13 35.0 14 66.0 15 25.0 16 18.0 17 19.0 18 24.0 19 26.0 20 28.0 21 26.0 22 40.0 23 31.0 24 28.0 25 48.0 26 39.0 27 58.0 28 70.0 29 65.0 30 92.0 31 123.0 32 141.0 33 160.0 34 255.0 35 313.0 36 469.0 37 781.0 38 350.0 39 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.112455874936966 14.296520423600606 26.70196671709531 39.88905698436712 2 29.715436917652983 22.13548224628557 28.355577940065473 19.79350289599597 3 30.658953722334005 24.974849094567407 21.277665995975855 23.088531187122737 4 28.160484481453445 28.160484481453445 14.837244511733536 28.841786525359574 5 30.306841046277665 29.95472837022133 17.982897384305836 21.75553319919517 6 21.49886449659349 35.7809740095887 16.527882916982083 26.192278576835733 7 21.08327005821311 13.33839534295115 40.344216654011646 25.234117944824096 8 23.29531051964512 18.681875792141952 22.00253485424588 36.02027883396705 9 24.645030425963487 20.36004056795132 25.557809330628807 29.43711967545639 10-11 26.384654471544717 27.693089430894307 18.34349593495935 27.57876016260163 12-13 24.273200457026785 21.20096483432779 26.444077694553762 28.081757014091657 14-15 26.999872822078085 22.07808724405443 23.629657891390053 27.292382042477424 16-17 26.987367615158863 22.751052698736764 23.363531963761645 26.89804772234273 18-19 26.39030612244898 23.95408163265306 23.035714285714285 26.619897959183675 20-21 26.9535240040858 24.01685393258427 21.884576098059245 27.145045965270686 22-23 27.297090352220522 24.48953547728433 22.434915773353755 25.778458397141396 24-25 27.458232368320367 24.55043999489861 21.757428899375082 26.23389873740594 26-27 27.529951567677795 23.97399949018608 21.539638032118276 26.95641091001784 28-29 27.234476603340557 23.575162565344893 22.338390921841132 26.851969909473418 30-31 26.541554959785525 24.74147836078131 22.86480275756415 25.852163921869014 32-33 27.268061080456818 23.225972026177338 22.610034646477608 26.895932246888233 34-35 26.634928589325984 24.07917815083939 22.70107742420446 26.584815835630167 36-37 26.47919582644102 24.990456801119734 21.87301183356661 26.65733553887263 38-39 26.463461293202396 24.0403009820176 22.331335288866217 27.164902435913785 40-41 27.035664067493286 23.814393455196218 22.306020708168223 26.84392176914227 42-43 26.784570037165196 24.29834678969627 22.760476739715493 26.15660643342304 44-45 28.067700987306065 23.695345557122707 21.784844210796255 26.452109244774967 46-47 26.704182120475767 22.637165877989514 22.944110500063946 27.714541501470773 48-49 27.429227237949505 23.32313185411885 23.119102269829124 26.128538638102526 50-51 27.1227621483376 23.618925831202045 22.39130434782609 26.86700767263427 52-53 26.715216558068228 23.252842723904433 22.5756995017248 27.45624121630254 54-55 27.031170158405722 23.696985181400102 22.687787429739398 26.58405723045478 56-57 27.694267515923563 23.21019108280255 22.764331210191084 26.331210191082803 58-59 27.055973479535893 23.29465765650899 22.963151855157466 26.68621700879765 60-61 26.823049464558903 23.90362060173381 22.488526262111165 26.784803671596123 62-63 28.2580974241265 24.356031624585565 22.00969140525376 25.376179546034177 64-65 27.321360336262895 23.907782448095784 