Starting /dee2/code/volunteer_pipeline.sh SRR5515074 current disk space = 1523787718656 free memory = 1580623288 SRR5515074 SRAfilesize 3fafe578aab0d45ce7515747e6ce087f SRR5515074.sra SRR5515074.sra file validated SRR5515074 is paired end SRR5515074 is conventional basespace SRR5515074 read1 length is 90-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515074_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90-101 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.99375 33.0 27.0 33.0 15.0 33.0 2 29.009 33.0 27.0 33.0 15.0 33.0 3 27.4915 33.0 27.0 33.0 15.0 33.0 4 32.42875 37.0 33.0 37.0 15.0 37.0 5 32.9535 37.0 33.0 37.0 22.0 37.0 6 33.16675 37.0 33.0 37.0 22.0 37.0 7 33.3235 37.0 33.0 37.0 27.0 37.0 8 33.2685 37.0 37.0 37.0 22.0 37.0 9 33.26175 37.0 37.0 37.0 22.0 37.0 10-11 33.186 37.0 37.0 37.0 22.0 37.0 12-13 32.940749999999994 37.0 35.0 37.0 15.0 37.0 14-15 34.507125 40.0 35.0 40.0 22.0 40.0 16-17 34.47675 40.0 35.0 40.0 18.5 40.0 18-19 34.456125 40.0 37.0 40.0 22.0 40.0 20-21 34.237 38.5 33.0 40.0 15.0 40.0 22-23 34.041375 37.0 33.0 40.0 15.0 40.0 24-25 33.859750000000005 37.0 33.0 40.0 15.0 40.0 26-27 33.613625 37.0 33.0 40.0 15.0 40.0 28-29 33.367999999999995 37.0 33.0 40.0 15.0 40.0 30-31 33.306 37.0 33.0 40.0 6.0 40.0 32-33 32.960125 37.0 33.0 40.0 6.0 40.0 34-35 32.914125 37.0 33.0 40.0 6.0 40.0 36-37 32.4675 37.0 33.0 40.0 2.0 40.0 38-39 32.389625 37.0 33.0 40.0 2.0 40.0 40-41 32.122 37.0 33.0 40.0 2.0 40.0 42-43 31.951125 37.0 33.0 40.0 2.0 40.0 44-45 31.705375 37.0 33.0 40.0 2.0 40.0 46-47 31.469625 37.0 33.0 40.0 2.0 40.0 48-49 31.435375 37.0 33.0 40.0 2.0 40.0 50-51 31.62875 37.0 33.0 40.0 2.0 40.0 52-53 31.261499999999998 37.0 33.0 40.0 2.0 40.0 54-55 30.997125 37.0 33.0 40.0 2.0 40.0 56-57 30.870625 37.0 33.0 37.0 2.0 40.0 58-59 30.6515 37.0 30.0 37.0 2.0 40.0 60-61 30.443624999999997 37.0 27.0 37.0 2.0 40.0 62-63 30.378 37.0 30.0 37.0 2.0 40.0 64-65 30.035875 37.0 27.0 37.0 2.0 40.0 66-67 29.817625 37.0 27.0 37.0 2.0 40.0 68-69 29.713 37.0 27.0 37.0 2.0 38.5 70-71 29.538249999999998 37.0 27.0 37.0 2.0 37.0 72-73 29.249875 35.0 27.0 37.0 2.0 37.0 74-75 28.884 33.0 27.0 37.0 2.0 37.0 76-77 20.216125 19.5 14.0 30.0 2.0 35.0 78-79 22.3245 24.5 15.0 30.0 2.0 35.0 80-81 27.072875 33.0 24.5 35.0 2.0 37.0 82-83 28.124625 33.0 27.0 37.0 2.0 37.0 84-85 28.185 33.0 27.0 37.0 2.0 37.0 86-87 28.19975 33.0 27.0 37.0 2.0 37.0 88-89 27.9785 33.0 27.0 37.0 2.0 37.0 90-91 27.967871936734184 33.0 27.0 37.0 2.0 37.0 92-93 27.779694923730933 33.0 27.0 37.0 2.0 37.0 94-95 27.586982226414683 33.0 27.0 37.0 2.0 37.0 96-97 27.094363169588846 33.0 24.5 37.0 2.0 37.0 98-99 26.897066198595788 33.0 22.0 37.0 2.0 37.0 100-101 25.145310932798395 33.0 18.5 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 173.0 3 62.0 4 25.0 5 26.0 6 33.0 7 25.0 8 33.0 9 28.0 10 21.0 11 21.0 12 19.0 13 18.0 14 20.0 15 14.0 16 14.0 17 21.0 18 23.0 19 25.0 20 25.0 21 16.0 22 23.0 23 30.0 24 26.0 25 38.0 26 50.0 27 64.0 28 75.0 29 88.0 30 106.0 31 121.0 32 177.0 33 195.0 34 278.0 35 401.0 36 666.0 37 853.0 38 167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.30457614403601 