Starting /dee2/code/volunteer_pipeline.sh SRR5578434 current disk space = 1523699585024 free memory = 1579658192 SRR5578434 SRAfilesize 7adb558c8c93ed530f4cd1f8462be2f4 SRR5578434.sra SRR5578434.sra file validated SRR5578434 is paired end SRR5578434 is conventional basespace SRR5578434 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69075 34.0 34.0 34.0 33.0 34.0 2 33.457 34.0 34.0 34.0 33.0 34.0 3 33.52775 34.0 34.0 34.0 33.0 34.0 4 33.6085 34.0 34.0 34.0 33.0 34.0 5 33.632 34.0 34.0 34.0 33.0 34.0 6 37.26225 38.0 38.0 38.0 36.0 38.0 7 37.58425 38.0 38.0 38.0 37.0 38.0 8 37.6955 38.0 38.0 38.0 38.0 38.0 9 37.7115 38.0 38.0 38.0 38.0 38.0 10-14 37.69945 38.0 38.0 38.0 38.0 38.0 15-19 37.688 38.0 38.0 38.0 38.0 38.0 20-24 37.6814 38.0 38.0 38.0 38.0 38.0 25-29 37.660799999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.630700000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.5822 38.0 38.0 38.0 38.0 38.0 40-44 37.5115 38.0 38.0 38.0 38.0 38.0 45-49 37.478449999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.4243 38.0 38.0 38.0 37.0 38.0 55-59 37.42864999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.379599999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.375150000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.246050000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.195049999999995 38.0 38.0 38.0 36.2 38.0 80-84 37.13785 38.0 38.0 38.0 36.0 38.0 85-89 37.05319999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.98350000000001 38.0 38.0 38.0 35.8 38.0 95-99 36.819599999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.704 38.0 38.0 38.0 34.8 38.0 105-109 36.60955 38.0 38.0 38.0 34.0 38.0 110-114 36.431799999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.263999999999996 38.0 37.8 38.0 33.8 38.0 120-124 36.13675 38.0 37.6 38.0 33.2 38.0 125-129 35.8971 38.0 37.0 38.0 32.8 38.0 130-134 35.51175 38.0 36.0 38.0 31.0 38.0 135-139 35.23735 38.0 35.8 38.0 29.6 38.0 140-144 34.6926 38.0 35.0 38.0 27.4 38.0 145-149 34.156349999999996 38.0 35.0 38.0 25.6 38.0 150-151 30.226625 36.0 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 1.0 18 2.0 19 2.0 20 4.0 21 5.0 22 1.0 23 9.0 24 7.0 25 7.0 26 13.0 27 12.0 28 21.0 29 23.0 30 30.0 31 32.0 32 52.0 33 55.0 34 114.0 35 227.0 36 629.0 37 2747.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.0648815653965 10.22142121524202 7.569515962924819 35.14418125643666 2 24.925 13.775 33.275 28.025 3 22.66700025018764 18.088566424818612 24.31823867900926 34.92619464598449 4 27.474999999999998 26.150000000000002 21.525 24.85 5 25.324999999999996 30.85 23.799999999999997 20.025000000000002 6 22.225 32.550000000000004 23.5 21.725 7 17.625 22.8 38.9 20.674999999999997 8 20.525 22.675 28.775000000000002 28.025 9 20.3 22.575 30.9 26.224999999999998 10-14 23.74737473747375 26.002600260026004 24.172417241724172 26.07760776077608 15-19 23.82 24.404999999999998 25.745 26.029999999999998 20-24 23.91 24.595 25.8 25.695 25-29 23.89 25.14 25.305 25.665 30-34 24.11 25.040000000000003 24.65 26.200000000000003 35-39 23.64 25.374999999999996 24.95 26.035000000000004 40-44 24.285 24.565 25.005 26.145000000000003 45-49 23.785 