Starting /dee2/code/volunteer_pipeline.sh SRR5578432 current disk space = 1523748122624 free memory = 1582346200 SRR5578432 SRAfilesize 6424a75995b8ac9ae4fe9add69cf2dbf SRR5578432.sra SRR5578432.sra file validated SRR5578432 is paired end SRR5578432 is conventional basespace SRR5578432 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2325 34.0 33.0 34.0 33.0 34.0 2 33.471 34.0 34.0 34.0 33.0 34.0 3 33.52 34.0 34.0 34.0 33.0 34.0 4 33.491 34.0 34.0 34.0 33.0 34.0 5 33.52675 34.0 34.0 34.0 33.0 34.0 6 37.25375 38.0 38.0 38.0 36.0 38.0 7 37.432 38.0 38.0 38.0 37.0 38.0 8 37.51 38.0 38.0 38.0 37.0 38.0 9 37.54975 38.0 38.0 38.0 38.0 38.0 10-14 37.52305 38.0 38.0 38.0 38.0 38.0 15-19 37.5311 38.0 38.0 38.0 38.0 38.0 20-24 37.53835 38.0 38.0 38.0 38.0 38.0 25-29 37.5135 38.0 38.0 38.0 38.0 38.0 30-34 37.527950000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.509699999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.40755 38.0 38.0 38.0 37.6 38.0 45-49 37.39215 38.0 38.0 38.0 37.0 38.0 50-54 37.374199999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.36295 38.0 38.0 38.0 37.0 38.0 60-64 37.2825 38.0 38.0 38.0 37.0 38.0 65-69 37.3286 38.0 38.0 38.0 37.0 38.0 70-74 37.2791 38.0 38.0 38.0 37.0 38.0 75-79 37.2776 38.0 38.0 38.0 37.0 38.0 80-84 37.248000000000005 38.0 38.0 38.0 36.8 38.0 85-89 37.18025 38.0 38.0 38.0 36.4 38.0 90-94 37.145050000000005 38.0 38.0 38.0 36.0 38.0 95-99 37.072050000000004 38.0 38.0 38.0 36.0 38.0 100-104 37.013799999999996 38.0 38.0 38.0 35.6 38.0 105-109 36.99885 38.0 38.0 38.0 35.8 38.0 110-114 36.9405 38.0 38.0 38.0 35.2 38.0 115-119 36.73685 38.0 38.0 38.0 35.0 38.0 120-124 36.72255 38.0 38.0 38.0 35.0 38.0 125-129 36.56925 38.0 38.0 38.0 34.4 38.0 130-134 36.2413 38.0 38.0 38.0 34.0 38.0 135-139 36.1813 38.0 38.0 38.0 33.8 38.0 140-144 35.931799999999996 38.0 38.0 38.0 33.0 38.0 145-149 35.4965 38.0 37.2 38.0 32.2 38.0 150-151 31.796499999999998 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 0.0 20 2.0 21 5.0 22 1.0 23 3.0 24 8.0 25 9.0 26 11.0 27 11.0 28 12.0 29 33.0 30 24.0 31 32.0 32 49.0 33 64.0 34 97.0 35 132.0 36 353.0 37 3146.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.23425692695214 9.798488664987405 9.47103274559194 39.496221662468514 2 24.825 13.950000000000001 33.475 27.750000000000004 3 22.225 18.65 22.175 36.95 4 26.1 26.150000000000002 20.575 27.175 5 27.250000000000004 29.725 23.35 19.675 6 21.875 33.650000000000006 22.75 21.725 7 16.150000000000002 23.625 38.975 21.25 8 21.525 22.3 29.225 26.950000000000003 9 20.05 21.55 32.875 25.525 10-14 23.05 26.61 24.67 25.669999999999998 15-19 23.44 25.465 25.645 25.45 20-24 22.765 25.795 25.685000000000002 25.755 25-29 23.425 25.2 25.580000000000002 25.795 30-34 23.14 26.119999999999997 25.474999999999998 25.264999999999997 35-39 23.66 25.215 25.555 25.569999999999997 40-44 23.59 25.290000000000003 25.845000000000002 25.275 45-49 22.91 25.535000000000004 25.53 26.025 50-54 23.77 25.535000000000004 25.56 25.135 55-59 23.75 25.035 