14.95373843460865 26.25656414103526 40.48512128032008 2 28.625 22.325 30.225 18.825 3 30.15 24.025 24.375 21.45 4 27.474999999999998 29.099999999999998 17.125 26.3 5 31.282820705176295 30.582645661415352 17.62940735183796 20.505126281570394 6 21.360680340170084 34.19209604802401 17.433716858429214 27.01350675337669 7 21.47147147147147 13.413413413413414 39.66466466466467 25.45045045045045 8 24.374374374374376 19.11911911911912 21.47147147147147 35.03503503503504 9 22.74774774774775 18.493493493493492 27.72772772772773 31.03103103103103 10-11 26.66082822469661 27.586638308519955 18.541223570624297 27.211309896159143 12-13 24.283389660783577 21.880085117035925 26.761797471523348 27.07472775065715 14-15 26.429733450131398 23.551495432361406 23.35127017895132 26.667500938555875 16-17 26.944236059014752 23.568392098024507 22.930732683170792 26.556639159789945 18-19 27.035138176816304 22.84606727522821 23.458797048893334 26.65999749906215 20-21 27.694423605901473 23.55588897224306 22.48062015503876 26.269067266816705 22-23 26.870152614460846 24.505879409557167 22.54190642982237 26.08206154615962 24-25 26.68335419274093 24.831038798498124 22.340425531914892 26.14518147684606 26-27 27.433295753476138 24.489540273080294 22.22222222222222 25.854941751221343 28-29 27.581028657239393 22.70053810536854 23.40132649230384 26.317106745088225 30-31 25.663495242864297 23.760640961442164 24.13620430645969 26.43965948923385 32-33 27.6172607879925 23.48968105065666 22.73921200750469 26.153846153846157 34-35 27.455887873858092 23.388812413965713 22.650481792016016 26.50481792016018 36-37 26.389584376564844 23.935903855783675 22.8592889334001 26.81522283425138 38-39 27.2090112640801 23.14142678347935 22.252816020025033 27.396745932415516 40-41 27.243148542109875 23.751720685771495 22.437742460267803 26.56738831185083 42-43 26.764264264264266 24.224224224224226 22.922922922922922 26.08858858858859 44-45 26.576576576576578 23.323323323323322 23.073073073073072 27.027027027027028 46-47 27.177177177177175 23.173173173173172 22.635135135135133 27.014514514514516 48-49 27.118007758728567 24.602678012764358 22.82567888874984 25.453635339757223 50-51 27.686725885149503 23.695733767046164 21.906668334792943 26.710872013011382 52-53 26.590681362725448 23.033567134268537 22.645290581162325 27.730460921843687 54-55 27.1099423991986 24.079639368895567 22.539444027047335 26.270974204858504 56-57 27.161266107844362 22.644814212435882 23.25785061929188 26.936069060427876 58-59 27.326236693800876 23.60676268002505 21.891045710707576 27.175954915466498 60-61 26.652478718077116 23.472709063595392 23.24737105658488 26.627441161742617 62-63 27.49248496993988 23.08366733466934 22.28206412825651 27.14178356713427 64-65 27.39468405215647 23.119358074222667 22.141424272818455 27.344533600802407 66-67 27.27956854383545 23.84297002383043 22.56365232660228 26.313809105731846 68-69 27.72066198595787 23.08174523570712 21.802908726178536 27.39468405215647 70-71 27.118856569709127 23.3074222668004 21.351554663991976 28.222166499498496 72-73 25.977933801404212 