25.235000000000003 25.045 25.935000000000002 50-54 23.669999999999998 25.069999999999997 25.06 26.200000000000003 55-59 24.035 25.180000000000003 24.955 25.83 60-64 24.03 25.324999999999996 25.16 25.485000000000003 65-69 23.974999999999998 24.69 25.224999999999998 26.11 70-74 24.23 25.424999999999997 24.32 26.025 75-79 24.654999999999998 24.58 24.425 26.340000000000003 80-84 23.985 24.779999999999998 25.035 26.200000000000003 85-89 24.310000000000002 24.905 24.77 26.015 90-94 24.645 24.435000000000002 24.765 26.155 95-99 24.385 24.445 25.03 26.14 100-104 24.365000000000002 25.009999999999998 24.43 26.195 105-109 24.845 24.895 24.495 25.765 110-114 24.925 25.115 24.3 25.66 115-119 24.529999999999998 25.66 24.325 25.485000000000003 120-124 24.795 25.46 23.845 25.900000000000002 125-129 24.665 25.14 23.5 26.695 130-134 24.755 25.19 23.93 26.125 135-139 24.5 25.385 23.36 26.755000000000003 140-144 24.555 25.395 23.485 26.565 145-149 24.7 25.465 23.56 26.275 150-151 23.7 26.0375 22.95 27.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 1.5 28 1.0 29 2.5 30 8.5 31 10.5 32 10.5 33 18.5 34 27.0 35 40.0 36 58.0 37 75.5 38 88.0 39 101.0 40 130.5 41 149.0 42 160.0 43 172.0 44 189.5 45 183.5 46 166.5 47 174.5 48 170.5 49 152.0 50 131.5 51 116.5 52 109.5 53 108.0 54 103.0 55 103.0 56 100.5 57 100.5 58 95.0 59 86.5 60 90.5 61 85.0 62 75.0 63 64.5 64 65.5 65 68.5 66 59.0 67 53.0 68 48.0 69 39.5 70 36.5 71 37.5 72 30.5 73 27.0 74 23.0 75 14.5 76 9.5 77 5.5 78 4.5 79 6.0 80 4.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52679705359411 96.975 2 1.3462026924053847 2.65 3 0.12700025400050802 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 2.075 0.0 0.0 0.0 0.0 98-99 2.425 0.0 0.0 0.0 0.0 100-101 2.95 0.0 0.0 0.0 0.0 102-103 3.3875 0.0 0.0 0.0 0.0 104-105 4.0 0.0 0.0 0.0 0.0 106-107 4.5 0.0 0.0 0.0 0.0 108-109 5.125 0.0 0.0 0.0 0.0 110-111 5.7125 0.0 0.0 0.0 0.0 112-113 6.487500000000001 0.0 0.0 0.0 0.0 114-115 7.275 0.0 0.0 0.0 0.0 116-117 8.3125 0.0 0.0 0.0 0.0 118-119 9.1875 0.0 0.0 0.0 0.0 120-121 9.9125 0.0 0.0 0.0 0.0 122-123 10.6375 0.0 0.0 0.0 0.0 124-125 11.4875 0.0 0.0 0.0 0.0 126-127 12.25 0.0 0.0 0.0 0.0 128-129 13.3375 0.0 0.0 0.0 0.0 130-131 14.1625 0.0 0.0 0.0 0.0 132-133 14.8625 0.0 0.0 0.0 0.0 134-135 15.924999999999999 0.0 0.0 0.0 0.0 136-137 16.9125 0.0 0.0 0.0 0.0 138-139 17.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578434 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.129 33.0 33.0 34.0 33.0 34.0 2 33.23775 34.0 33.0 34.0 33.0 34.0 3 33.2205 34.0 33.0 34.0 33.0 34.0 4 33.17625 34.0 33.0 34.0 33.0 34.0 5 33.17175 34.0 33.0 34.0 33.0 34.0 6 37.42125 38.0 38.0 38.0 38.0 38.0 7 37.37475 38.0 38.0 38.0 37.0 38.0 8 37.41375 38.0 38.0 38.0 38.0 38.0 9 37.39925 38.0 38.0 38.0 38.0 38.0 10-14 37.415949999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.34495 38.0 38.0 38.0 38.0 38.0 20-24 37.2926 38.0 38.0 38.0 37.8 38.0 25-29 37.25215 38.0 38.0 38.0 37.4 38.0 30-34 37.2548 38.0 38.0 38.0 37.4 38.0 35-39 37.28515 38.0 38.0 38.0 37.6 38.0 40-44 37.301700000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.2841 38.0 38.0 38.0 38.0 38.0 50-54 37.226200000000006 38.0 