25.235000000000003 25.979999999999997 60-64 23.445 25.2 25.740000000000002 25.615 65-69 23.31 25.064999999999998 26.055 25.569999999999997 70-74 23.65 24.725 25.34 26.284999999999997 75-79 23.825 24.855 25.35 25.97 80-84 23.5 25.324999999999996 25.790000000000003 25.385 85-89 24.22 25.525 24.715 25.540000000000003 90-94 24.285 25.025 25.28 25.41 95-99 24.035 25.019999999999996 25.305 25.64 100-104 24.709999999999997 25.485000000000003 24.335 25.47 105-109 24.41 25.045 25.180000000000003 25.365 110-114 23.985 25.61 24.8 25.605 115-119 24.73 25.195 24.44 25.635 120-124 24.23 25.53 24.565 25.674999999999997 125-129 24.02 25.185000000000002 24.34 26.455000000000002 130-134 24.42 25.27 24.085 26.224999999999998 135-139 24.785 25.505 23.74 25.97 140-144 24.08 26.21 23.66 26.05 145-149 23.7 25.85 24.48 25.97 150-151 24.587500000000002 26.825 23.325000000000003 25.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 2.5 29 4.0 30 6.0 31 9.0 32 13.0 33 22.5 34 34.5 35 38.0 36 52.5 37 74.0 38 88.0 39 112.5 40 134.0 41 154.0 42 164.5 43 175.5 44 180.5 45 170.5 46 192.0 47 199.0 48 200.5 49 188.0 50 159.5 51 147.0 52 131.5 53 129.5 54 106.0 55 85.5 56 86.0 57 84.0 58 78.0 59 75.5 60 75.5 61 74.0 62 61.5 63 47.0 64 53.5 65 54.0 66 45.0 67 41.0 68 43.0 69 39.5 70 31.5 71 28.5 72 26.0 73 18.0 74 15.0 75 13.0 76 9.0 77 6.5 78 5.0 79 3.5 80 2.5 81 3.0 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83514813876931 97.575 2 1.063560395036718 2.1 3 0.07596859964547988 0.22499999999999998 4 0.02532286654849329 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.8250000000000002 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.75 0.0 0.0 0.0 0.0 108-109 3.0999999999999996 0.0 0.0 0.0 0.0 110-111 3.4625 0.0 0.0 0.0 0.0 112-113 4.0125 0.0 0.0 0.0 0.0 114-115 4.574999999999999 0.0 0.0 0.0 0.0 116-117 5.075 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.3375 0.0 0.0 0.0 0.0 122-123 7.1875 0.0 0.0 0.0 0.0 124-125 7.7625 0.0 0.0 0.0 0.0 126-127 8.2375 0.0 0.0 0.0 0.0 128-129 8.875 0.0 0.0 0.0 0.0 130-131 9.475 0.0 0.0 0.0 0.0 132-133 10.3125 0.0 0.0 0.0 0.0 134-135 11.037500000000001 0.0 0.0 0.0 0.0 136-137 11.95 0.0 0.0 0.0 0.0 138-139 12.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578432 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8745 33.0 32.0 34.0 30.0 34.0 2 32.06325 33.0 33.0 34.0 31.0 34.0 3 31.9545 33.0 33.0 34.0 29.0 34.0 4 31.982 33.0 33.0 34.0 31.0 34.0 5 31.90875 33.0 33.0 34.0 29.0 34.0 6 36.11175 38.0 38.0 38.0 33.0 38.0 7 35.94825 38.0 38.0 38.0 33.0 38.0 8 35.984 38.0 38.0 38.0 33.0 38.0 9 35.98575 38.0 38.0 38.0 33.0 38.0 10-14 35.87579999999999 38.0 37.4 38.0 32.4 38.0 15-19 35.7585 38.0 37.2 38.0 31.6 38.0 20-24 35.61559999999999 38.0 37.0 38.0 29.8 38.0 25-29 35.50915 38.0 37.0 38.0 29.0 38.0 30-34 35.3608 38.0 37.0 38.0 29.0 38.0 35-39 35.25215 38.0 36.6 38.0 28.8 38.0 40-44 34.9613 38.0 36.0 38.0 27.4 38.0 45-49 34.7847 38.0 35.8 38.0 27.0 38.0 50-54 34.56095 38.0 35.4 38.0 26.2 38.0 55-59 34.213499999999996 38.0 35.0 38.0 23.2 