23.98445336008024 23.244734202607823 26.792878635907723 74-75 26.993480441323968 23.45787362086259 22.530090270812437 27.018555667001003 76-77 40.55917753259779 22.003510531594785 16.875626880641924 20.561685055165498 78-79 25.86833855799373 23.724137931034484 23.56112852664577 26.846394984326018 80-81 27.335423197492165 23.54858934169279 22.194357366771158 26.921630094043884 82-83 26.83385579937304 23.02194357366771 22.808777429467085 27.335423197492165 84-85 26.9660102847109 23.203311175216353 23.1029725322965 26.72770600777625 86-87 27.68652037617555 22.695924764890282 22.70846394984326 26.90909090909091 88-89 27.143931795386155 22.881143430290873 22.517552657973923 27.45737211634905 90-91 27.68652037617555 23.21003134796238 22.13166144200627 26.9717868338558 92-93 27.68439538384345 22.842448569994982 22.15253386853989 27.32062217762168 94-95 26.935139882072512 23.221678584870155 21.854221553130095 27.988959979927237 96-97 25.952858575727184 24.0346038114343 23.169508525576727 26.843029087261783 98-99 28.25050200803213 23.569277108433734 22.389558232931726 25.790662650602407 100-101 27.125658389766745 21.507399046902435 23.350890393779782 28.016052169551042 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.5 26 1.0 27 1.0 28 4.0 29 4.5 30 3.5 31 7.0 32 9.0 33 11.5 34 17.0 35 20.0 36 26.5 37 42.0 38 54.0 39 67.0 40 83.5 41 98.0 42 113.5 43 135.0 44 146.0 45 150.0 46 164.0 47 150.5 48 140.0 49 138.5 50 120.0 51 126.5 52 138.5 53 128.5 54 112.0 55 107.5 56 111.5 57 97.0 58 92.5 59 90.5 60 81.0 61 86.5 62 86.0 63 87.5 64 87.5 65 85.5 66 83.0 67 78.5 68 78.5 69 73.5 70 70.5 71 68.0 72 56.5 73 45.0 74 38.5 75 36.5 76 36.5 77 27.5 78 19.5 79 14.0 80 8.0 81 9.0 82 7.5 83 4.0 84 3.0 85 3.0 86 1.5 87 1.0 88 1.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.025 6 0.05 7 0.1 8 0.1 9 0.1 10-11 0.08750000000000001 12-13 0.13749999999999998 14-15 0.11249999999999999 16-17 0.025 18-19 0.0375 20-21 0.025 22-23 0.075 24-25 0.125 26-27 0.21250000000000002 28-29 0.11249999999999999 30-31 0.15 32-33 0.0625 34-35 0.11249999999999999 36-37 0.15 38-39 0.125 40-41 0.11249999999999999 42-43 0.1 44-45 0.1 46-47 0.1 48-49 0.11249999999999999 50-51 0.08750000000000001 52-53 0.2 54-55 0.17500000000000002 56-57 0.08750000000000001 58-59 0.1875 60-61 0.15 62-63 0.2 64-65 0.3 66-67 0.3375 68-69 0.3 70-71 0.3 72-73 0.3 74-75 0.3 76-77 0.3 78-79 0.3125 80-81 0.3125 82-83 0.3125 84-85 0.3375 86-87 0.3125 88-89 0.3 90-91 0.30003750468808604 92-93 0.3250812703175794 94-95 0.300187617260788 96-97 0.1002004008016032 98-99 0.10030090270812438 100-101 0.025075225677031094 >>END_MODULE >>Sequence Length Distribution warn #Length Count 90 1.0 91 0.0 92 0.0 93 1.0 94 1.0 95 1.0 96 8.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3988.