Starting /dee2/code/volunteer_pipeline.sh SRR5578433 current disk space = 1523702095872 free memory = 1579655236 SRR5578433 SRAfilesize 716b85d034229f06dfe3866ef316c57f SRR5578433.sra SRR5578433.sra file validated SRR5578433 is paired end SRR5578433 is conventional basespace SRR5578433 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42775 34.0 33.0 34.0 33.0 34.0 2 33.31175 34.0 34.0 34.0 33.0 34.0 3 33.37825 34.0 34.0 34.0 33.0 34.0 4 33.49925 34.0 34.0 34.0 33.0 34.0 5 33.5245 34.0 34.0 34.0 33.0 34.0 6 37.1975 38.0 38.0 38.0 36.0 38.0 7 37.40675 38.0 38.0 38.0 37.0 38.0 8 37.566 38.0 38.0 38.0 38.0 38.0 9 37.6165 38.0 38.0 38.0 38.0 38.0 10-14 37.574200000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.581649999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.562799999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.535849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.52605 38.0 38.0 38.0 38.0 38.0 35-39 37.4512 38.0 38.0 38.0 37.6 38.0 40-44 37.38655 38.0 38.0 38.0 37.0 38.0 45-49 37.29265 38.0 38.0 38.0 37.0 38.0 50-54 37.2502 38.0 38.0 38.0 36.6 38.0 55-59 37.20864999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.145050000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.1375 38.0 38.0 38.0 36.0 38.0 70-74 37.07645 38.0 38.0 38.0 36.0 38.0 75-79 37.015600000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.923449999999995 38.0 38.0 38.0 35.2 38.0 85-89 36.82445 38.0 38.0 38.0 34.6 38.0 90-94 36.75035 38.0 38.0 38.0 34.8 38.0 95-99 36.5673 38.0 38.0 38.0 34.2 38.0 100-104 36.52825 38.0 38.0 38.0 34.0 38.0 105-109 36.237449999999995 38.0 37.8 38.0 33.6 38.0 110-114 36.007349999999995 38.0 37.2 38.0 33.0 38.0 115-119 35.9514 38.0 37.0 38.0 33.0 38.0 120-124 35.56955000000001 38.0 36.0 38.0 31.0 38.0 125-129 35.37935 38.0 36.0 38.0 30.6 38.0 130-134 35.2097 38.0 36.0 38.0 30.0 38.0 135-139 34.8391 38.0 35.2 38.0 28.0 38.0 140-144 34.4144 38.0 35.0 38.0 26.2 38.0 145-149 33.713300000000004 38.0 34.6 38.0 22.8 38.0 150-151 29.211 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 0.0 18 2.0 19 1.0 20 5.0 21 8.0 22 7.0 23 11.0 24 8.0 25 10.0 26 18.0 27 18.0 28 25.0 29 35.0 30 40.0 31 44.0 32 54.0 33 89.0 34 119.0 35 301.0 36 695.0 37 2503.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.58404558404558 11.188811188811188 8.702408702408702 34.52473452473453 2 24.575 13.575000000000001 31.674999999999997 30.175 3 23.125 19.35 22.8 34.725 4 28.449999999999996 26.3 20.525 24.725 5 27.695771828871653 28.946710032524393 21.816362271703778 21.541155866900176 6 22.900000000000002 29.599999999999998 24.6 22.900000000000002 7 17.625 23.35 39.6 19.425 8 21.025 21.325 29.825000000000003 27.825 9 20.625 21.325 32.25 25.8 10-14 22.875 25.72 25.31 26.095000000000002 15-19 23.69 24.88 25.485000000000003 25.945 20-24 24.3 24.91 25.040000000000003 25.75 25-29 23.575 25.585 25.415 25.424999999999997 30-34 22.855 25.564999999999998 25.655 25.924999999999997 35-39 23.57 24.305 25.674999999999997 26.450000000000003 40-44 23.565 24.349999999999998 26.025 26.06 45-49 23.555 25.19 25.56 25.695 50-54 23.425 24.98 25.31 26.284999999999997 55-59 23.724999999999998 24.79 25.224999999999998 26.26 60-64 23.575 25.480000000000004 24.37 26.575 65-69 23.845 24.98 25.705 25.47 70-74 23.705000000000002 25.06 24.68 26.555 75-79 24.025 24.43 25.785000000000004 25.759999999999998 80-84 24.195 24.795 24.945 26.064999999999998 85-89 24.33 24.27 25.515 25.885 90-94 24.58 24.279999999999998 24.735 26.405 