Starting /dee2/code/volunteer_pipeline.sh SRR5515076 current disk space = 1523774038016 free memory = 1583117732 SRR5515076 SRAfilesize ff22941bab9100981c24208ff6ed0f5a SRR5515076.sra SRR5515076.sra file validated SRR5515076 is paired end SRR5515076 is conventional basespace SRR5515076 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515076_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 54 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.578 15.0 15.0 15.0 15.0 27.0 2 23.40775 27.0 15.0 27.0 15.0 33.0 3 27.08625 27.0 27.0 33.0 15.0 33.0 4 32.88125 37.0 33.0 37.0 27.0 37.0 5 33.05375 37.0 33.0 37.0 22.0 37.0 6 33.12725 37.0 33.0 37.0 22.0 37.0 7 33.2845 37.0 33.0 37.0 27.0 37.0 8 33.2815 37.0 33.0 37.0 27.0 37.0 9 33.20175 37.0 37.0 37.0 22.0 37.0 10-11 33.12625 37.0 35.0 37.0 22.0 37.0 12-13 33.09225 37.0 37.0 37.0 22.0 37.0 14-15 34.578875 40.0 35.0 40.0 18.5 40.0 16-17 34.515375000000006 40.0 35.0 40.0 22.0 40.0 18-19 34.342 40.0 35.0 40.0 18.5 40.0 20-21 34.284625 40.0 33.0 40.0 15.0 40.0 22-23 34.156125 37.0 33.0 40.0 15.0 40.0 24-25 33.9445 37.0 33.0 40.0 15.0 40.0 26-27 33.786 37.0 33.0 40.0 15.0 40.0 28-29 33.5685 37.0 33.0 40.0 15.0 40.0 30-31 33.51175 37.0 33.0 40.0 15.0 40.0 32-33 33.2765 37.0 33.0 40.0 6.0 40.0 34-35 33.063874999999996 37.0 33.0 40.0 6.0 40.0 36-37 32.78275 37.0 33.0 40.0 6.0 40.0 38-39 32.87625 37.0 33.0 40.0 6.0 40.0 40-41 32.514625 37.0 33.0 40.0 6.0 40.0 42-43 32.287 37.0 33.0 40.0 2.0 40.0 44-45 31.9925 37.0 33.0 40.0 2.0 40.0 46-47 31.55275 37.0 33.0 40.0 2.0 40.0 48-49 31.716875 37.0 33.0 40.0 2.0 40.0 50-51 31.784374999999997 37.0 33.0 40.0 2.0 40.0 52-53 31.575499999999998 37.0 33.0 40.0 2.0 40.0 54-55 31.350250000000003 37.0 33.0 40.0 2.0 40.0 56-57 31.213250000000002 37.0 33.0 37.0 2.0 40.0 58-59 30.955750000000002 37.0 33.0 37.0 2.0 40.0 60-61 30.783 37.0 33.0 37.0 2.0 40.0 62-63 30.65575 37.0 33.0 37.0 2.0 40.0 64-65 30.39225 37.0 33.0 37.0 2.0 40.0 66-67 30.1635 37.0 27.0 37.0 2.0 40.0 68-69 29.857625 37.0 27.0 37.0 2.0 38.5 70-71 29.673625 37.0 27.0 37.0 2.0 37.0 72-73 29.250375 33.0 27.0 37.0 2.0 37.0 74-75 29.090125 33.0 27.0 37.0 2.0 37.0 76-77 27.912 33.0 27.0 37.0 2.0 37.0 78-79 28.611375000000002 33.0 27.0 37.0 2.0 37.0 80-81 28.7485 33.0 27.0 37.0 2.0 37.0 82-83 28.594625 33.0 27.0 37.0 2.0 37.0 84-85 28.38425 33.0 27.0 37.0 2.0 37.0 86-87 28.329875 33.0 27.0 37.0 2.0 37.0 88-89 28.089375 33.0 27.0 37.0 2.0 37.0 90-91 27.951625 33.0 27.0 37.0 2.0 37.0 92-93 27.771 33.0 27.0 37.0 2.0 37.0 94-95 27.662625 33.0 27.0 37.0 2.0 37.0 96-97 27.510924474026524 33.0 27.0 37.0 2.0 37.0 98-99 27.175888833249875 33.0 24.5 37.0 2.0 37.0 100-101 25.376564847270906 33.0 18.5 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 184.0 3 52.0 4 22.0 5 30.0 6 26.0 7 23.0 8 26.0 9 12.0 10 24.0 11 21.0 12 19.0 13 19.0 14 20.0 15 24.0 16 13.0 17 18.0 18 23.0 19 21.0 20 15.0 21 20.0 22 20.0 23 32.0 24 39.0 25 39.0 26 48.0 27 56.0 28 66.0 29 81.0 30 75.0 31 129.0 32 146.0 33 213.0 34 280.0 35 410.0 36 591.0 37 893.0 38 270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.6986986986987 24.3993993993994 12.287287287287288 