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5515074 read2 length is 90-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515074_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 90-101 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.126 33.0 33.0 33.0 15.0 33.0 2 29.0985 33.0 33.0 33.0 15.0 33.0 3 29.06975 33.0 33.0 33.0 15.0 33.0 4 32.2705 37.0 33.0 37.0 15.0 37.0 5 32.0605 37.0 33.0 37.0 15.0 37.0 6 32.229 37.0 33.0 37.0 15.0 37.0 7 32.23425 37.0 33.0 37.0 15.0 37.0 8 32.30525 37.0 33.0 37.0 15.0 37.0 9 32.281 37.0 33.0 37.0 15.0 37.0 10-11 32.128875 37.0 33.0 37.0 15.0 37.0 12-13 31.844 37.0 33.0 37.0 15.0 37.0 14-15 33.286125 37.0 33.0 40.0 10.5 40.0 16-17 33.0 37.0 33.0 40.0 6.0 40.0 18-19 32.766000000000005 37.0 33.0 40.0 6.0 40.0 20-21 32.719125000000005 37.0 33.0 40.0 4.0 40.0 22-23 32.446 37.0 33.0 40.0 2.0 40.0 24-25 32.379625 37.0 33.0 40.0 2.0 40.0 26-27 32.52312499999999 37.0 33.0 40.0 2.0 40.0 28-29 32.20975 37.0 33.0 40.0 2.0 40.0 30-31 32.081375 37.0 33.0 40.0 2.0 40.0 32-33 31.732 37.0 33.0 40.0 2.0 40.0 34-35 31.63875 37.0 33.0 40.0 2.0 40.0 36-37 31.395 37.0 33.0 40.0 2.0 40.0 38-39 31.235374999999998 37.0 33.0 40.0 2.0 40.0 40-41 30.690875 37.0 27.0 40.0 2.0 40.0 42-43 30.252625 37.0 27.0 40.0 2.0 40.0 44-45 30.126625 37.0 27.0 40.0 2.0 40.0 46-47 30.289875000000002 37.0 27.0 40.0 2.0 40.0 48-49 30.524625 37.0 27.0 40.0 2.0 40.0 50-51 29.476125 35.0 27.0 38.5 2.0 40.0 52-53 29.61275 37.0 27.0 37.0 2.0 40.0 54-55 29.902250000000002 37.0 27.0 37.0 2.0 40.0 56-57 29.739625 37.0 27.0 37.0 2.0 40.0 58-59 29.538875 37.0 27.0 37.0 2.0 40.0 60-61 29.314 37.0 27.0 37.0 2.0 40.0 62-63 28.957875 37.0 27.0 37.0 2.0 40.0 64-65 28.74175 37.0 27.0 37.0 2.0 40.0 66-67 28.633249999999997 35.0 27.0 37.0 2.0 40.0 68-69 28.147624999999998 33.0 24.5 37.0 2.0 37.0 70-71 27.794 33.0 24.5 37.0 2.0 37.0 72-73 27.669375 33.0 24.5 37.0 2.0 37.0 74-75 27.65 33.0 24.5 37.0 2.0 37.0 76-77 27.318125 33.0 22.0 37.0 2.0 37.0 78-79 27.128375 33.0 22.0 37.0 2.0 37.0 80-81 26.98775 33.0 22.0 37.0 2.0 37.0 82-83 26.807875 33.0 22.0 37.0 2.0 37.0 84-85 26.6615 33.0 22.0 37.0 2.0 37.0 86-87 26.4465 33.0 22.0 37.0 2.0 37.0 88-89 26.280749999999998 33.0 22.0 37.0 2.0 37.0 90-91 25.29184480495124 33.0 10.5 37.0 2.0 37.0 92-93 20.189047261815453 24.5 2.0 33.0 2.0 37.0 94-95 23.09104552276138 30.0 2.0 33.0 2.0 37.0 96-97 24.00015680594193 33.0 2.0 37.0 2.0 37.0 98-99 24.412722263961932 33.0 2.0 37.0 2.0 37.0 100-101 22.672426746806913 30.0 2.0 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 289.0 3 47.0 4 35.0 5 27.0 6 31.0 7 19.0 8 21.0 9 21.0 10 30.0 11 22.0 12 25.0 13 21.0 14 37.0 15 25.0 16 14.0 17 31.0 18 24.0 19 17.0 20 28.0 21 25.0 22 29.0 23 40.0 24 43.0 25 58.0 26 49.0 27 60.0 28 80.0 29 100.0 30 112.0 31 144.0 32 135.0 33 181.0 34 250.0 35 407.0 36 559.0 37 727.0 38 236.0 39 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.075000000000003 14.475 27.325 41.125 2 31.35 21.525 27.6 19.525000000000002 3 30.38259564891223 25.081270317579396 21.955488872218055 22.58064516129032 4 26.619964973730298 28.14610958218664 15.361521140855642 29.87240430322742 5 31.49074537268634 30.21510755377689 17.733866933466732 20.560280140070038 6 22.061030515257627 34.14207103551776 17.18359179589795 26.613306653326664 7 20.145145145145147 13.238238238238237 40.51551551551552 26.101101101101097 8 23.554443053817273 18.32290362953692 23.30413016270338 34.81852315394243 