38.0 38.0 37.4 38.0 55-59 37.202749999999995 38.0 38.0 38.0 37.2 38.0 60-64 37.11865 38.0 38.0 38.0 37.0 38.0 65-69 37.0924 38.0 38.0 38.0 37.0 38.0 70-74 36.936 38.0 38.0 38.0 36.2 38.0 75-79 36.906099999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.8532 38.0 38.0 38.0 36.0 38.0 85-89 36.782300000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.6716 38.0 38.0 38.0 35.0 38.0 95-99 36.56975 38.0 38.0 38.0 35.0 38.0 100-104 36.4131 38.0 38.0 38.0 34.4 38.0 105-109 36.288999999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.021950000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.8369 38.0 38.0 38.0 33.2 38.0 120-124 35.641600000000004 38.0 37.4 38.0 32.8 38.0 125-129 35.2781 38.0 36.2 38.0 30.8 38.0 130-134 34.837399999999995 38.0 35.8 38.0 29.6 38.0 135-139 34.25765 38.0 34.4 38.0 25.4 38.0 140-144 33.49285 38.0 33.0 38.0 21.4 38.0 145-149 32.351 38.0 33.0 38.0 12.0 38.0 150-151 26.891624999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 2.0 6 1.0 7 8.0 8 1.0 9 2.0 10 1.0 11 2.0 12 4.0 13 4.0 14 1.0 15 2.0 16 1.0 17 8.0 18 6.0 19 4.0 20 8.0 21 3.0 22 8.0 23 9.0 24 6.0 25 15.0 26 17.0 27 21.0 28 15.0 29 29.0 30 22.0 31 47.0 32 61.0 33 99.0 34 133.0 35 253.0 36 641.0 37 2558.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.225 18.224999999999998 10.05 29.5 2 28.65 22.925 27.750000000000004 20.674999999999997 3 23.9 24.55 28.375 23.175 4 26.724999999999998 32.15 19.400000000000002 21.725 5 27.900000000000002 32.65 19.425 20.025000000000002 6 23.65 34.55 20.150000000000002 21.65 7 22.375 18.224999999999998 34.849999999999994 24.55 8 23.275000000000002 21.45 23.974999999999998 31.3 9 23.65 22.55 26.0 27.800000000000004 10-14 26.240000000000002 25.295 22.755 25.71 15-19 26.131532883220803 24.561140285071268 23.53088272068017 25.776444111027757 20-24 25.96149037259315 25.01625406351588 23.935983995999 25.08627156789197 25-29 26.144608456342254 24.723542656992745 23.6977733299975 25.4340755566675 30-34 26.498722892773074 25.171533029498672 23.428657284519456 24.901086793208794 35-39 25.774795974565663 25.31918089420718 23.53677464577179 25.369248485455365 40-44 26.56124899919936 24.229383506805444 23.8791032826261 25.330264211369098 45-49 26.126126126126124 24.664664664664667 23.803803803803802 25.405405405405407 50-54 26.07695001751138 24.425876819932956 24.03061990293691 25.466553259618752 55-59 26.596224147428515 24.07231208372978 24.332715709349493 24.99874805949221 60-64 26.489734601902853 23.685528292438658 25.222834251377062 24.60190285428142 65-69 26.45953395139063 24.16938110749186 24.660486093710848 24.710598847406665 70-74 26.51803607214429 24.223446893787575 24.298597194388776 24.95991983967936 75-79 25.664913598797895 24.33258201853243 24.25244177310293 25.750062609566744 80-84 25.79416775227979 25.072652570397835 23.945285098707288 25.187894578615094 85-89 26.205723434060435 24.92495497298379 24.029417650590354 24.839903942365417 90-94 26.319475711641406 25.148831857521635 23.84811646405523 24.683575966781728 95-99 26.757744082470097 25.071310614021918 23.670119601661412 24.50082570184657 100-104 26.773822041960845 24.916128386159933 24.044865054328778 