21.99719780919628 26.773659406445038 66-67 27.37366003062787 23.468606431852987 22.56253190403267 26.59520163348647 68-69 26.560697346494038 23.381617741315218 23.355980002563772 26.701704909626972 70-71 26.21359223300971 23.377618804292283 22.917731221257025 27.491057741440983 72-73 26.60773763771458 23.417883679221113 22.89264668203946 27.081732001024854 74-75 26.893117098710256 23.70067679734389 22.819563274166775 26.586642829779084 76-77 26.957408824279522 22.991583779648046 22.749298648304002 27.301708747768426 78-79 27.41873804971319 23.82409177820268 22.574888463989804 26.18228170809433 80-81 26.639448838989537 22.799183465169687 23.271242663944882 27.29012503189589 82-83 26.459342340045882 23.65536579148611 22.686719347438185 27.198572521029824 84-85 26.51863195507912 23.9152628892292 22.447677386421645 27.11842776927004 86-87 27.26340087201847 22.92895614260067 22.646832521159272 27.160810464221598 88-89 27.49198203976908 23.181526619627967 22.604233483001924 26.72225785760103 90-91 27.873268342739866 23.114417650076962 22.524371472550026 26.487942534633145 92-93 27.104722792607806 23.562628336755647 21.701745379876797 27.630903490759756 94-95 27.734324913450443 23.900500064110783 21.887421464290295 26.477753558148482 96-97 27.64675724173289 23.58369648807998 21.96872596770059 26.800820302486546 98-99 27.226202661207775 22.466734902763562 22.799385875127943 27.50767656090072 100-101 28.25864276568502 22.880921895006402 22.125480153649168 26.73495518565941 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 2.0 13 2.5 14 4.5 15 4.0 16 3.0 17 9.5 18 10.5 19 6.0 20 7.0 21 8.5 22 6.0 23 5.0 24 4.5 25 3.0 26 6.0 27 8.0 28 9.5 29 13.0 30 11.0 31 10.0 32 16.5 33 18.5 34 19.0 35 22.5 36 29.5 37 45.0 38 52.5 39 54.5 40 67.0 41 90.0 42 113.5 43 127.5 44 140.0 45 153.0 46 145.5 47 134.0 48 148.0 49 152.0 50 152.0 51 152.5 52 122.0 53 100.0 54 100.0 55 103.0 56 96.0 57 85.5 58 95.0 59 93.0 60 78.5 61 87.5 62 84.0 63 76.0 64 78.5 65 82.0 66 90.0 67 81.5 68 69.0 69 72.0 70 82.0 71 74.0 72 53.0 73 40.5 74 38.5 75 29.5 76 22.0 77 25.5 78 21.0 79 14.5 80 11.5 81 9.5 82 5.5 83 2.0 84 2.0 85 1.0 86 1.5 87 1.5 88 0.5 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.7250000000000001 3 0.6 4 0.9249999999999999 5 0.6 6 0.9249999999999999 7 1.225 8 1.375 9 1.4000000000000001 10-11 1.6 12-13 1.5375 14-15 1.7125000000000001 16-17 2.0375 18-19 2.0 20-21 2.1 22-23 2.0500000000000003 24-25 1.9875 26-27 1.925 28-29 1.9625 30-31 2.0875 32-33 2.5875 34-35 0.22499999999999998 36-37 1.7624999999999997 38-39 1.9875 40-41 2.2125 42-43 2.4625 44-45 2.5125 46-47 2.2624999999999997 48-49 1.975 50-51 2.25 52-53 2.1624999999999996 54-55 2.15 56-57 1.875 58-59 1.9625 60-61 1.95 62-63 1.975 64-65 1.8624999999999998 66-67 2.0500000000000003 68-69 2.4875000000000003 70-71 2.15 72-73 2.4250000000000003 74-75 2.1125000000000003 76-77 1.975 78-79 1.9375 80-81 2.025 82-83 1.925 84-85 2.0500000000000003 86-87 2.5250000000000004 88-89 2.5625 90-91 2.489055659787367 92-93 2.5268951713785337 94-95 2.3782701214169486 96-97 2.218323098132598 98-99 1.9568489713998998 100-101 2.032112393376819 >>END_MODULE >>Sequence Length Distribution warn #Length Count 89 2.0 90 1.0 91 0.0 92 0.0 93 2.0 94 1.0 95 1.0 96 7.