9 23.779724655819777 18.222778473091363 26.708385481852314 31.289111389236545 10-11 27.30345518277416 27.290936404606907 18.928392588883327 26.477215823735605 12-13 24.652560410667334 21.48491298359835 25.57906598222111 28.283460623513207 14-15 26.486418825885593 22.89397922142947 24.1457003379647 26.47390161472024 16-17 27.641462193289932 22.58387581372058 23.222333500250375 26.552328492739107 18-19 25.88883324987481 24.59939909864797 22.270906359539307 27.240861291937907 20-21 27.46276129678308 23.18187507823257 22.33070471898861 27.024658905995746 22-23 26.89948679434222 24.170734760295407 22.393290774815373 26.536487670547004 24-25 26.320400500625784 24.405506883604506 22.36545682102628 26.90863579474343 26-27 26.988102692548527 24.520976831559175 22.29179711959925 26.199123356293047 28-29 27.432077125328657 23.02491548766746 22.085889570552148 27.45711781645173 30-31 25.820185324317556 24.06711745554721 23.791635361883294 26.321061858251944 32-33 26.24921728240451 24.007514088916718 23.080776455854725 26.66249217282404 34-35 26.887499999999996 22.4375 23.275000000000002 27.400000000000002 36-37 26.974999999999998 23.775 22.35 26.900000000000002 38-39 27.200000000000003 24.075 22.037499999999998 26.687499999999996 40-41 27.9125 22.225 23.1 26.7625 42-43 26.924999999999997 23.9375 22.5875 26.55 44-45 26.8375 23.9125 22.1875 27.0625 46-47 27.224999999999998 23.3625 22.275 27.1375 48-49 25.874999999999996 22.675 23.225 28.225 50-51 26.700000000000003 23.549999999999997 22.162499999999998 27.5875 52-53 26.2875 23.775 22.925 27.0125 54-55 27.237499999999997 22.6375 23.6125 26.5125 56-57 27.1625 24.0 22.175 26.6625 58-59 26.85 23.875 23.0125 26.2625 60-61 26.5375 23.962500000000002 22.0 27.500000000000004 62-63 26.937499999999996 22.287499999999998 22.925 27.85 64-65 27.1625 23.7375 22.6 26.5 66-67 26.3625 22.3375 23.425 27.875 68-69 27.575 23.375 22.650000000000002 26.400000000000002 70-71 26.924999999999997 23.6625 22.412499999999998 27.0 72-73 26.25 22.5 23.4625 27.787499999999998 74-75 27.450000000000003 22.825 22.9375 26.787499999999998 76-77 26.825 22.6 22.4625 28.1125 78-79 26.174999999999997 24.0 22.375 27.450000000000003 80-81 26.875 22.475 23.0 27.650000000000002 82-83 26.887499999999996 22.3375 22.375 28.4 84-85 26.637499999999996 23.2625 22.425 27.675 86-87 27.187499999999996 22.2625 23.825 26.724999999999998 88-89 27.6375 21.675 23.3625 27.325 90-91 26.328291036379547 23.502937867233403 22.690336292036505 27.47843480435054 92-93 33.89597399349837 21.955488872218055 21.955488872218055 22.193048262065513 94-95 27.463731865932967 22.798899449724864 22.336168084042022 27.40120060030015 96-97 27.07472775065715 23.857804481161597 22.255601451996494 26.81186631618475 98-99 26.859504132231404 22.789882294014525 22.426746806912096 27.923866766841975 100-101 28.09917355371901 22.702228900576007 22.151264713248185 27.0473328324568 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 0.5 25 0.0 26 0.0 27 0.5 28 1.0 29 1.5 30 3.5 31 5.0 32 7.0 33 14.5 34 15.0 35 13.5 36 29.0 37 42.0 38 45.0 39 57.0 40 73.0 41 100.0 42 122.5 43 138.5 44 147.5 45 146.0 46 140.0 47 135.0 48 132.0 49 124.5 50 144.0 51 151.0 52 138.0 53 127.0 54 119.5 55 111.0 56 105.5 57 106.0 58 94.5 59 95.0 60 100.0 61 100.5 62 99.5 63 84.5 64 78.5 65 86.0 66 90.5 67 95.0 68 87.0 69 75.5 70 68.5 71 59.5 72 53.0 73 49.5 74 39.0 75 26.5 76 25.0 77 21.5 78 17.5 79 17.0 80 10.0 81 6.0 82 8.5 83 5.0 84 1.