24.26518451755045 105-109 26.844662625857836 24.830937233882683 23.989380353654262 24.33501978660522 110-114 27.0034581265975 25.274394827845438 23.715731970129806 24.006415075427253 115-119 27.337877117369953 25.46356620226521 23.1382179011727 24.060338779192143 120-124 28.15835630167878 25.387121022300175 23.066900526183915 23.387622149837135 125-129 27.76469409229844 25.434684571829436 23.33015984366388 23.470461492208248 130-134 28.580735692091814 24.987471183722562 23.338678961611706 23.09311416257392 135-139 28.24236354531798 26.114171256885328 23.495242864296443 22.14822233350025 140-144 28.78818227341012 26.27441161742614 23.074611917876815 21.86279419128693 145-149 28.43696805847602 26.189045759487335 23.49554420746971 21.878441974566936 150-151 29.498561960735277 25.82218331874453 23.008628235588347 21.670626484931848 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 1.5 28 3.5 29 3.5 30 4.0 31 4.5 32 10.0 33 19.0 34 22.5 35 28.5 36 40.5 37 63.0 38 82.0 39 91.5 40 120.0 41 141.0 42 141.5 43 160.0 44 176.0 45 175.0 46 166.5 47 153.0 48 147.0 49 147.0 50 132.5 51 127.5 52 125.0 53 103.5 54 105.5 55 107.0 56 99.0 57 101.0 58 95.5 59 96.5 60 98.5 61 92.0 62 86.5 63 82.5 64 72.5 65 69.5 66 72.0 67 59.0 68 52.0 69 59.5 70 53.5 71 43.0 72 44.5 73 38.0 74 24.0 75 14.0 76 10.0 77 9.5 78 10.5 79 6.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.025 25-29 0.075 30-34 0.165 35-39 0.135 40-44 0.08 45-49 0.1 50-54 0.065 55-59 0.155 60-64 0.15 65-69 0.22499999999999998 70-74 0.2 75-79 0.17500000000000002 80-84 0.21 85-89 0.06 90-94 0.055 95-99 0.08499999999999999 100-104 0.145 105-109 0.185 110-114 0.23500000000000001 115-119 0.22999999999999998 120-124 0.22499999999999998 125-129 0.215 130-134 0.22999999999999998 135-139 0.15 140-144 0.15 145-149 0.13 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47133757961784 96.625 2 1.2993630573248407 2.55 3 0.12738853503184713 0.375 4 0.07643312101910828 0.3 5 0.0 0.0 6 0.025477707006369425 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0125 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.075 0.025 0.0 0.0 0.0 72-73 0.0875 0.025 0.0 0.0 0.0 74-75 0.125 0.025 0.0 0.0 0.0 76-77 0.16249999999999998 0.025 0.0 0.0 0.0 78-79 0.21250000000000002 0.025 0.0 0.0 0.0 80-81 0.2875 0.025 0.0 0.0 0.0 82-83 0.42500000000000004 0.025 0.0 0.0 0.0 84-85 0.6625 0.025 0.0 0.0 0.0 86-87 0.75 0.025 0.0 0.0 0.0 88-89 0.875 0.025 0.0 0.0 0.0 90-91 1.125 0.025 0.0 0.0 0.0 92-93 1.4 0.025 0.0 0.0 0.0 94-95 1.65 0.025 0.0 0.0 0.0 96-97 2.075 0.025 0.0 0.0 0.0 98-99 2.4375 0.025 0.0 0.0 0.0 100-101 2.975 0.025 0.0 0.0 0.0 102-103 3.4125 0.025 0.0 0.0 0.0 104-105 4.025 0.025 0.0 0.0 0.0 106-107 4.4875 0.025 0.0 0.0 0.0 108-109 5.05 0.025 0.0 0.0 0.0 110-111 5.625 0.025 0.0 0.0 0.0 112-113 6.387499999999999 0.025 0.0 0.0 0.0 114-115 7.15 0.025 0.0 0.0 0.0 116-117 8.1875 0.025 0.0 0.0 0.0 118-119 9.0625 0.025 0.0 0.0 0.0 120-121 9.7875 0.025 0.0 0.0 0.0 122-123 10.5125 0.025 0.0 0.0 0.0 124-125 11.3625 0.025 0.0 0.0 0.0 126-127 12.1125 0.025 0.0 0.0 0.0 128-129 13.175 0.025 0.0 0.0 0.0 130-131 14.0 0.025 0.0 0.0 0.0 132-133 14.7375 0.025 0.0 0.0 0.0 134-135 15.837499999999999 