38.0 60-64 34.0105 38.0 34.4 38.0 24.4 38.0 65-69 33.6031 38.0 34.0 38.0 17.6 38.0 70-74 33.3778 38.0 33.8 38.0 16.0 38.0 75-79 32.8681 37.6 32.4 38.0 16.0 38.0 80-84 32.27 37.0 30.8 38.0 15.0 38.0 85-89 31.803000000000004 37.0 29.6 38.0 15.0 38.0 90-94 31.1801 36.6 28.2 38.0 14.6 38.0 95-99 30.389100000000003 36.0 26.2 38.0 14.2 38.0 100-104 29.64875 35.0 24.2 38.0 13.4 38.0 105-109 29.070100000000004 34.8 23.0 38.0 13.0 38.0 110-114 28.000300000000003 34.0 17.4 38.0 4.2 38.0 115-119 26.949900000000003 34.0 15.0 38.0 2.0 38.0 120-124 25.694499999999998 32.4 14.4 37.6 2.0 38.0 125-129 24.372499999999995 31.0 13.4 36.8 2.0 38.0 130-134 22.74305 27.4 8.6 35.8 2.0 38.0 135-139 21.0721 24.0 2.0 35.0 2.0 38.0 140-144 19.04945 19.8 2.0 34.6 2.0 38.0 145-149 16.61695 8.8 2.0 34.0 2.0 38.0 150-151 12.825624999999999 2.0 2.0 30.5 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 37.0 3 4.0 4 7.0 5 5.0 6 6.0 7 6.0 8 9.0 9 5.0 10 9.0 11 15.0 12 12.0 13 24.0 14 16.0 15 20.0 16 25.0 17 27.0 18 35.0 19 40.0 20 63.0 21 59.0 22 55.0 23 75.0 24 82.0 25 113.0 26 114.0 27 153.0 28 161.0 29 193.0 30 213.0 31 254.0 32 282.0 33 393.0 34 416.0 35 453.0 36 452.0 37 167.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.6 17.224999999999998 11.899999999999999 32.275 2 29.000751314800898 24.517906336088156 25.945404457801153 20.535937891309793 3 23.62816336757705 26.058631921824105 25.757955399649212 24.555249310949637 4 25.012531328320804 30.37593984962406 19.749373433583962 24.862155388471177 5 27.81257830117765 32.92407917815084 18.892508143322477 20.370834377349034 6 23.58679339669835 35.36768384192096 19.65982991495748 21.38569284642321 7 22.611305652826413 17.983991995998 34.4672336168084 24.937468734367183 8 23.705926481620406 23.680920230057513 23.730932733183295 28.882220555138783 9 23.05 23.425 26.724999999999998 26.8 10-14 26.225735441264757 25.765459275565338 22.858715229137484 25.15009005403242 15-19 25.543206168018422 24.672073695804546 24.476819865825572 25.307900270351457 20-24 25.946514423076923 25.961538461538463 23.677884615384613 24.4140625 25-29 26.145296149802235 25.759775697191206 23.451659740649877 24.64326841235668 30-34 25.9235158674542 25.893482831114223 24.276704374812294 23.90629692661928 35-39 25.652195683741425 25.852486104852034 24.215111912272796 24.280206299133745 40-44 25.771233974358974 25.570913461538463 24.163661858974358 24.494190705128204 45-49 25.956530448717945 24.694511217948715 24.534254807692307 24.814703525641026 50-54 25.625876226717402 25.96635289405167 24.384137792910074 24.02363308632085 55-59 26.005308227753016 25.048825679803695 24.117381942010116 24.828484150433173 60-64 26.477659787617714 24.774594269685434 24.70947705870567 24.038268883991183 65-69 26.191907051282055 25.53084935897436 24.228766025641026 24.048477564102562 70-74 26.03864250675743 25.703273600961058 24.23165482030233 24.026429071979177 75-79 26.08173076923077 25.255408653846157 24.534254807692307 24.128605769230766 80-84 25.588500450766304 25.538415306020234 