14.614614614614615 2 30.075000000000003 22.7 28.175 19.05 3 30.725 25.324999999999996 22.575 21.375 4 28.075 27.725 16.175 28.025 5 30.83270817704426 29.982495623905976 17.65441360340085 21.530382595648913 6 23.59128474830954 34.03456048084148 17.330328074129728 25.043826696719258 7 20.86673346693387 13.201402805611224 41.758517034068134 24.173346693386772 8 25.213032581453632 17.694235588972433 21.954887218045112 35.13784461152882 9 24.586466165413533 17.74436090225564 26.94235588972431 30.72681704260652 10-11 28.385318802455217 26.418639609169485 17.63747964424402 27.558561944131277 12-13 26.156159919789445 21.155533274846473 26.494548188996113 26.19375861636797 14-15 26.98571786519669 22.37534452518166 23.778501628664493 26.860435980957153 16-17 27.315973960941413 23.13470205307962 22.421131697546322 27.12819228843265 18-19 25.942156003505694 23.538249655690496 23.42556654563666 27.094027795167147 20-21 27.25225225225225 23.636136136136134 22.84784784784785 26.263763763763766 22-23 27.71793587174349 22.58266533066132 22.46993987975952 27.229458917835668 24-25 27.330827067669173 24.022556390977442 22.506265664160402 26.14035087719298 26-27 27.880155446909864 23.05377961639714 22.677698382850693 26.388366553842296 28-29 27.060886995740418 23.064394888499123 21.911801553495362 27.962916562265093 30-31 26.65330661322645 23.34669338677355 23.208917835671343 26.791082164328657 32-33 28.17077751345937 23.16263928884437 22.749467885313635 25.91711531238262 34-35 28.013029315960914 22.6634928589326 22.16236532197444 27.161112503132046 36-37 26.726839664034095 24.771217249592578 22.364297354895324 26.137645731478 38-39 27.590527502819196 23.34293948126801 22.00225535647162 27.06427765944117 40-41 26.913920561333164 23.117403834106 22.152612454579625 27.816063149981208 42-43 27.649711851666247 22.776246554748184 22.90152843898772 26.672513154597844 44-45 28.319138276553108 23.259018036072142 21.317635270541082 27.104208416833668 46-47 27.969924812030072 22.518796992481203 21.992481203007518 27.518796992481203 48-49 27.09612733425241 23.47411956385512 22.659481137987218 26.77027196390525 50-51 28.501628664495115 23.390127787521926 22.362816336757703 25.74542721122526 52-53 27.57929046007271 22.89081108186035 22.48965776607747 27.04024069198947 54-55 27.124592629731765 23.238906994234142 23.0383554775633 26.598144898470792 56-57 27.86474639949906 23.331246086412023 22.15403882279274 26.649968691296184 58-59 28.44071195788418 22.399097518174983 22.374028578591126 26.78616194534971 60-61 27.052776733107684 23.191676068697507 22.276545067067822 27.47900213112699 62-63 26.71679197994987 24.223057644110277 21.604010025062657 27.456140350877195 64-65 28.218318695106646 23.212045169385195 21.40526976160602 27.164366373902133 66-67 27.392614920874152 23.423762873649835 22.707862346144182 26.475759859331827 68-69 27.80426599749059 22.47176913425345 22.371392722710162 27.352572145545796 70-71 26.72521957340025 23.801756587202007 21.304893350062734 28.16813048933501 72-73 26.697627714321577 23.12037153257186 22.455127400527175 27.72687335257939 74-75 27.106318956870613 24.022066198595788 