Starting /dee2/code/volunteer_pipeline.sh SRR5515075 current disk space = 1523786141696 free memory = 1583118604 SRR5515075 SRAfilesize 52d9eba2514dfd74a64b984c6546931a SRR5515075.sra SRR5515075.sra file validated SRR5515075 is paired end SRR5515075 is conventional basespace SRR5515075 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515075_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.555 33.0 33.0 33.0 27.0 33.0 2 31.56075 33.0 33.0 33.0 27.0 33.0 3 30.90625 33.0 33.0 33.0 27.0 33.0 4 35.12425 37.0 37.0 37.0 33.0 37.0 5 34.91675 37.0 37.0 37.0 33.0 37.0 6 34.716 37.0 37.0 37.0 33.0 37.0 7 34.7725 37.0 37.0 37.0 33.0 37.0 8 34.63275 37.0 37.0 37.0 33.0 37.0 9 34.6335 37.0 37.0 37.0 33.0 37.0 10-11 34.649875 37.0 37.0 37.0 33.0 37.0 12-13 34.617000000000004 37.0 37.0 37.0 33.0 37.0 14-15 36.427875 40.0 37.0 40.0 33.0 40.0 16-17 36.385125 40.0 37.0 40.0 33.0 40.0 18-19 36.229124999999996 40.0 37.0 40.0 33.0 40.0 20-21 36.16275 40.0 37.0 40.0 30.0 40.0 22-23 36.051500000000004 40.0 37.0 40.0 30.0 40.0 24-25 35.901624999999996 40.0 37.0 40.0 27.0 40.0 26-27 35.7295 40.0 37.0 40.0 27.0 40.0 28-29 35.6845 40.0 37.0 40.0 27.0 40.0 30-31 35.472750000000005 40.0 37.0 40.0 27.0 40.0 32-33 35.298875 38.5 37.0 40.0 27.0 40.0 34-35 35.076 37.0 37.0 40.0 27.0 40.0 36-37 34.753625 37.0 37.0 40.0 24.5 40.0 38-39 34.445375 37.0 33.0 40.0 22.0 40.0 40-41 34.3575 37.0 33.0 40.0 22.0 40.0 42-43 34.085125000000005 37.0 33.0 40.0 22.0 40.0 44-45 33.761875 37.0 33.0 40.0 22.0 40.0 46-47 33.454125 37.0 33.0 40.0 22.0 40.0 48-49 33.637 37.0 33.0 40.0 22.0 40.0 50-51 33.82925 37.0 33.0 40.0 22.0 40.0 52-53 33.64725 37.0 33.0 40.0 22.0 40.0 54-55 33.30825 37.0 33.0 40.0 22.0 40.0 56-57 33.16375 37.0 33.0 40.0 22.0 40.0 58-59 32.83125 37.0 33.0 38.5 18.5 40.0 60-61 32.652125 37.0 33.0 37.0 18.5 40.0 62-63 32.55175 37.0 33.0 37.0 18.5 40.0 64-65 32.251625 37.0 33.0 37.0 15.0 40.0 66-67 32.017625 37.0 33.0 37.0 15.0 40.0 68-69 31.769 37.0 33.0 37.0 15.0 38.5 70-71 31.458750000000002 37.0 33.0 37.0 15.0 37.0 72-73 31.15325 37.0 33.0 37.0 6.0 37.0 74-75 31.074375 37.0 33.0 37.0 6.0 37.0 76-77 29.389125 33.0 27.0 37.0 6.0 37.0 78-79 30.478749999999998 33.0 33.0 37.0 6.0 37.0 80-81 30.68625 37.0 33.0 37.0 4.0 37.0 82-83 30.566499999999998 37.0 33.0 37.0 2.0 37.0 84-85 30.419125 35.0 33.0 37.0 2.0 37.0 86-87 30.165875 33.0 33.0 37.0 2.0 37.0 88-89 30.090125 33.0 33.0 37.0 2.0 37.0 90-91 29.921 33.0 33.0 37.0 2.0 37.0 92-93 29.564125 33.0 30.0 37.0 2.0 37.0 94-95 29.388624999999998 33.0 27.0 37.0 2.0 37.0 96-97 29.152788663663664 33.0 27.0 37.0 2.0 37.0 98-99 28.95945945945946 33.0 27.0 37.0 2.0 37.0 100-101 26.90765765765766 33.0 24.5 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 80.0 3 33.0 4 11.0 5 13.0 6 11.0 7 10.0 8 16.0 9 17.0 10 13.0 11 21.0 12 9.0 13 18.0 14 23.0 15 7.0 16 28.0 17 16.0 18 17.0 19 17.0 20 11.0 21 19.0 22 23.0 23 28.0 24 37.0 25 30.0 26 40.0 27 59.0 28 66.0 29 61.0 30 88.0 31 123.0 32 128.0 33 177.0 34 233.0 35 355.0 36 604.0 37 1001.0 38 557.