24.42151657818291 24.451567665030552 85-89 25.948923385077617 25.23284927391087 24.316474712068104 24.501752628943414 90-94 25.645645645645647 25.565565565565567 24.51951951951952 24.26926926926927 95-99 26.05058852992737 25.239168544953667 24.412722263961932 24.297520661157023 100-104 26.51139494114701 25.875281743050337 23.911845730027547 23.70147758577511 105-109 25.756209935897434 26.13681891025641 24.073517628205128 24.033453525641026 110-114 25.733894399358782 26.17974150886685 24.005610660254483 24.080753431519888 115-119 26.657984371869365 26.051893408134642 23.938088559406935 23.35203366058906 120-124 26.643633268238947 26.348204897100796 23.484051875219066 23.52410995944119 125-129 26.619929894842265 25.78868302453681 23.805708562844266 23.785678517776667 130-134 27.314165497896216 26.112001602885194 23.76277299138449 22.811059907834103 135-139 27.68375726016423 26.782495493691165 23.122371319847787 22.411375926296813 140-144 27.798068744684045 27.34277280232151 22.369540201130736 22.48961825186371 145-149 27.889522665866107 27.469228459921947 22.060442309616732 22.580806564595214 150-151 28.596469262551643 28.108175785651685 20.77125328659071 22.524101665205958 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 3.5 30 8.0 31 9.5 32 13.0 33 19.0 34 23.5 35 28.0 36 44.0 37 65.5 38 83.0 39 102.0 40 112.5 41 124.0 42 131.5 43 161.0 44 192.0 45 191.5 46 180.5 47 175.0 48 179.0 49 166.0 50 144.5 51 148.0 52 149.5 53 122.0 54 107.5 55 111.0 56 97.5 57 91.0 58 99.0 59 86.5 60 77.0 61 79.0 62 72.0 63 66.5 64 66.0 65 67.5 66 60.0 67 52.5 68 48.0 69 42.0 70 44.0 71 39.5 72 27.5 73 21.0 74 20.5 75 15.5 76 6.5 77 3.0 78 3.0 79 1.5 80 0.5 81 1.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.22499999999999998 4 0.25 5 0.22499999999999998 6 0.05 7 0.05 8 0.025 9 0.0 10-14 0.06 15-19 0.13 20-24 0.16 25-29 0.135 30-34 0.11 35-39 0.145 40-44 0.16 45-49 0.16 50-54 0.13999999999999999 55-59 0.155 60-64 0.18 65-69 0.16 70-74 0.11 75-79 0.16 80-84 0.16999999999999998 85-89 0.15 90-94 0.1 95-99 0.17500000000000002 100-104 0.17500000000000002 105-109 0.16 110-114 0.19 115-119 0.18 120-124 0.145 125-129 0.15 130-134 0.18 135-139 0.13999999999999999 140-144 0.065 145-149 0.06999999999999999 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98862199747155 97.875 2 0.8849557522123894 1.7500000000000002 3 0.12642225031605564 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.11249999999999999 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.4625 0.0 0.0 0.0 0.0 110-111 2.7875 0.0 0.0 0.0 0.0 112-113 3.0875000000000004 0.0 0.0 0.0 0.0 114-115 3.45 0.0 0.0 0.0 0.0 116-117 3.7874999999999996 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.5625 0.0 0.0 0.0 0.0 122-123 5.0625 0.0 0.0 0.0 0.0 124-125 5.3625 0.0 0.0 0.0 0.0 126-127 5.65 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 6.987500000000001 0.0 0.0 0.0 0.0 136-137 7.45 0.0 0.0 0.0 0.0 138-139 7.