21.414242728184554 27.45737211634905 76-77 27.53605015673981 23.310344827586206 21.11598746081505 28.037617554858933 78-79 27.922159447583176 23.4526051475204 22.146892655367232 26.478342749529187 80-81 27.924196787148592 22.70331325301205 22.151104417670684 27.221385542168676 82-83 27.907560914343133 22.67018337101231 22.28083396131625 27.14142175332831 84-85 27.860821504836075 22.434367541766107 22.773520914457983 26.93129003893983 86-87 28.225401606425706 23.33082329317269 21.674196787148595 26.76957831325301 88-89 27.741530740276033 22.647427854454204 22.948557089084066 26.662484316185697 90-91 26.91534790253705 22.607385079125848 22.95905551369003 27.518211504647073 92-93 28.485380850796837 22.524783536202786 22.173422010289872 26.816413602710504 94-95 27.373040752351095 22.557993730407524 22.63322884012539 27.435736677115983 96-97 27.974921630094045 22.557993730407524 22.244514106583072 27.22257053291536 98-99 28.186151530356245 22.792272955343705 21.889111891620672 27.132463622679374 100-101 28.42276830491474 22.956369107321965 21.95336008024072 26.667502507522567 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 2.0 26 2.5 27 2.0 28 2.0 29 4.5 30 6.0 31 8.0 32 11.5 33 12.0 34 25.0 35 29.5 36 26.5 37 44.0 38 60.0 39 68.5 40 77.5 41 85.0 42 98.5 43 119.5 44 128.5 45 139.0 46 149.0 47 143.0 48 138.5 49 132.5 50 121.0 51 113.0 52 112.5 53 111.0 54 113.5 55 106.5 56 89.0 57 76.0 58 89.5 59 97.0 60 89.0 61 99.5 62 96.5 63 89.5 64 89.0 65 88.0 66 95.0 67 103.0 68 103.0 69 98.0 70 83.0 71 69.5 72 63.0 73 57.5 74 52.5 75 40.5 76 33.5 77 29.5 78 20.0 79 12.5 80 10.5 81 7.0 82 3.5 83 3.0 84 3.5 85 3.0 86 0.5 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.025 6 0.17500000000000002 7 0.2 8 0.25 9 0.25 10-11 0.21250000000000002 12-13 0.2625 14-15 0.22499999999999998 16-17 0.15 18-19 0.1625 20-21 0.1 22-23 0.2 24-25 0.25 26-27 0.2875 28-29 0.22499999999999998 30-31 0.2 32-33 0.1625 34-35 0.22499999999999998 36-37 0.2875 38-39 0.2375 40-41 0.2375 42-43 0.22499999999999998 44-45 0.2 46-47 0.25 48-49 0.2625 50-51 0.22499999999999998 52-53 0.2875 54-55 0.27499999999999997 56-57 0.1875 58-59 0.27499999999999997 60-61 0.2875 62-63 0.25 64-65 0.375 66-67 0.475 68-69 0.375 70-71 0.375 72-73 0.41250000000000003 74-75 0.3 76-77 0.3125 78-79 0.43750000000000006 80-81 0.4 82-83 0.475 84-85 0.4875 86-87 0.4 88-89 0.375 90-91 0.475 92-93 0.3875 94-95 0.3125 96-97 0.20022525341008632 98-99 0.20030045067601399 100-101 0.15022533800701052 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 3.0 96 3.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3994.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATCTG 15 0.009900334 47.563293 86-87 AACATCA 15 0.009900334 47.563293 28-29 GGACGAG 15 0.009900334 47.563293 74-75 >>END_MODULE SRR5515076 read2 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5515076_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 54 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.972 33.0 33.0 33.0 15.0 33.0 2 29.03375 33.0 33.0 33.0 15.0 33.0 3 29.0915 33.0 33.0 33.0 15.0 33.0 4 32.289 37.0 33.0 37.0 15.0 37.0 5 32.235 37.0 33.0 