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.075 5 0.05 6 0.05 7 0.1 8 0.125 9 0.125 10-11 0.15 12-13 0.1625 14-15 0.13749999999999998 16-17 0.15 18-19 0.15 20-21 0.13749999999999998 22-23 0.13749999999999998 24-25 0.125 26-27 0.1875 28-29 0.1625 30-31 0.17500000000000002 32-33 0.1875 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 90 1.0 91 0.0 92 0.0 93 1.0 94 0.0 95 2.0 96 3.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3993.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562362 spots for SRR5515074.sra Written 562362 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra Read 562353 spots for SRR5515074.sra Written 562353 spots for SRR5515074.sra SRR ids: ['SRR5515074.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dg3j2w9_ SRR5515074.sra spots: 11247069 blocks: [[1, 562353], [562354, 1124706], [1124707, 1687059], [1687060, 2249412], [2249413, 2811765], [2811766, 3374118], [3374119, 3936471], [3936472, 4498824], [4498825, 5061177], [5061178, 5623530], [5623531, 6185883], [6185884, 6748236], [6748237, 7310589], [7310590, 7872942], [7872943, 8435295], [8435296, 8997648], [8997649, 9560001], [9560002, 10122354], [10122355, 10684707], [10684708, 11247069]] SRR5515074 file size 2690871 SRR5515074 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5515074 SRR5515074_1.fastq SRR5515074_2.fastq Input file: SRR5515074_1.fastq Paired file: SRR5515074_2.fastq trimmed: SRR5515074-trimmed-pair1.fastq, SRR5515074-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:13:25 2024 >> started Mon Dec 9 17:13:36 2024 >> done (11.090s) 11247069 read pairs processed; of these: 296095 ( 2.63%) short read pairs filtered out after trimming by size control 673238 ( 5.99%) empty read pairs filtered out after trimming by size control 10277736 (91.38%) read pairs available; of these: 2857657 (27.80%) trimmed read pairs available after processing 7420079 (72.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 236 0.00% 19 598 0.01% 20 924 0.01% 21 1349 0.01% 22 1800 0.02% 23 2193 0.02% 24 2520 0.02% 25 2998 0.03% 26 3555 0.03% 27 3995 0.04% 28 4249 0.04% 29 4663 0.05% 30 4921 0.05% 31 5480 0.05% 32 5623 0.05% 33 5855 0.06% 34 6104 0.06% 35 6096 0.06% 36 6302 0.06% 37 6671 0.06% 38 6794 0.07% 39 7126 0.07% 40 7400 0.07% 41 7465 0.07% 42 7730 0.08% 43 7726 0.08% 44 7832 0.08% 45 7738 0.08% 46 8205 0.08% 47 8454 0.08% 48 9794 0.10% 49 9005 0.09% 50 9091 0.09% 51 9130 0.09% 52 9241 0.09% 53 9461 0.09% 54 9803 0.10% 55 10233 0.10% 56 10904 0.11% 57 11939 0.12% 58 12235 0.12% 59 18019 0.18% 60 23180 0.23% 61 23616 0.23% 62 25190 0.25% 63 24966 0.24% 64 25485 0.25% 65 26308 0.26% 66 27868 0.27% 67 28394 0.28% 68 28499 0.28% 69 28531 0.28% 70 29205 0.28% 71 28154 0.27% 72 27454 0.27% 73 27416 