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAACA 10 0.0067743617 145.37975 145 CGTGCTC 10 0.0070373793 143.5625 9 >>END_MODULE Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164273 spots for SRR5578432.sra Written 1164273 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra Read 1164255 spots for SRR5578432.sra Written 1164255 spots for SRR5578432.sra SRR ids: ['SRR5578432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k1pmw958 SRR5578432.sra spots: 23285118 blocks: [[1, 1164255], [1164256, 2328510], [2328511, 3492765], [3492766, 4657020], [4657021, 5821275], [5821276, 6985530], [6985531, 8149785], [8149786, 9314040], [9314041, 10478295], [10478296, 11642550], [11642551, 12806805], [12806806, 13971060], [13971061, 15135315], [15135316, 16299570], [16299571, 17463825], [17463826, 18628080], [18628081, 19792335], [19792336, 20956590], [20956591, 22120845], [22120846, 23285118]] SRR5578432 file size 7868862 SRR5578432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578432 SRR5578432_1.fastq SRR5578432_2.fastq Input file: SRR5578432_1.fastq Paired file: SRR5578432_2.fastq trimmed: SRR5578432-trimmed-pair1.fastq, SRR5578432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:20:27 2024 >> started Mon Dec 9 17:20:53 2024 >> done (25.176s) 23285118 read pairs processed; of these: 52383 ( 0.22%) short read pairs filtered out after trimming by size control 81627 ( 0.35%) empty read pairs filtered out after trimming by size control 23151108 (99.42%) read pairs available; of these: 12730091 (54.99%) trimmed read pairs available after processing 10421017 (45.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 17 0.00% 21 13 0.00% 22 8 0.00% 23 14 0.00% 24 21 0.00% 25 23 0.00% 26 18 0.00% 27 16 0.00% 28 21 0.00% 29 16 0.00% 30 24 0.00% 31 28 0.00% 32 28 0.00% 33 31 0.00% 34 21 0.00% 35 35 0.00% 36 49 0.00% 37 42 0.00% 38 36 0.00% 39 65 0.00% 40 64 0.00% 41 70 0.00% 42 72 0.00% 43 79 0.00% 44 101 0.00% 45 105 0.00% 46 111 0.00% 47 136 0.00% 48 163 0.00% 49 162 0.00% 50 220 0.00% 51 229 0.00% 52 291 0.00% 53 262 0.00% 54 344 0.00% 55 367 0.00% 56 365 0.00% 57 416 0.00% 58 516 0.00% 59 634 0.00% 60 732 0.00% 61 781 0.00% 62 908 0.00% 63 1136 0.00% 64 1214 0.01% 65 1415 0.01% 66 1561 0.01% 67 1780 0.01% 68 2063 0.01% 69 2474 0.01% 70 2834 0.01% 71 3003 0.01% 72 3472 0.01% 73 3890 0.02% 74 4346 0.02% 75 5023 0.02% 76 5503 0.02% 77 6129 0.03% 78 6715 0.03% 79 7744 0.03% 80 8526 0.04% 81 9629 0.04% 82 11070 0.05% 83 12587 0.05% 84 15954 0.07% 85 18413 0.08% 86 19114 0.08% 87 20613 0.09% 88 21614 0.09% 89 22679 0.10% 90 24468 0.11% 91 25956 0.11% 92 27746 0.12% 93 29838 0.13% 94 32145 0.14% 95 33894 0.15% 96 35605 0.15% 97 37639 0.16% 98 39695 0.17% 99 41759 0.18% 100 43847 0.19% 101 45686 0.20% 102 48988 0.21% 103 51120 0.22% 104 53712 0.23% 105 56375 0.24% 106 59619 0.26% 107 61493 0.27% 108 63952 0.28% 109 66712 0.29% 110 68581 0.30% 111 70994 0.31% 112 74505 0.32% 113 76870 0.33% 114 81141 0.35% 115 85247 0.37% 116 87194 0.38% 117 90885 0.39% 118 93044 0.40% 119 95927 0.41% 120 98369 0.42% 121 101231 0.44% 122 105973 0.46% 