95-99 24.62 24.605 25.080000000000002 25.695 100-104 24.545 25.224999999999998 24.36 25.869999999999997 105-109 24.81 25.014999999999997 24.625 25.55 110-114 24.285 24.775 24.365000000000002 26.575 115-119 24.595 24.545 24.695 26.165 120-124 24.8 24.83 24.545 25.825 125-129 24.87 25.040000000000003 24.46 25.629999999999995 130-134 24.68 25.155 24.11 26.055 135-139 24.5 24.65 24.52 26.33 140-144 24.605 25.245 23.885 26.265 145-149 24.43 25.205 23.605 26.76 150-151 25.284624046040282 24.88427373952208 23.920930814462654 25.910171399974978 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.5 28 2.5 29 4.0 30 8.0 31 9.5 32 14.0 33 22.5 34 27.5 35 30.0 36 48.5 37 69.0 38 79.5 39 100.5 40 115.0 41 132.5 42 165.5 43 179.0 44 179.5 45 177.5 46 173.5 47 187.0 48 193.5 49 170.5 50 153.5 51 140.5 52 126.0 53 122.5 54 121.0 55 116.0 56 108.0 57 95.5 58 83.5 59 82.0 60 76.5 61 69.5 62 68.5 63 63.5 64 63.0 65 60.5 66 51.5 67 48.5 68 41.0 69 34.5 70 31.0 71 31.0 72 28.0 73 22.0 74 20.5 75 14.5 76 10.0 77 7.5 78 4.5 79 4.0 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4750000000000005 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34525308486528 98.625 2 0.6043817678166709 1.2 3 0.02518257365902795 0.075 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.7374999999999998 0.0 0.0 0.0 0.0 98-99 1.9874999999999998 0.0 0.0 0.0 0.0 100-101 2.2750000000000004 0.0 0.0 0.0 0.0 102-103 2.5875 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.325 0.0 0.0 0.0 0.0 108-109 3.75 0.0 0.0 0.0 0.0 110-111 4.275 0.0 0.0 0.0 0.0 112-113 4.7125 0.0 0.0 0.0 0.0 114-115 5.2375 0.0 0.0 0.0 0.0 116-117 5.875 0.0 0.0 0.0 0.0 118-119 6.4375 0.0 0.0 0.0 0.0 120-121 7.0375 0.0 0.0 0.0 0.0 122-123 7.8625 0.0 0.0 0.0 0.0 124-125 8.475000000000001 0.0 0.0 0.0 0.0 126-127 8.975 0.0 0.0 0.0 0.0 128-129 9.75 0.0 0.0 0.0 0.0 130-131 10.7625 0.0 0.0 0.0 0.0 132-133 11.575 0.0 0.0 0.0 0.0 134-135 12.4 0.0 0.0 0.0 0.0 136-137 13.15 0.0 0.0 0.0 0.0 138-139 13.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 40 0.0076702754 19.072369 1 >>END_MODULE SRR5578433 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8375 33.0 33.0 34.0 32.0 34.0 2 33.008 33.0 33.0 34.0 32.0 34.0 3 32.99025 34.0 33.0 34.0 32.0 34.0 4 32.91975 34.0 33.0 34.0 32.0 34.0 5 32.9315 34.0 33.0 34.0 32.0 34.0 6 37.0825 38.0 38.0 38.0 36.0 38.0 7 37.1535 38.0 38.0 38.0 37.0 38.0 8 37.122 38.0 38.0 38.0 37.0 38.0 9 37.14425 38.0 38.0 38.0 37.0 38.0 10-14 37.15265 38.0 38.0 38.0 36.8 38.0 15-19 37.146100000000004 38.0 38.0 38.0 36.8 38.0 20-24 37.1075 38.0 38.0 38.0 37.0 38.0 25-29 37.062400000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.091699999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.048649999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0586 38.0 38.0 38.0 36.8 38.0 45-49 37.06475 38.0 38.0 38.0 36.8 38.0 50-54 37.0097 38.0 38.0 38.0 36.2 38.0 55-59 36.9017 38.0 38.0 38.0 36.0 38.0 60-64 36.8375 38.0 38.0 38.0 36.0 38.0 65-69 36.77055 38.0 38.0 38.0 35.6 38.0 70-74 36.69794999999999 38.0 38.0 38.0 35.2 38.0 75-79 36.5527 38.0 38.0 38.0 34.6 38.0 80-84 36.539249999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.3937 38.0 38.0 38.0 34.0 38.0 90-94 36.2447 38.0 38.0 38.0 34.0 38.0 95-99 36.17815 38.0 38.0 38.0 33.8 38.0 100-104 35.967549999999996 38.0 38.0 38.0 33.0 38.0 105-109 35.82855 38.0 38.0 38.0 32.8 38.0 110-114 35.56655 38.0 37.0 38.0 31.4 38.0 115-119 35.3562 38.0 36.4 38.0 31.0 38.0 120-124 35.00565 38.0 35.8 38.0 28.8 38.0 