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 18.8344172086043 13.006503251625812 25.71285642821411 42.446223111555774 2 32.425 21.85 27.025 18.7 3 30.125 26.200000000000003 21.85 21.825 4 29.2 28.95 14.549999999999999 27.3 5 31.45 28.849999999999998 17.625 22.075 6 22.041531148361273 35.7518138603953 16.537403052289218 25.66925193895422 7 21.97747183979975 12.665832290362955 40.32540675844806 25.03128911138924 8 25.087631447170754 17.97696544817226 21.657486229344016 35.27791687531297 9 25.31930879038317 18.332081141998497 27.29777109942399 29.05083896819434 10-11 28.514207034672673 25.785455000625863 18.56302415821755 27.137313806483913 12-13 25.250501002004004 21.430360721442888 26.23997995991984 27.07915831663327 14-15 27.419556779767124 22.912232377613623 23.513208964567422 26.155001878051838 16-17 27.120340255191394 22.71703777833375 23.167375531648737 26.99524643482612 18-19 26.8951713785339 23.329997498123593 22.654490868151115 27.120340255191394 20-21 28.185569588595722 23.096161060397648 22.933600100037513 25.78466925096911 22-23 28.260325406758447 23.541927409261575 21.83979974968711 26.357947434292868 24-25 27.263619286161557 23.59423919849718 22.241703193487787 26.900438321853475 26-27 27.887747431721372 23.50288148333751 21.761463292407917 26.8479077925332 28-29 26.806059847251785 23.262802053336674 22.448979591836736 27.482158507574812 30-31 28.101139066216046 24.233320816122166 21.917636750531983 25.747903367129805 32-33 28.928928928928926 22.972972972972975 22.12212212212212 25.975975975975974 34-35 27.566349524286434 23.059589384076116 22.734101151727593 26.639959939909865 36-37 27.58707090954648 23.50288148333751 23.34001503382611 25.570032573289904 38-39 27.6449229998748 23.31288343558282 22.67434581194441 26.367847752597974 40-41 27.61988230875172 23.074996869913612 21.948165769375237 27.356955051959435 42-43 27.37171464330413 23.00375469336671 22.878598247809762 26.7459324155194 44-45 27.759699624530665 23.153942428035045 21.877346683354194 27.2090112640801 46-47 27.954431647471207 22.70906359539309 21.957936905358036 27.378567851777667 48-49 27.07472775065715 23.319564401051444 23.169357867067216 26.436349981224183 50-51 27.215823735603408 22.59639459188783 22.608913370055085 27.578868302453678 52-53 28.068637274549097 23.371743486973948 21.705911823647295 26.853707414829657 54-55 26.834460305534684 22.802404207362887 22.451790633608816 27.911344853493613 56-57 28.272841051314142 22.202753441802255 22.74092615769712 26.783479349186486 58-59 28.36213373403456 22.915101427498122 21.91334835962935 26.809416478837967 60-61 26.84118236472946 22.57014028056112 23.371743486973948 27.21693386773547 62-63 28.78787878787879 22.915101427498122 21.7129977460556 26.584022038567497 64-65 28.05412855531888 22.81668963788999 22.115023180052624 27.014158626738507 66-67 28.369061050520244 23.17914002757929 21.93807195687602 26.513726965024446 68-69 28.1077694235589 23.107769423558896 21.842105263157897 26.94235588972431 70-71 28.480140333291565 22.71645157248465 22.140082696403958 26.663325397819822 72-73 27.819548872180448 22.832080200501252 