123 108348 0.47% 124 113545 0.49% 125 116873 0.50% 126 121894 0.53% 127 124664 0.54% 128 128231 0.55% 129 132698 0.57% 130 136082 0.59% 131 140865 0.61% 132 145480 0.63% 133 149519 0.65% 134 155497 0.67% 135 162329 0.70% 136 170038 0.73% 137 175528 0.76% 138 184310 0.80% 139 194794 0.84% 140 205487 0.89% 141 215934 0.93% 142 235437 1.02% 143 251226 1.09% 144 275651 1.19% 145 309634 1.34% 146 359089 1.55% 147 452052 1.95% 148 622991 2.69% 149 1033520 4.46% 150 4069987 17.58% 151 10421017 45.01% 23151108 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=24 prefix-density=0.62 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=13.94 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.0 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=18 prefix-density=0.65 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=68.24 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578432 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:21:40 Started mapping on | Dec 09 17:21:41 Finished on | Dec 09 17:26:14 Mapping speed, Million of reads per hour | 305.29 Number of input reads | 23151108 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 21314577 Uniquely mapped reads % | 92.07% Average mapped length | 287.12 Number of splices: Total | 22254073 Number of splices: Annotated (sjdb) | 21006291 Number of splices: GT/AG | 21979246 Number of splices: GC/AG | 251916 Number of splices: AT/AC | 10027 Number of splices: Non-canonical | 12884 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313820 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 43849 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.36% % of reads unmapped: other | 1.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1554649 1554649 1554649 N_multimapping 313820 313820 313820 N_noFeature 693017 20697519 868940 N_ambiguous 522451 2749 82425 UnstrandedReadsAssigned:20099109 PositiveStrandReadsAssigned:614309 NegativeStrandReadsAssigned:20363212 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5578432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578432-trimmed-pair1.fastq SRR5578432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,151,108 reads, 20,512,243 reads pseudoaligned [quant] estimated average fragment length: 228.824 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52973 SRR5578432.ke.tsv 35125 SRR5578432.se.tsv 88098 total ==> SRR5578432.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 708.337 0 0 PNS24247 1044 816.176 48.255 3.97853 PNS24249 1928 1700.18 60.1243 2.37969 PNS24246 1044 816.176 48.255 3.97853 PNS24248 1044 816.176 48.255 3.97853 PNS24244 1471 1243.18 118.111 6.39324 PNS24243 293 107.837 0 0 KQK14069 1603 1375.18 1795.58 87.8638 KQK14071 474 258.585 22.6133 5.88471 ==> SRR5578432.se.tsv <== BRADI_1g14170v3 1926 BRADI_1g53295v3 105 BRADI_1g59795v3 345 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 2397 BRADI_1g74790v3 142 BRADI_1g09890v3 2 BRADI_1g77505v3 436 BRADI_1g48960v3 0 SRR5578432 completed mapping pipeline successfully