37.0 15.0 37.0 6 32.30775 37.0 33.0 37.0 15.0 37.0 7 32.28825 37.0 33.0 37.0 15.0 37.0 8 32.2515 37.0 33.0 37.0 15.0 37.0 9 32.13275 37.0 33.0 37.0 15.0 37.0 10-11 31.962 37.0 33.0 37.0 15.0 37.0 12-13 31.8315 37.0 33.0 37.0 15.0 37.0 14-15 33.27375 37.0 33.0 40.0 15.0 40.0 16-17 33.233625 37.0 33.0 40.0 6.0 40.0 18-19 33.010125 37.0 33.0 40.0 6.0 40.0 20-21 32.995625 37.0 33.0 40.0 4.0 40.0 22-23 32.827625 37.0 33.0 40.0 2.0 40.0 24-25 32.433375 37.0 33.0 40.0 2.0 40.0 26-27 32.366125 37.0 33.0 40.0 2.0 40.0 28-29 32.263000000000005 37.0 33.0 40.0 2.0 40.0 30-31 32.058375 37.0 33.0 40.0 2.0 40.0 32-33 31.849125 37.0 33.0 40.0 2.0 40.0 34-35 31.639499999999998 37.0 33.0 40.0 2.0 40.0 36-37 31.538 37.0 33.0 40.0 2.0 40.0 38-39 31.284125000000003 37.0 33.0 40.0 2.0 40.0 40-41 30.750500000000002 37.0 27.0 40.0 2.0 40.0 42-43 30.675 37.0 27.0 40.0 2.0 40.0 44-45 30.758375 37.0 33.0 40.0 2.0 40.0 46-47 30.63275 37.0 33.0 40.0 2.0 40.0 48-49 30.682000000000002 37.0 30.0 40.0 2.0 40.0 50-51 29.670375 35.0 27.0 38.5 2.0 40.0 52-53 29.700625000000002 37.0 27.0 37.0 2.0 40.0 54-55 30.193625 37.0 27.0 37.0 2.0 40.0 56-57 29.935499999999998 37.0 27.0 37.0 2.0 40.0 58-59 29.947000000000003 37.0 27.0 37.0 2.0 40.0 60-61 29.802374999999998 37.0 27.0 37.0 2.0 40.0 62-63 29.461624999999998 37.0 27.0 37.0 2.0 40.0 64-65 29.213124999999998 37.0 27.0 37.0 2.0 40.0 66-67 28.9675 37.0 27.0 37.0 2.0 40.0 68-69 28.682625 37.0 27.0 37.0 2.0 37.0 70-71 28.38025 33.0 27.0 37.0 2.0 37.0 72-73 28.175625 33.0 27.0 37.0 2.0 37.0 74-75 27.936375 33.0 27.0 37.0 2.0 37.0 76-77 27.799374999999998 33.0 27.0 37.0 2.0 37.0 78-79 27.531 33.0 27.0 37.0 2.0 37.0 80-81 27.109125 33.0 22.0 37.0 2.0 37.0 82-83 27.041125 33.0 22.0 37.0 2.0 37.0 84-85 26.893375 33.0 22.0 37.0 2.0 37.0 86-87 26.758875 33.0 22.0 37.0 2.0 37.0 88-89 26.657375000000002 33.0 22.0 37.0 2.0 37.0 90-91 26.425625 33.0 22.0 37.0 2.0 37.0 92-93 26.343375 33.0 22.0 37.0 2.0 37.0 94-95 25.98775 33.0 15.0 37.0 2.0 37.0 96-97 25.551745655109837 33.0 8.5 37.0 2.0 37.0 98-99 25.153903903903903 33.0 2.0 37.0 2.0 37.0 100-101 23.462212212212215 30.0 2.0 35.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 284.0 3 55.0 4 31.0 5 31.0 6 33.0 7 29.0 8 26.0 9 23.0 10 26.0 11 22.0 12 22.0 13 18.0 14 17.0 15 16.0 16 25.0 17 24.0 18 20.0 19 22.0 20 16.0 21 27.0 22 22.0 23 26.0 24 37.0 25 35.0 26 44.0 27 68.0 28 71.0 29 80.0 30 79.0 31 113.0 32 151.0 33 205.0 34 238.0 35 321.0 36 518.0 37 835.0 38 390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.424999999999997 13.225000000000001 25.3 44.05 2 32.9 21.85 27.224999999999998 18.025 3 31.207801950487625 24.456114028507127 22.030507626906726 22.305576394098527 4 28.16020025031289 26.80851063829787 15.594493116395494 29.43679599499374 5 32.12409306980235 29.522141606204656 16.91268451338504 21.441080810607957 6 21.76088044022011 35.74287143571786 16.833416708354175 25.662831415707853 7 20.460806411219636 13.648885549711995 41.12196343601302 24.768344603055347 8 24.580305687797544 17.840140315710347 21.57354046604861 36.0060135304435 9 25.056376847907792 18.767226259082936 26.20897018291155 