22.832080200501252 26.516290726817044 74-75 28.35129040340767 21.96191430719118 22.074668003006764 27.61212728639439 76-77 27.778473875454203 22.05237438917429 22.140082696403958 28.029069038967545 78-79 27.2715879182855 23.812507833061787 21.932573004135858 26.983331244516854 80-81 29.135338345864664 21.74185463659148 22.030075187969924 27.092731829573935 82-83 28.38701591678155 21.95763880185487 22.659481137987218 26.995864143376362 84-85 27.566754418954492 22.138648614767455 23.07885169863357 27.215745267644476 86-87 28.12382504073192 22.822408823160796 22.032836195011907 27.020929941095375 88-89 28.617967673223905 22.75404084701165 21.53865430397193 27.089337175792505 90-91 27.706766917293237 23.709273182957393 22.25563909774436 26.328320802005013 92-93 28.095238095238095 23.082706766917294 21.403508771929825 27.418546365914786 94-95 27.825106489601602 22.37534452518166 21.51089952392884 28.288649461287896 96-97 27.823691460055095 22.564487853744055 22.176308539944902 27.435512146255945 98-99 28.025557504384867 22.287647206213983 22.325231771485843 27.36156351791531 100-101 28.224392687202602 22.839969947407965 21.950914099674428 26.984723265715 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.0 27 2.5 28 2.0 29 1.5 30 5.0 31 7.5 32 9.0 33 13.5 34 13.0 35 20.5 36 34.0 37 35.5 38 45.0 39 56.5 40 70.0 41 93.0 42 104.0 43 118.0 44 126.5 45 126.0 46 129.5 47 141.5 48 150.5 49 136.5 50 132.0 51 139.0 52 131.5 53 125.0 54 119.5 55 108.5 56 92.5 57 90.5 58 88.5 59 80.0 60 93.5 61 102.0 62 97.5 63 95.5 64 94.0 65 88.0 66 95.5 67 97.0 68 83.5 69 84.5 70 84.5 71 76.5 72 71.5 73 59.5 74 47.0 75 40.0 76 30.0 77 26.5 78 22.5 79 15.5 80 12.0 81 8.5 82 5.5 83 2.5 84 2.5 85 1.5 86 0.0 87 0.5 88 0.5 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.125 8 0.15 9 0.17500000000000002 10-11 0.13749999999999998 12-13 0.2 14-15 0.1625 16-17 0.075 18-19 0.075 20-21 0.0375 22-23 0.125 24-25 0.1875 26-27 0.22499999999999998 28-29 0.1625 30-31 0.13749999999999998 32-33 0.1 34-35 0.15 36-37 0.22499999999999998 38-39 0.1625 40-41 0.1625 42-43 0.125 44-45 0.125 46-47 0.15 48-49 0.13749999999999998 50-51 0.15 52-53 0.2 54-55 0.17500000000000002 56-57 0.125 58-59 0.17500000000000002 60-61 0.2 62-63 0.17500000000000002 64-65 0.2375 66-67 0.2875 68-69 0.25 70-71 0.2375 72-73 0.25 74-75 0.22499999999999998 76-77 0.2375 78-79 0.2625 80-81 0.25 82-83 0.2625 84-85 0.2875 86-87 0.2625 88-89 0.2375 90-91 0.25 92-93 0.25 94-95 0.22499999999999998 96-97 0.12506253126563283 98-99 0.12512512512512514 100-101 0.07507507507507508 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 4.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3996.