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3986.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497437 spots for SRR5515073.sra Written 497437 spots for SRR5515073.sra Read 497440 spots for SRR5515073.sra Written 497440 spots for SRR5515073.sra SRR ids: ['SRR5515073.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vj5omii9 SRR5515073.sra spots: 9948743 blocks: [[1, 497437], [497438, 994874], [994875, 1492311], [1492312, 1989748], [1989749, 2487185], [2487186, 2984622], [2984623, 3482059], [3482060, 3979496], [3979497, 4476933], [4476934, 4974370], [4974371, 5471807], [5471808, 5969244], [5969245, 6466681], [6466682, 6964118], [6964119, 7461555], [7461556, 7958992], [7958993, 8456429], [8456430, 8953866], [8953867, 9451303], [9451304, 9948743]] SRR5515073 file size 2377806 SRR5515073 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5515073 SRR5515073_1.fastq SRR5515073_2.fastq Input file: SRR5515073_1.fastq Paired file: SRR5515073_2.fastq trimmed: SRR5515073-trimmed-pair1.fastq, SRR5515073-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:13:06 2024 >> started Mon Dec 9 17:13:16 2024 >> done (10.207s) 9948743 read pairs processed; of these: 250831 ( 2.52%) short read pairs filtered out after trimming by size control 570850 ( 5.74%) empty read pairs filtered out after trimming by size control 9127062 (91.74%) read pairs available; of these: 2462654 (26.98%) trimmed read pairs available after processing 6664408 (73.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 207 0.00% 19 502 0.01% 20 815 0.01% 21 1127 0.01% 22 1490 0.02% 23 1828 0.02% 24 2164 0.02% 25 2556 0.03% 26 3018 0.03% 27 3295 0.04% 28 3657 0.04% 29 3929 0.04% 30 4312 0.05% 31 4484 0.05% 32 4771 0.05% 33 4887 0.05% 34 5082 0.06% 35 5325 0.06% 36 5280 0.06% 37 5616 0.06% 38 5709 0.06% 39 5923 0.06% 40 6153 0.07% 41 6243 0.07% 42 6308 0.07% 43 6479 0.07% 44 6627 0.07% 45 6571 0.07% 46 6759 0.07% 47 7219 0.08% 48 8278 0.09% 49 7680 0.08% 50 7643 0.08% 51 7587 0.08% 52 7839 0.09% 53 8061 0.09% 54 8385 0.09% 55 8531 0.09% 56 9025 0.10% 57 10298 0.11% 58 10192 0.11% 59 15480 0.17% 60 19765 0.22% 61 20230 0.22% 62 21471 0.24% 63 21279 0.23% 64 21675 0.24% 65 22697 0.25% 66 23383 0.26% 67 24300 0.27% 68 24397 0.27% 69 24193 0.27% 70 24811 0.27% 71 24240 0.27% 72 23695 0.26% 73 23182 0.25% 74 22735 0.25% 75 24851 0.27% 76 20202 0.22% 77 23502 0.26% 78 25521 0.28% 79 27027 0.30% 80 28513 0.31% 81 30187 0.33% 82 32079 0.35% 83 32915 0.36% 84 33090 0.36% 85 34749 0.38% 86 36573 0.40% 87 38401 0.42% 88 37655 0.41% 89 40330 0.44% 90 43608 0.48% 91 48460 0.53% 92 54680 0.60% 93 65532 0.72% 94 67831 0.74% 95 80484 0.88% 96 95378 1.05% 97 120077 1.32% 98 181626 1.99% 99 228908 2.51% 100 462539 5.07% 101 6632956 72.67% 9127062 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=3.1 sequence=GCCGCCATCGCCAAGCTGCCGTCGCTGAGCCCATCCCCCCAGGTGGACGCGCTGTTCACGGAGCTGGTGACCGCGTGCGTGCCGCCGAGCCCCGTGGACGTGACGAAGCTGGGCCCGGAGGCGCAGAGGATGCGCGAGGAGCTGATCCGCCTCTGCTCCACCGCCGAGGGCCACCTGGAGGCGCACTACGCCGACAAGCTTGCCGCCTTCGACAACCCGCTGGACCACCTCGACTGCTTCCCCTACTACAGCAACTACATCAACCTGAGCAAGCTGGAGTACGACCTGCTCGCACGCTACATGCCTTCATCATCTGGCATCGAGCCGGCCCGCGTGGCGTTCGTGGGCTCCGGCCCGCTGCCGTTCACGTCGCTGGTCCTGGCGGCGCGCCACCTGCCCAACACGCTGTTCGACAACTACGACTGGAGCGAGTCGGCCAACGAGCGCGCCAGGAAGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=398.46 