29.967426710097723 10-11 27.163280662151994 26.962628542763984 18.836217707549537 27.037873087534486 12-13 25.332330072736394 20.453975420115373 27.213443691998997 27.000250815149236 14-15 27.857142857142858 23.157894736842106 23.05764411027569 25.927318295739347 16-17 27.627288688236767 23.325808878856282 22.523200401304237 26.52370203160271 18-19 27.538230132865383 23.640010027575833 22.73752820255703 26.084231637001754 20-21 27.835568366963276 23.411455069557586 22.55921794711117 26.19375861636797 22-23 27.513161193281526 24.492353973426926 21.985460015041365 26.009024818250186 24-25 28.15983965927596 23.98847551045973 21.821370412125766 26.030314418138545 26-27 28.130489335006274 24.0276035131744 21.417816813048933 26.42409033877039 28-29 28.338557993730408 23.398119122257054 22.043887147335422 26.219435736677116 30-31 26.85649774209734 24.222277972905168 22.641746111389864 26.27947817360763 32-33 27.9297365119197 22.77289836888331 22.60978670012547 26.687578419071517 34-35 27.3875 23.0875 22.25 27.275 36-37 26.5375 23.8125 22.925 26.724999999999998 38-39 28.462500000000002 23.2625 21.462500000000002 26.8125 40-41 27.400000000000002 23.0125 22.575 27.0125 42-43 27.525 23.0 23.1875 26.2875 44-45 27.762500000000003 23.474999999999998 21.5375 27.224999999999998 46-47 27.500000000000004 22.125 22.3 28.075 48-49 27.450000000000003 23.2875 22.5875 26.674999999999997 50-51 27.8375 23.925 21.625 26.6125 52-53 26.7125 22.912499999999998 22.4625 27.9125 54-55 27.1375 24.075 21.725 27.0625 56-57 27.925 22.3375 22.8125 26.924999999999997 58-59 27.425 22.9875 22.325 27.2625 60-61 26.575 22.85 22.537499999999998 28.037499999999998 62-63 28.199999999999996 22.925 22.2625 26.6125 64-65 27.975 22.125 22.425 27.474999999999998 66-67 26.7625 23.225 22.025 27.987499999999997 68-69 27.4125 23.150000000000002 22.775000000000002 26.6625 70-71 27.9375 21.912499999999998 21.9 28.249999999999996 72-73 27.200000000000003 22.787499999999998 23.1125 26.900000000000002 74-75 28.475 22.775000000000002 22.05 26.700000000000003 76-77 27.400000000000002 23.225 22.112499999999997 27.2625 78-79 26.950000000000003 23.8625 21.9625 27.224999999999998 80-81 27.3375 23.325000000000003 22.6375 26.700000000000003 82-83 27.537499999999998 22.35 23.325000000000003 26.787499999999998 84-85 27.875 22.2625 22.7125 27.150000000000002 86-87 28.1625 22.375 21.9375 27.525 88-89 26.924999999999997 22.912499999999998 22.6375 27.525 90-91 27.425 23.7375 22.25 26.5875 92-93 27.787499999999998 22.9875 22.2625 26.9625 94-95 27.487499999999997 23.05 21.8125 27.650000000000002 96-97 27.495621716287218 22.829622216662496 22.416812609457093 27.257943457593193 98-99 27.64014014014014 23.06056056056056 21.934434434434436 27.364864864864863 100-101 27.45245245245245 23.035535535535537 21.70920920920921 27.802802802802802 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.5 26 2.5 27 3.0 28 3.0 29 6.0 30 9.5 31 12.5 32 12.0 33 13.5 34 18.0 35 24.5 36 34.0 37 38.0 38 46.0 39 68.5 40 81.0 41 88.5 42 112.0 43 126.5 44 123.0 45 124.5 46 148.0 47 153.0 48 137.5 49 133.0 50 130.0 51 128.0 52 119.5 53 102.5 54 105.5 55 112.0 56 94.0 57 88.5 58 99.0 59 93.5 60 89.5 61 78.5 62 83.5 63 103.5 64 93.0 65 92.0 66 89.0 67 86.5 68 87.0 69 74.5 70 73.0 71 70.5 72 68.0 73 63.5 74 54.5 75 49.5 76 44.5 77 32.5 78 19.5 79 16.0 80 10.0 81 5.5 82 8.5 83 8.0 84 2.5 85 1.