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0125 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0 0.0 0.025 0.0 0.0 76-77 0.0 0.0 0.025 0.0 0.0 78-79 0.0 0.0 0.025 0.0 0.0 80-81 0.0 0.0 0.025 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.0 0.0 0.025 0.0 0.0 88-89 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5515075 read2 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515075_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 54 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.357 33.0 33.0 33.0 27.0 33.0 2 30.25725 33.0 33.0 33.0 27.0 33.0 3 30.1725 33.0 33.0 33.0 22.0 33.0 4 33.80025 37.0 37.0 37.0 27.0 37.0 5 33.73 37.0 37.0 37.0 27.0 37.0 6 33.65175 37.0 37.0 37.0 27.0 37.0 7 33.75275 37.0 37.0 37.0 27.0 37.0 8 33.6755 37.0 37.0 37.0 27.0 37.0 9 33.51225 37.0 37.0 37.0 27.0 37.0 10-11 33.552125000000004 37.0 37.0 37.0 27.0 37.0 12-13 33.294875000000005 37.0 37.0 37.0 24.5 37.0 14-15 35.003 40.0 37.0 40.0 27.0 40.0 16-17 34.876875 40.0 37.0 40.0 24.5 40.0 18-19 34.8625 40.0 37.0 40.0 24.5 40.0 20-21 34.689 40.0 37.0 40.0 22.0 40.0 22-23 34.703125 40.0 37.0 40.0 22.0 40.0 24-25 34.547 40.0 37.0 40.0 22.0 40.0 26-27 34.24325 38.5 33.0 40.0 15.0 40.0 28-29 34.099000000000004 37.0 33.0 40.0 15.0 40.0 30-31 33.79075 37.0 33.0 40.0 15.0 40.0 32-33 33.7625 37.0 33.0 40.0 15.0 40.0 34-35 33.662 37.0 33.0 40.0 15.0 40.0 36-37 33.44325 37.0 33.0 40.0 15.0 40.0 38-39 33.103375 37.0 33.0 40.0 15.0 40.0 40-41 33.00625 37.0 33.0 40.0 15.0 40.0 42-43 32.7315 37.0 33.0 40.0 6.0 40.0 44-45 32.451499999999996 37.0 33.0 40.0 6.0 40.0 46-47 32.423625 37.0 33.0 40.0 6.0 40.0 48-49 32.559875 37.0 33.0 40.0 4.0 40.0 50-51 31.355874999999997 37.0 30.0 38.5 2.0 40.0 52-53 31.502125 37.0 33.0 37.0 2.0 40.0 54-55 31.966375 37.0 33.0 40.0 2.0 40.0 56-57 31.971 37.0 33.0 40.0 2.0 40.0 58-59 31.69675 37.0 33.0 37.0 2.0 40.0 60-61 31.615000000000002 37.0 33.0 37.0 2.0 40.0 62-63 31.4215 37.0 33.0 37.0 2.0 40.0 64-65 31.069625000000002 37.0 33.0 37.0 2.0 40.0 66-67 30.820124999999997 37.0 33.0 37.0 2.0 40.0 68-69 30.623375 37.0 33.0 37.0 2.0 38.5 70-71 30.278624999999998 37.0 33.0 37.0 2.0 37.0 72-73 29.900374999999997 37.0 27.0 37.0 2.0 37.0 74-75 29.598750000000003 37.0 27.0 37.0 2.0 37.0 76-77 29.512375 35.0 27.0 37.0 2.0 37.0 78-79 29.305125 33.0 27.0 37.0 2.0 37.0 80-81 28.929125 33.0 27.0 37.0 2.0 37.0 82-83 28.679375 33.0 27.0 37.0 2.0 37.0 84-85 28.451875 33.0 27.0 37.0 2.0 37.0 86-87 28.108625 33.0 27.0 37.0 2.0 37.0 88-89 27.692 33.0 27.0 37.0 2.0 37.0 90-91 27.4375 33.0 24.5 37.0 2.0 37.0 92-93 27.255125 33.0 24.5 37.0 2.0 37.0 94-95 25.6875 33.0 18.5 37.0 2.0 37.0 96-97 25.06604757401775 33.0 15.0 37.0 2.0 37.0 98-99 25.72444889779559 33.0 18.5 37.0 2.0 37.0 100-101 24.480961923847694 30.0 8.5 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 177.0 3 36.0 4 16.0 5 20.0 6 21.0 7 23.0 8 21.0 9 15.0 10 19.0 11 18.0 12 23.0 13 19.0 14 18.0 15 13.0 16 14.0 17 19.0 18 28.0 19 23.0 20 20.0 21 25.0 22 20.0 23 32.0 24 34.0 25 41.0 26 53.0 27 51.0 28 66.0 29 74.0 30 103.0 31 134.0 32 162.0 33 171.0 34 220.0 35 373.0 36 591.0 37 899.0 38 406.0 39 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.35 13.65 24.525 42.475 2 33.15 20.599999999999998 27.1 19.15 3 30.9 25.85 20.875 22.375 4 27.224999999999998 28.725 14.000000000000002 30.049999999999997 5 31.724999999999998 29.599999999999998 16.950000000000003 21.725 6 22.975 35.4 16.1 25.525 7 20.980245061265315 13.278319579894973 39.80995248812203 