125-129 34.720150000000004 38.0 35.6 38.0 27.2 38.0 130-134 34.318000000000005 38.0 35.0 38.0 24.6 38.0 135-139 33.3769 38.0 33.4 38.0 19.0 38.0 140-144 32.76275 38.0 33.0 38.0 13.0 38.0 145-149 31.01995 38.0 31.0 38.0 4.2 38.0 150-151 25.4735 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 2.0 5 2.0 6 1.0 7 2.0 8 1.0 9 2.0 10 2.0 11 2.0 12 7.0 13 1.0 14 5.0 15 5.0 16 5.0 17 2.0 18 6.0 19 5.0 20 8.0 21 10.0 22 10.0 23 14.0 24 22.0 25 31.0 26 27.0 27 30.0 28 34.0 29 39.0 30 42.0 31 58.0 32 83.0 33 114.0 34 175.0 35 286.0 36 667.0 37 2295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.36836836836837 15.815815815815814 11.736736736736738 29.07907907907908 2 30.407601900475118 22.680670167541887 26.481620405101275 20.43010752688172 3 23.2982982982983 24.64964964964965 26.526526526526528 25.525525525525527 4 27.595696772579437 30.94821115836878 19.089316987740805 22.366775081310983 5 26.99524643482612 31.74881160870653 19.46459844883663 21.79134350763072 6 23.5 33.125 20.849999999999998 22.525000000000002 7 22.05 17.825 35.3 24.825 8 22.75 23.325000000000003 24.675 29.25 9 24.0 22.325 26.5 27.175 10-14 26.43 25.39 22.36 25.82 15-19 25.424999999999997 25.41 23.95 25.215 20-24 26.150000000000002 25.75 23.36 24.740000000000002 25-29 25.885 25.88 23.14 25.095 30-34 26.46 25.115 23.91 24.515 35-39 26.30131506575329 24.8012400620031 24.066203310165506 24.831241562078105 40-44 26.205000000000002 24.94 24.235 24.62 45-49 26.565 24.765 23.86 24.81 50-54 26.340000000000003 25.025 23.73 24.905 55-59 26.105 24.89 23.925 25.080000000000002 60-64 25.947594759475944 24.56745674567457 24.482448244824482 25.002500250025 65-69 26.455291058211643 23.999799959992 24.53490698139628 25.01000200040008 70-74 26.255251050210042 24.96999399879976 23.909781956391278 24.86497299459892 75-79 26.16154038509627 24.66616654163541 24.186046511627907 24.98624656164041 80-84 26.296574143535885 25.481370342585645 23.465866466616657 24.756189047261813 85-89 26.82 24.975 23.66 24.545 90-94 26.5 24.62 24.43 24.45 95-99 26.119999999999997 24.955 24.2 24.725 100-104 27.08 25.495 23.064999999999998 24.36 105-109 26.810000000000002 24.9 24.02 24.27 110-114 26.691672918229557 25.46636659164791 23.760940235058765 24.081020255063766 115-119 27.086354317715887 25.311265563278162 23.571178558927947 24.031201560078003 120-124 27.400000000000002 25.729999999999997 23.76 23.11 125-129 27.966398319915996 25.53627681384069 23.03115155757788 23.466173308665432 130-134 27.861393069653484 25.27626381319066 23.84619230961548 23.016150807540377 135-139 28.09 25.814999999999998 23.544999999999998 22.55 140-144 28.975 25.56 23.595 21.87 145-149 28.410000000000004 26.334999999999997 23.375 21.88 150-151 30.112499999999997 26.174999999999997 22.15 21.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 0.5 25 0.5 26 1.0 27 0.5 28 0.5 29 3.5 30 7.5 31 12.5 32 13.5 33 16.0 34 24.5 35 28.5 36 38.0 37 52.0 38 65.5 39 97.0 40 120.0 41 124.0 42 140.0 43 164.5 44 171.0 45 162.0 46 165.0 47 163.0 48 162.5 49 164.5 50 145.5 51 136.0 52 136.0 53 121.5 54 114.5 55 108.5 56 96.5 57 94.5 58 93.5 59 91.5 60 86.5 61 91.5 62 92.5 63 77.5 64 73.5 65 79.0 66 72.5 67 60.5 68 61.0 69 58.0 70 49.0 71 42.5 72 28.5 73 24.0 74 23.5 75 15.5 76 10.0 77 4.0 78 3.5 79 2.5 80 1.5 81 2.