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.125 5 0.075 6 0.05 7 0.17500000000000002 8 0.22499999999999998 9 0.22499999999999998 10-11 0.325 12-13 0.325 14-15 0.25 16-17 0.325 18-19 0.27499999999999997 20-21 0.2625 22-23 0.27499999999999997 24-25 0.21250000000000002 26-27 0.375 28-29 0.3125 30-31 0.35000000000000003 32-33 0.375 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 2.0 96 2.0 97 0.0 98 0.0 99 0.0 100 0.0 101 3996.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGCGA 15 0.0097366115 47.767296 90-91 CGGCGAG 15 0.0097366115 47.767296 90-91 >>END_MODULE Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra Read 624626 spots for SRR5515076.sra Written 624626 spots for SRR5515076.sra Read 624625 spots for SRR5515076.sra Written 624625 spots for SRR5515076.sra SRR ids: ['SRR5515076.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ai_7hw5c SRR5515076.sra spots: 12492501 blocks: [[1, 624625], [624626, 1249250], [1249251, 1873875], [1873876, 2498500], [2498501, 3123125], [3123126, 3747750], [3747751, 4372375], [4372376, 4997000], [4997001, 5621625], [5621626, 6246250], [6246251, 6870875], [6870876, 7495500], [7495501, 8120125], [8120126, 8744750], [8744751, 9369375], [9369376, 9994000], [9994001, 10618625], [10618626, 11243250], [11243251, 11867875], [11867876, 12492501]] SRR5515076 file size 2991369 SRR5515076 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5515076 SRR5515076_1.fastq SRR5515076_2.fastq Input file: SRR5515076_1.fastq Paired file: SRR5515076_2.fastq trimmed: SRR5515076-trimmed-pair1.fastq, SRR5515076-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:15:57 2024 >> started Mon Dec 9 17:16:39 2024 >> done (41.559s) 12492501 read pairs processed; of these: 344148 ( 2.75%) short read pairs filtered out after trimming by size control 778112 ( 6.23%) empty read pairs filtered out after trimming by size control 11370241 (91.02%) read pairs available; of these: 3293873 (28.97%) trimmed read pairs available after processing 8076368 (71.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 281 0.00% 19 696 0.01% 20 1129 0.01% 21 1639 0.01% 22 2104 0.02% 23 2598 0.02% 24 3133 0.03% 25 3722 0.03% 26 4211 0.04% 27 4770 0.04% 28 5173 0.05% 29 5490 0.05% 30 5924 0.05% 31 6418 0.06% 32 6529 0.06% 33 6876 0.06% 34 7202 0.06% 35 7122 0.06% 36 7396 0.07% 37 7554 0.07% 38 7651 0.07% 39 7958 0.07% 40 8542 0.08% 41 8644 0.08% 42 8676 0.08% 43 8952 0.08% 44 8876 0.08% 45 9031 0.08% 46 9388 0.08% 47 9629 0.08% 48 11094 0.10% 49 10264 0.09% 50 10305 0.09% 51 10326 0.09% 52 10639 0.09% 53 11270 0.10% 54 11272 0.10% 55 11826 0.10% 56 12328 0.11% 57 13642 0.12% 58 14125 0.12% 59 21031 0.18% 60 26615 0.23% 61 27893 0.25% 62 29219 0.26% 63 28961 0.25% 64 29751 0.26% 65 31008 0.27% 66 31989 0.28% 67 33086 0.29% 68 33410 0.29% 69 32947 0.29% 70 34155 0.30% 71 32831 0.29% 72 31622 0.28% 73 31755 0.28% 74 30787 0.27% 75 33574 