25.93148287071768 8 25.062531265632813 18.18409204602301 20.910455227613806 35.842921460730366 9 24.96248124062031 19.734867433716857 25.53776888444222 29.764882441220607 10-11 28.165665665665667 26.58908908908909 17.792792792792792 27.45245245245245 12-13 25.500751126690034 21.081622433650477 25.751126690035054 27.666499749624435 14-15 27.08281210908181 22.416812609457093 23.742807105328996 26.7575681761321 16-17 27.027027027027028 23.46096096096096 22.56006006006006 26.95195195195195 18-19 26.973601901663958 23.570624296259226 23.29538346052796 26.160390341548855 20-21 28.08707619166771 22.89503315400976 22.119354435130738 26.898536219191794 22-23 27.348930314024773 23.49555861378706 22.469660953334166 26.685850118854 24-25 26.8951713785339 23.48011008256192 23.179884913685264 26.444833625218916 26-27 28.33708990733784 23.453543701477585 21.061858251940897 27.147508139243676 28-29 27.81879614566387 22.562883243649104 21.5742710549368 28.044049555750217 30-31 27.43085971718183 24.65273432611688 22.07483418846202 25.84157176823927 32-33 27.485599799649385 23.37841222138743 22.401702980215376 26.73428499874781 34-35 27.425 22.95 22.125 27.500000000000004 36-37 27.2625 23.175 22.6 26.9625 38-39 27.450000000000003 22.9875 22.75 26.8125 40-41 27.3625 22.9375 22.287499999999998 27.4125 42-43 26.937499999999996 23.825 22.125 27.1125 44-45 27.450000000000003 23.549999999999997 22.1 26.900000000000002 46-47 27.737499999999997 22.7375 21.9375 27.5875 48-49 26.924999999999997 23.6875 22.3 27.0875 50-51 28.125 23.25 21.45 27.175 52-53 27.750000000000004 23.45 22.3125 26.487500000000004 54-55 28.199999999999996 22.8875 22.0875 26.825 56-57 27.987499999999997 23.400000000000002 21.6875 26.924999999999997 58-59 27.2625 22.725 22.8375 27.175 60-61 27.375 23.175 22.05 27.400000000000002 62-63 27.025 23.0875 21.8 28.0875 64-65 27.0125 24.1125 22.1 26.775 66-67 26.875 23.0375 23.150000000000002 26.937499999999996 68-69 28.075 22.3625 22.4375 27.125 70-71 27.8375 22.525000000000002 22.3 27.3375 72-73 26.625 23.275000000000002 22.525000000000002 27.575 74-75 27.700000000000003 22.85 22.5 26.950000000000003 76-77 27.525 22.6 22.55 27.325 78-79 27.1125 22.35 22.8875 27.650000000000002 80-81 27.962500000000002 23.0625 21.95 27.025 82-83 27.500000000000004 22.8375 22.037499999999998 27.625 84-85 26.887499999999996 21.912499999999998 23.2875 27.9125 86-87 27.750000000000004 23.1375 21.75 27.3625 88-89 27.6375 21.9375 22.8125 27.6125 90-91 26.2625 23.325000000000003 22.475 27.9375 92-93 28.9125 22.0 22.175 26.9125 94-95 27.037499999999998 23.8625 21.6625 27.437499999999996 96-97 26.980352897009137 22.11237642347641 23.126016768864975 27.78125391064948 98-99 28.2064128256513 22.28206412825651 22.645290581162325 26.866232464929862 100-101 28.75751503006012 21.655811623246493 21.705911823647295 27.880761523046093 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 2.0 28 4.0 29 3.5 30 2.5 31 8.5 32 10.5 33 9.5 34 13.5 35 21.0 36 30.5 37 40.0 38 48.0 39 56.0 40 78.5 41 98.5 42 107.5 43 117.0 44 120.5 45 121.0 46 133.5 47 159.0 48 151.5 49 130.5 50 128.0 51 133.5 52 130.0 53 122.5 54 124.5 55 114.5 56 95.0 57 83.5 58 85.0 59 91.5 60 87.0 61 79.5 62 92.0 63 103.5 64 105.0 65 98.0 66 92.5 67 91.5 68 87.5 69 83.5 70 74.5 71 71.0 72 66.0 73 50.0 74 47.5 75 43.0 76 33.0 77 29.0 78 21.0 79 19.5 80 14.5 81 5.5 82 3.0 83 5.0 84 6.0 85 3.0 86 1.5 87 1.0 88 1.0 89 1.0 90 0.5 91 1.0 92 2.