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.025 3 0.1 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.02 70-74 0.02 75-79 0.025 80-84 0.025 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.025 115-119 0.005 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21855306276784 98.4 2 0.7310310057978321 1.4500000000000002 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2125 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 1.9625 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.5875 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.2625 0.0 0.0 0.0 0.0 108-109 3.675 0.0 0.0 0.0 0.0 110-111 4.1875 0.0 0.0 0.0 0.0 112-113 4.6625 0.0 0.0 0.0 0.0 114-115 5.199999999999999 0.0 0.0 0.0 0.0 116-117 5.85 0.0 0.0 0.0 0.0 118-119 6.3875 0.0 0.0 0.0 0.0 120-121 6.9625 0.0 0.0 0.0 0.0 122-123 7.7875 0.0 0.0 0.0125 0.0 124-125 8.425 0.0 0.0 0.025 0.0 126-127 8.9 0.0 0.0 0.025 0.0 128-129 9.6875 0.0 0.0 0.025 0.0 130-131 10.725000000000001 0.0 0.0 0.025 0.0 132-133 11.575 0.0 0.0 0.025 0.0 134-135 12.3875 0.0 0.0 0.025 0.0 136-137 13.075 0.0 0.0 0.025 0.0 138-139 13.7125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTACTT 10 0.006830828 145.0 8 >>END_MODULE Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926377 spots for SRR5578433.sra Written 926377 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra Read 926358 spots for SRR5578433.sra Written 926358 spots for SRR5578433.sra SRR ids: ['SRR5578433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4qpht2be SRR5578433.sra spots: 18527179 blocks: [[1, 926358], [926359, 1852716], [1852717, 2779074], [2779075, 3705432], [3705433, 4631790], [4631791, 5558148], [5558149, 6484506], [6484507, 7410864], [7410865, 8337222], [8337223, 9263580], [9263581, 10189938], [10189939, 11116296], [11116297, 12042654], [12042655, 12969012], [12969013, 13895370], [13895371, 14821728], [14821729, 15748086], [15748087, 16674444], [16674445, 17600802], [17600803, 18527179]] SRR5578433 file size 6256552 SRR5578433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578433 SRR5578433_1.fastq SRR5578433_2.fastq Input file: SRR5578433_1.fastq Paired file: SRR5578433_2.fastq trimmed: SRR5578433-trimmed-pair1.fastq, SRR5578433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:27:59 2024 >> started Mon Dec 9 17:28:21 2024 >> done (21.937s) 18527179 read pairs processed; of these: 24337 ( 0.13%) short read pairs filtered out after trimming by size control 24446 ( 0.13%) empty read pairs filtered out after trimming by size control 18478396 (99.74%) read pairs available; of these: 10210667 (55.26%) trimmed read pairs available after processing 8267729 (44.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 15 0.00% 20 12 0.00% 21 17 0.00% 22 21 0.00% 23 12 0.00% 24 19 0.00% 25 16 0.00% 26 13 0.00% 27 16 0.00% 28 22 0.00% 29 29 0.00% 30 27 0.00% 31 30 0.00% 32 17 0.00% 33 26 0.00% 34 38 0.00% 35 25 0.00% 36 49 0.00% 37 49 0.00% 38 36 0.00% 39 47 0.00% 40 61 0.00% 41 64 0.00% 42 78 0.00% 43 78 0.00% 44 92 0.00% 45 89 0.00% 46 129 0.00% 47 141 0.00% 48 149 0.00% 49 156 0.00% 50 231 0.00% 51 224 0.00% 52 257 0.00% 53 311 0.00% 54 343 0.00% 55 364 0.00% 56 409 0.00% 57 493 0.00% 58 585 0.00% 59 681 0.00% 60 704 0.00% 61 888 0.00% 62 994 0.01% 63 1155 0.01% 64 1263 0.01% 65 1411 0.01% 66 1659 0.01% 67 1934 0.01% 68 2315 0.01% 69 2912 0.02% 70 3427 0.02% 71 3505 0.02% 72 3777 0.02% 73 4122 0.02% 74 4606 0.02% 75 5082 0.03% 76 5579 0.03% 77 6145 0.03% 78 6970 0.04% 79 7872 0.04% 80 8819 0.05% 81 9931 0.05% 82 11181 0.06% 83 12219 0.07% 84 14479 0.08% 85 15727 0.09% 86 16926 0.09% 87 17765 0.10% 88 19098 0.10% 89 20214 0.11% 90 21704 0.12% 91 23426 0.13% 92 24975 0.14% 