0.27% 74 26826 0.26% 75 29127 0.28% 76 23970 0.23% 77 27750 0.27% 78 29906 0.29% 79 32152 0.31% 80 33255 0.32% 81 35384 0.34% 82 37888 0.37% 83 38819 0.38% 84 39268 0.38% 85 41054 0.40% 86 42871 0.42% 87 44977 0.44% 88 43906 0.43% 89 47031 0.46% 90 51271 0.50% 91 56366 0.55% 92 63225 0.62% 93 75931 0.74% 94 79916 0.78% 95 93843 0.91% 96 111064 1.08% 97 140375 1.37% 98 211232 2.06% 99 262683 2.56% 100 515721 5.02% 101 7386202 71.87% 10277736 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=212.02 fanout-score-rank=16 prefix-density=1.01 prefix-fanout=26.2 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=464.47 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=26.2 sequence=CGGCGGCGGAGG criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=220.20 fanout-score-rank=16 prefix-density=0.96 prefix-fanout=26.5 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=448.09 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=27.5 sequence=GCCGCCGCCGGAGCCTCCACGGCTGCCACCGTAGCCGCCGCCG SRR5515074 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:14:19 Started mapping on | Dec 09 17:14:20 Finished on | Dec 09 17:16:19 Mapping speed, Million of reads per hour | 310.92 Number of input reads | 10277736 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 9171647 Uniquely mapped reads % | 89.24% Average mapped length | 191.68 Number of splices: Total | 5006463 Number of splices: Annotated (sjdb) | 4787422 Number of splices: GT/AG | 4929871 Number of splices: GC/AG | 63502 Number of splices: AT/AC | 3390 Number of splices: Non-canonical | 9700 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 120357 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 13203 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.71% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1024813 1024813 1024813 N_multimapping 120357 120357 120357 N_noFeature 210251 4625375 4592864 N_ambiguous 185080 11922 12359 UnstrandedReadsAssigned:8776316 PositiveStrandReadsAssigned:4534350 NegativeStrandReadsAssigned:4566424 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5515074 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5515074-trimmed-pair1.fastq SRR5515074-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,277,736 reads, 9,046,259 reads pseudoaligned [quant] estimated average fragment length: 241.829 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR5515074.ke.tsv 35125 SRR5515074.se.tsv 88098 total ==> SRR5515074.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.34 29.037 6.14843 PNS24247 1044 803.171 27.3108 5.00653 PNS24249 1928 1687.17 130.002 11.3449 PNS24246 1044 803.171 27.3108 5.00653 PNS24248 1044 803.171 27.3108 5.00653 PNS24244 1471 1230.17 68.0287 8.14211 PNS24243 293 54.4996 7 18.911 KQK14069 1603 1362.17 5135.05 555.038 KQK14071 474 234.675 493.782 309.797 ==> SRR5515074.se.tsv <== BRADI_1g14170v3 5795 BRADI_1g53295v3 31 BRADI_1g59795v3 88 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 559 BRADI_1g74790v3 200 BRADI_1g09890v3 0 BRADI_1g77505v3 87 BRADI_1g48960v3 0 SRR5515074 completed mapping pipeline successfully