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.05 10-11 0.1 12-13 0.15 14-15 0.075 16-17 0.1 18-19 0.08750000000000001 20-21 0.08750000000000001 22-23 0.08750000000000001 24-25 0.075 26-27 0.17500000000000002 28-29 0.11249999999999999 30-31 0.11249999999999999 32-33 0.17500000000000002 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 1.0 96 7.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3992.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512054 spots for SRR5515075.sra Written 512054 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra Read 512035 spots for SRR5515075.sra Written 512035 spots for SRR5515075.sra SRR ids: ['SRR5515075.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6rofj8vh SRR5515075.sra spots: 10240719 blocks: [[1, 512035], [512036, 1024070], [1024071, 1536105], [1536106, 2048140], [2048141, 2560175], [2560176, 3072210], [3072211, 3584245], [3584246, 4096280], [4096281, 4608315], [4608316, 5120350], [5120351, 5632385], [5632386, 6144420], [6144421, 6656455], [6656456, 7168490], [7168491, 7680525], [7680526, 8192560], [8192561, 8704595], [8704596, 9216630], [9216631, 9728665], [9728666, 10240719]] SRR5515075 file size 2448262 SRR5515075 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5515075 SRR5515075_1.fastq SRR5515075_2.fastq Input file: SRR5515075_1.fastq Paired file: SRR5515075_2.fastq trimmed: SRR5515075-trimmed-pair1.fastq, SRR5515075-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:20:48 2024 >> started Mon Dec 9 17:20:58 2024 >> done (10.060s) 10240719 read pairs processed; of these: 280338 ( 2.74%) short read pairs filtered out after trimming by size control 596769 ( 5.83%) empty read pairs filtered out after trimming by size control 9363612 (91.44%) read pairs available; of these: 2706989 (28.91%) trimmed read pairs available after processing 6656623 (71.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 243 0.00% 19 571 0.01% 20 978 0.01% 21 1365 0.01% 22 1710 0.02% 23 2210 0.02% 24 2495 0.03% 25 3033 0.03% 26 3295 0.04% 27 3852 0.04% 28 4287 0.05% 29 4644 0.05% 30 4810 0.05% 31 5089 0.05% 32 5381 0.06% 33 5492 0.06% 34 5910 0.06% 35 6044 0.06% 36 6148 0.07% 37 6356 0.07% 38 6571 0.07% 39 6572 0.07% 40 7070 0.08% 41 7035 0.08% 42 7246 0.08% 43 7298 0.08% 44 7232 0.08% 45 7498 0.08% 46 7527 0.08% 47 7942 0.08% 48 9173 0.10% 49 8587 0.09% 50 8543 0.09% 51 8614 0.09% 52 8663 0.09% 53 9235 0.10% 54 9156 0.10% 55 9606 0.10% 56 10168 0.11% 57 11050 0.12% 58 11511 0.12% 59 17135 0.18% 60 21847 0.23% 61 22600 0.24% 62 23760 0.25% 63 23514 0.25% 64 24516 0.26% 65 25529 0.27% 66 26224 0.28% 67 27418 0.29% 68 27182 0.29% 69 26925 0.29% 70 27537 0.29% 71 26720 0.29% 72 25849 0.28% 73 25973 0.28% 74 