0.025 0.0 0.0 0.0 136-137 16.775 0.025 0.0 0.0 0.0 138-139 17.7 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTAT 10 0.006830828 145.0 1 AAAAAAA 40 0.0076550315 36.25 145 >>END_MODULE Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767998 spots for SRR5578434.sra Written 767998 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra Read 767987 spots for SRR5578434.sra Written 767987 spots for SRR5578434.sra SRR ids: ['SRR5578434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3rdb8q9u SRR5578434.sra spots: 15359751 blocks: [[1, 767987], [767988, 1535974], [1535975, 2303961], [2303962, 3071948], [3071949, 3839935], [3839936, 4607922], [4607923, 5375909], [5375910, 6143896], [6143897, 6911883], [6911884, 7679870], [7679871, 8447857], [8447858, 9215844], [9215845, 9983831], [9983832, 10751818], [10751819, 11519805], [11519806, 12287792], [12287793, 13055779], [13055780, 13823766], [13823767, 14591753], [14591754, 15359751]] SRR5578434 file size 5183215 SRR5578434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578434 SRR5578434_1.fastq SRR5578434_2.fastq Input file: SRR5578434_1.fastq Paired file: SRR5578434_2.fastq trimmed: SRR5578434-trimmed-pair1.fastq, SRR5578434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:26:03 2024 >> started Mon Dec 9 17:26:22 2024 >> done (18.201s) 15359751 read pairs processed; of these: 15502 ( 0.10%) short read pairs filtered out after trimming by size control 20104 ( 0.13%) empty read pairs filtered out after trimming by size control 15324145 (99.77%) read pairs available; of these: 8651263 (56.46%) trimmed read pairs available after processing 6672882 (43.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 14 0.00% 20 14 0.00% 21 13 0.00% 22 19 0.00% 23 15 0.00% 24 16 0.00% 25 21 0.00% 26 15 0.00% 27 18 0.00% 28 23 0.00% 29 35 0.00% 30 24 0.00% 31 29 0.00% 32 27 0.00% 33 33 0.00% 34 31 0.00% 35 26 0.00% 36 44 0.00% 37 49 0.00% 38 38 0.00% 39 64 0.00% 40 66 0.00% 41 75 0.00% 42 66 0.00% 43 88 0.00% 44 90 0.00% 45 89 0.00% 46 126 0.00% 47 140 0.00% 48 176 0.00% 49 192 0.00% 50 201 0.00% 51 249 0.00% 52 276 0.00% 53 309 0.00% 54 300 0.00% 55 387 0.00% 56 418 0.00% 57 492 0.00% 58 530 0.00% 59 597 0.00% 60 676 0.00% 61 835 0.01% 62 987 0.01% 63 1095 0.01% 64 1250 0.01% 65 1392 0.01% 66 1574 0.01% 67 1781 0.01% 68 2040 0.01% 69 2528 0.02% 70 2950 0.02% 71 3123 0.02% 72 3630 0.02% 73 4014 0.03% 74 4486 0.03% 75 5055 0.03% 76 5493 0.04% 77 6153 0.04% 78 6858 0.04% 79 7776 0.05% 80 8687 0.06% 81 9459 0.06% 82 11061 0.07% 83 12177 0.08% 84 14157 0.09% 85 15525 0.10% 86 16444 0.11% 87 17597 0.11% 88 18933 0.12% 89 20092 0.13% 90 21127 0.14% 91 23174 0.15% 92 24555 0.16% 93 26602 0.17% 94 28496 0.19% 95 29993 0.20% 96 31296 0.20% 97 32948 0.22% 98 33801 0.22% 99 35659 0.23% 100 37138 0.24% 101 39245 0.26% 102 41015 0.27% 103 43393 0.28% 104 44621 0.29% 105 46558 0.30% 106 48772 0.32% 107 49459 0.32% 108 51049 0.33% 109 52743 0.34% 110 53896 0.35% 111 55496 0.36% 112 57437 0.37% 113 59350 0.39% 114 62172 0.41% 115 64487 0.42% 116 65504 0.43% 117 66903 0.44% 118 66474 0.43% 119 68045 0.44% 120 69382 0.45% 121 70604 0.46% 122 72234 0.47% 123 74829 