93 26802 0.15% 94 28454 0.15% 95 29640 0.16% 96 30930 0.17% 97 33076 0.18% 98 33717 0.18% 99 35409 0.19% 100 37734 0.20% 101 39248 0.21% 102 41171 0.22% 103 43200 0.23% 104 44977 0.24% 105 47107 0.25% 106 48726 0.26% 107 49622 0.27% 108 51028 0.28% 109 53138 0.29% 110 54048 0.29% 111 56012 0.30% 112 58621 0.32% 113 60243 0.33% 114 62774 0.34% 115 64710 0.35% 116 65969 0.36% 117 67473 0.37% 118 68124 0.37% 119 68592 0.37% 120 71190 0.39% 121 73018 0.40% 122 75441 0.41% 123 77118 0.42% 124 80466 0.44% 125 82086 0.44% 126 84200 0.46% 127 85516 0.46% 128 86370 0.47% 129 88129 0.48% 130 89852 0.49% 131 91958 0.50% 132 94734 0.51% 133 97618 0.53% 134 99968 0.54% 135 103672 0.56% 136 106486 0.58% 137 109483 0.59% 138 113125 0.61% 139 118452 0.64% 140 123219 0.67% 141 130201 0.70% 142 140431 0.76% 143 152342 0.82% 144 169535 0.92% 145 194382 1.05% 146 230778 1.25% 147 299362 1.62% 148 436676 2.36% 149 848195 4.59% 150 4067853 22.01% 151 8267729 44.74% 18478396 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=14 prefix-density=0.85 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=26.35 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=12 prefix-density=0.58 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.15 sequence-density-rank=21 fanout-score=88.14 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=15.9 sequence=GCCGCCGCCGCC SRR5578433 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:29:08 Started mapping on | Dec 09 17:29:08 Finished on | Dec 09 17:32:04 Mapping speed, Million of reads per hour | 377.97 Number of input reads | 18478396 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 17281598 Uniquely mapped reads % | 93.52% Average mapped length | 287.71 Number of splices: Total | 17677006 Number of splices: Annotated (sjdb) | 16596556 Number of splices: GT/AG | 17453380 Number of splices: GC/AG | 201846 Number of splices: AT/AC | 8842 Number of splices: Non-canonical | 12938 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254537 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 39237 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.79% % of reads unmapped: other | 1.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 959121 959121 959121 N_multimapping 254537 254537 254537 N_noFeature 719626 16779230 904693 N_ambiguous 380533 2475 63901 UnstrandedReadsAssigned:16181439 PositiveStrandReadsAssigned:499893 NegativeStrandReadsAssigned:16313004 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5578433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578433-trimmed-pair1.fastq SRR5578433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,478,396 reads, 16,426,367 reads pseudoaligned [quant] estimated average fragment length: 239.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR5578433.ke.tsv 35125 SRR5578433.se.tsv 88098 total ==> SRR5578433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.207 0 0 PNS24247 1044 805.678 45.9481 5.0621 PNS24249 1928 1689.68 83.3696 4.37953 PNS24246 1044 805.678 45.9481 5.0621 PNS24248 1044 805.678 45.9481 5.0621 PNS24244 1471 1232.68 89.786 6.46522 PNS24243 293 110.709 0 0 KQK14069 1603 1364.68 1174.21 76.3731 KQK14071 474 255.286 35.3103 12.2772 ==> SRR5578433.se.tsv <== BRADI_1g14170v3 1370 BRADI_1g53295v3 162 BRADI_1g59795v3 234 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 1733 BRADI_1g74790v3 80 BRADI_1g09890v3 3 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR5578433 completed mapping pipeline successfully