25044 0.27% 75 27303 0.29% 76 22511 0.24% 77 26152 0.28% 78 28298 0.30% 79 30076 0.32% 80 31603 0.34% 81 33259 0.36% 82 35689 0.38% 83 36598 0.39% 84 36984 0.39% 85 38723 0.41% 86 41045 0.44% 87 42383 0.45% 88 41431 0.44% 89 44378 0.47% 90 48343 0.52% 91 53321 0.57% 92 60479 0.65% 93 71964 0.77% 94 74926 0.80% 95 88083 0.94% 96 105282 1.12% 97 131429 1.40% 98 197847 2.11% 99 245148 2.62% 100 491522 5.25% 101 6630852 70.82% 9363612 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=226.03 fanout-score-rank=16 prefix-density=1.20 prefix-fanout=27.1 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=495.29 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=28.1 sequence=GCGGCGGCGGGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=229.00 fanout-score-rank=15 prefix-density=1.13 prefix-fanout=27.0 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=31 fanout-score=480.19 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=27.9 sequence=GCGGCGGCGGCTACGGTGG SRR5515075 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:21:39 Started mapping on | Dec 09 17:21:39 Finished on | Dec 09 17:22:52 Mapping speed, Million of reads per hour | 461.77 Number of input reads | 9363612 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 8230336 Uniquely mapped reads % | 87.90% Average mapped length | 189.97 Number of splices: Total | 4378315 Number of splices: Annotated (sjdb) | 4174225 Number of splices: GT/AG | 4307834 Number of splices: GC/AG | 56576 Number of splices: AT/AC | 2920 Number of splices: Non-canonical | 10985 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 115568 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 11352 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.97% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1063651 1063651 1063651 N_multimapping 115568 115568 115568 N_noFeature 187427 4165452 4113062 N_ambiguous 159393 11410 11778 UnstrandedReadsAssigned:7883516 PositiveStrandReadsAssigned:4053474 NegativeStrandReadsAssigned:4105496 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5515075 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5515075-trimmed-pair1.fastq SRR5515075-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,363,612 reads, 8,096,086 reads pseudoaligned [quant] estimated average fragment length: 232.427 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52973 SRR5515075.ke.tsv 35125 SRR5515075.se.tsv 88098 total ==> SRR5515075.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.773 0 0 PNS24247 1044 812.573 24.8913 5.16478 PNS24249 1928 1696.57 124.876 12.41 PNS24246 1044 812.573 24.8913 5.16478 PNS24248 1044 812.573 24.8913 5.16478 PNS24244 1471 1239.57 61.4506 8.35836 PNS24243 293 64.1069 18 47.3407 KQK14069 1603 1371.57 3728.06 458.28 KQK14071 474 244.257 709.986 490.083 ==> SRR5515075.se.tsv <== BRADI_1g14170v3 4510 BRADI_1g53295v3 34 BRADI_1g59795v3 65 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 578 BRADI_1g74790v3 183 BRADI_1g09890v3 0 BRADI_1g77505v3 56 BRADI_1g48960v3 0 SRR5515075 completed mapping pipeline successfully