0.30% 76 27682 0.24% 77 32092 0.28% 78 35097 0.31% 79 37319 0.33% 80 38485 0.34% 81 41235 0.36% 82 43430 0.38% 83 44329 0.39% 84 45122 0.40% 85 47386 0.42% 86 49999 0.44% 87 52188 0.46% 88 51036 0.45% 89 53675 0.47% 90 58356 0.51% 91 65121 0.57% 92 73069 0.64% 93 87745 0.77% 94 90800 0.80% 95 107743 0.95% 96 127522 1.12% 97 159505 1.40% 98 240708 2.12% 99 298715 2.63% 100 591882 5.21% 101 8044961 70.75% 11370241 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=226.41 fanout-score-rank=12 prefix-density=1.21 prefix-fanout=27.0 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=506.07 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=27.8 sequence=GCGGCGGCGGGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=238.80 fanout-score-rank=11 prefix-density=1.16 prefix-fanout=27.6 sequence=CGGCGGCGGCGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=484.76 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=27.8 sequence=GCGGCGGCGGCT SRR5515076 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:17:31 Started mapping on | Dec 09 17:17:31 Finished on | Dec 09 17:20:00 Mapping speed, Million of reads per hour | 274.72 Number of input reads | 11370241 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 9661039 Uniquely mapped reads % | 84.97% Average mapped length | 190.02 Number of splices: Total | 5188816 Number of splices: Annotated (sjdb) | 4951370 Number of splices: GT/AG | 5108853 Number of splices: GC/AG | 65242 Number of splices: AT/AC | 3502 Number of splices: Non-canonical | 11219 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 129844 % of reads mapped to multiple loci | 1.14% Number of reads mapped to too many loci | 13407 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.04% % of reads unmapped: other | 0.73% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1634771 1634771 1634771 N_multimapping 129844 129844 129844 N_noFeature 216287 4887308 4824750 N_ambiguous 188947 13420 13905 UnstrandedReadsAssigned:9255805 PositiveStrandReadsAssigned:4760311 NegativeStrandReadsAssigned:4822384 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR5515076 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5515076-trimmed-pair1.fastq SRR5515076-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,370,241 reads, 9,505,923 reads pseudoaligned [quant] estimated average fragment length: 238.644 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR5515076.ke.tsv 35125 SRR5515076.se.tsv 88098 total ==> SRR5515076.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.479 5.19593e-06 1.05863e-06 PNS24247 1044 806.356 37.012 6.53206 PNS24249 1928 1690.36 114.9 9.67336 PNS24246 1044 806.356 37.012 6.53206 PNS24248 1044 806.356 37.012 6.53206 PNS24244 1471 1233.36 59.0639 6.81504 PNS24243 293 57.8284 12 29.5308 KQK14069 1603 1365.36 3785.39 394.548 KQK14071 474 237.981 988.728 591.248 ==> SRR5515076.se.tsv <== BRADI_1g14170v3 4886 BRADI_1g53295v3 30 BRADI_1g59795v3 75 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 625 BRADI_1g74790v3 212 BRADI_1g09890v3 1 BRADI_1g77505v3 67 BRADI_1g48960v3 0 SRR5515076 completed mapping pipeline successfully