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=26.6 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=3.0 sequence=GCCGCCATCGCCAAGCTGCCGTCGCTGAGCCCATCCCCCCAGGTGGACGCGCTGTTCACGGAGCTGGTGACCGCGTGCGTGCCGCCGAGCCCCGTGGACGTGACGAAGCTGGGCCCGGAGGCGCAGAGGATGCGCGAGGAGCTGATCCGCCTCTGCTCCACCGCCGAGGGCCACCTGGAGGCGCACTACGCCGACAAGCTTGCCGCCTTCGACAACCCGCTGGACCACCTCGACTGCTTCCCCTACTACAGCAACTACATCAACCTGAGCAAGCTGGAGTACGACCTGCTCGCACGCTACATGCCTTCATCATCTGGCATCGAGCCGGCCCGCGTGGCGTTCGTGGGCTCCGGCCCGCTGCCGTTCACGTCGCTGGTCCTGGCGGCGCGCCACCTGCCCAACACGCTGTTCGACAACTACGACTGGAGCGAGTCGGCCAACGAGCGCGCCAGGAAGCT criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=387.74 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=27.7 sequence=GCGGCGGCGGAG SRR5515073 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:13:59 Started mapping on | Dec 09 17:13:59 Finished on | Dec 09 17:16:03 Mapping speed, Million of reads per hour | 264.98 Number of input reads | 9127062 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 7742389 Uniquely mapped reads % | 84.83% Average mapped length | 191.91 Number of splices: Total | 4199663 Number of splices: Annotated (sjdb) | 4018890 Number of splices: GT/AG | 4132231 Number of splices: GC/AG | 56619 Number of splices: AT/AC | 2921 Number of splices: Non-canonical | 7892 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.43 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101222 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 37134 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.20% % of reads unmapped: other | 3.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1313575 1313575 1313575 N_multimapping 101222 101222 101222 N_noFeature 174053 3908977 3862145 N_ambiguous 164259 10608 10807 UnstrandedReadsAssigned:7404077 PositiveStrandReadsAssigned:3822804 NegativeStrandReadsAssigned:3869437 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5515073 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5515073-trimmed-pair1.fastq SRR5515073-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,127,062 reads, 7,710,879 reads pseudoaligned [quant] estimated average fragment length: 238.506 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52973 SRR5515073.ke.tsv 35125 SRR5515073.se.tsv 88098 total ==> SRR5515073.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.731 16.2991 3.96415 PNS24247 1044 806.494 28.5949 6.02537 PNS24249 1928 1690.49 90.3657 9.08419 PNS24246 1044 806.494 28.5949 6.02537 PNS24248 1044 806.494 28.5949 6.02537 PNS24244 1471 1233.49 86.5504 11.9242 PNS24243 293 58.1432 3 8.76835 KQK14069 1603 1365.49 5401.32 672.212 KQK14071 474 238.266 503.924 359.417 ==> SRR5515073.se.tsv <== BRADI_1g14170v3 6119 BRADI_1g53295v3 26 BRADI_1g59795v3 72 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 435 BRADI_1g74790v3 166 BRADI_1g09890v3 0 BRADI_1g77505v3 70 BRADI_1g48960v3 0 SRR5515073 completed mapping pipeline successfully