0.49% 124 76253 0.50% 125 78881 0.51% 126 79751 0.52% 127 80239 0.52% 128 80945 0.53% 129 83262 0.54% 130 84102 0.55% 131 84550 0.55% 132 87452 0.57% 133 89084 0.58% 134 90991 0.59% 135 93216 0.61% 136 95779 0.63% 137 97203 0.63% 138 99566 0.65% 139 103785 0.68% 140 106794 0.70% 141 111436 0.73% 142 119129 0.78% 143 125703 0.82% 144 137582 0.90% 145 156960 1.02% 146 183846 1.20% 147 231918 1.51% 148 331207 2.16% 149 636681 4.15% 150 3243226 21.16% 151 6672882 43.54% 15324145 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=11 prefix-density=0.89 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=18.10 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.0 sequence=GTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGTTAG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=4.72 fanout-score-rank=9 prefix-density=0.85 prefix-fanout=3.5 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=18.74 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=AAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR5578434 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:27:15 Started mapping on | Dec 09 17:27:15 Finished on | Dec 09 17:30:26 Mapping speed, Million of reads per hour | 288.83 Number of input reads | 15324145 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13646456 Uniquely mapped reads % | 89.05% Average mapped length | 285.63 Number of splices: Total | 13168253 Number of splices: Annotated (sjdb) | 12407873 Number of splices: GT/AG | 12997104 Number of splices: GC/AG | 155636 Number of splices: AT/AC | 6275 Number of splices: Non-canonical | 9238 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306030 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 80771 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.02% % of reads unmapped: other | 2.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1381696 1381696 1381696 N_multimapping 306030 306030 306030 N_noFeature 527411 13268284 640487 N_ambiguous 314999 1724 50225 UnstrandedReadsAssigned:12804046 PositiveStrandReadsAssigned:376448 NegativeStrandReadsAssigned:12955744 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=139 echo kmer=135 SRR5578434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578434-trimmed-pair1.fastq SRR5578434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,324,145 reads, 13,071,525 reads pseudoaligned [quant] estimated average fragment length: 217.479 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR5578434.ke.tsv 35125 SRR5578434.se.tsv 88098 total ==> SRR5578434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 719.834 0 0 PNS24247 1044 827.521 41.5374 5.19171 PNS24249 1928 1711.52 63.6166 3.84449 PNS24246 1044 827.521 41.5374 5.19171 PNS24248 1044 827.521 41.5374 5.19171 PNS24244 1471 1254.52 38.7712 3.19655 PNS24243 293 116.102 0 0 KQK14069 1603 1386.52 1473.89 109.948 KQK14071 474 270.653 64.5646 24.6735 ==> SRR5578434.se.tsv <== BRADI_1g14170v3 1731 BRADI_1g53295v3 47 BRADI_1g59795v3 429 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 2058 BRADI_1g74790v3 51 BRADI_1g09890v3 6 BRADI_1g77505v3 201 BRADI_1g48960v3 0 SRR5578434 completed mapping pipeline successfully