Starting /dee2/code/volunteer_pipeline.sh SRR5578435 current disk space = 1523777413120 free memory = 1580618540 SRR5578435 SRAfilesize 16b14e9537923c5dad7ce7fd651b4dc0 SRR5578435.sra SRR5578435.sra file validated SRR5578435 is paired end SRR5578435 is conventional basespace SRR5578435 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.47675 34.0 34.0 34.0 33.0 34.0 2 33.44025 34.0 34.0 34.0 33.0 34.0 3 33.53575 34.0 34.0 34.0 33.0 34.0 4 33.51925 34.0 34.0 34.0 33.0 34.0 5 33.5135 34.0 34.0 34.0 33.0 34.0 6 37.207 38.0 38.0 38.0 36.0 38.0 7 37.4315 38.0 38.0 38.0 37.0 38.0 8 37.4865 38.0 38.0 38.0 37.0 38.0 9 37.53125 38.0 38.0 38.0 38.0 38.0 10-14 37.5147 38.0 38.0 38.0 38.0 38.0 15-19 37.49655 38.0 38.0 38.0 38.0 38.0 20-24 37.5351 38.0 38.0 38.0 38.0 38.0 25-29 37.51445 38.0 38.0 38.0 38.0 38.0 30-34 37.5126 38.0 38.0 38.0 38.0 38.0 35-39 37.4379 38.0 38.0 38.0 37.6 38.0 40-44 37.3472 38.0 38.0 38.0 37.0 38.0 45-49 37.38195 38.0 38.0 38.0 37.0 38.0 50-54 37.34095 38.0 38.0 38.0 37.0 38.0 55-59 37.27665 38.0 38.0 38.0 37.0 38.0 60-64 37.2739 38.0 38.0 38.0 37.0 38.0 65-69 37.2635 38.0 38.0 38.0 37.0 38.0 70-74 37.184850000000004 38.0 38.0 38.0 36.6 38.0 75-79 37.1492 38.0 38.0 38.0 36.2 38.0 80-84 37.087250000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.9368 38.0 38.0 38.0 35.8 38.0 90-94 36.908750000000005 38.0 38.0 38.0 35.4 38.0 95-99 36.82365 38.0 38.0 38.0 35.0 38.0 100-104 36.78060000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.676 38.0 38.0 38.0 35.0 38.0 110-114 36.60815 38.0 38.0 38.0 34.8 38.0 115-119 36.45305 38.0 38.0 38.0 34.0 38.0 120-124 36.33675 38.0 38.0 38.0 34.0 38.0 125-129 36.25735000000001 38.0 38.0 38.0 34.0 38.0 130-134 36.0592 38.0 38.0 38.0 33.4 38.0 135-139 35.80285 38.0 37.2 38.0 32.8 38.0 140-144 35.643950000000004 38.0 36.4 38.0 32.8 38.0 145-149 35.12695 38.0 36.0 38.0 31.0 38.0 150-151 31.93675 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 3.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 1.0 17 3.0 18 2.0 19 3.0 20 2.0 21 5.0 22 1.0 23 1.0 24 4.0 25 12.0 26 15.0 27 10.0 28 20.0 29 29.0 30 27.0 31 48.0 32 48.0 33 86.0 34 98.0 35 145.0 36 440.0 37 2991.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.449999999999996 11.55 6.225 31.775 2 23.785678517776667 13.019529293940913 34.501752628943414 28.693039559339006 3 22.525000000000002 19.400000000000002 24.55 33.525 4 29.025000000000002 24.75 20.9 25.324999999999996 5 27.275 30.8 21.3 20.625 6 22.275 31.6 23.599999999999998 22.525000000000002 7 20.3 21.125 38.45 20.125 8 21.375 21.9 29.65 27.075 9 20.424999999999997 19.875 33.074999999999996 26.625 10-14 24.515 25.22 24.62 25.645 15-19 24.18 24.715 25.06 26.045 20-24 24.19 25.025 25.11 25.674999999999997 25-29 24.099999999999998 24.740000000000002 25.474999999999998 25.685000000000002 30-34 23.715 24.395 25.36 26.529999999999998 35-39 24.371218560928046 24.936246812340617 24.14620731036552 26.54632731636582 40-44 23.94 24.485 25.34 26.235000000000003 45-49 24.566228311415568 24.296214810740537 25.306265313265662 25.83129156457823 50-54 23.955000000000002 24.905 24.85 26.290000000000003 55-59 23.67118355917796 24.686234311715584 25.28626431321566 26.356317815890794 60-64 23.985 24.37 24.34 27.305 65-69 25.04376531786125 24.37853248637023 25.138798579502826 25.438903616265694 70-74 24.55122756137807 24.65623281164058 24.396219810990548 26.3963198159908 75-79 24.42 24.955 23.990000000000002 26.634999999999998 80-84 24.745 24.44 24.654999999999998 26.16 85-89 25.23878581787268 24.40866129919488 24.053608041206182 26.298944841726257 90-94 25.305 24.435000000000002 24.465 25.795 95-99 25.345000000000002 24.335 24.79 25.53 100-104 25.335 24.64 24.404999999999998 25.619999999999997 105-109 25.405 24.775 24.325 25.495 110-114 24.68 24.87 24.654999999999998 25.795 115-119 25.15 24.645 24.44 25.765 120-124 25.17625881294065 24.55122756137807 23.796189809490475 26.47632381619081 125-129 25.03 24.91 24.01 26.05 130-134 25.590000000000003 24.54 23.919999999999998 25.95 135-139 24.97 24.785 24.54 25.705 140-144 24.709999999999997 25.014999999999997 24.34 25.935000000000002 145-149 25.195 24.85 23.74 26.215 150-151 26.787499999999998 24.525 23.4875 25.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 3.0 27 3.0 28 0.5 29 3.0 30 6.5 31 8.5 32 13.5 33 19.0 34 27.5 35 39.5 36 46.0 37 61.5 38 78.0 39 90.5 40 113.0 41 135.0 42 150.5 43 170.5 44 167.5 45 165.0 46 173.0 47 176.0 48 172.5 49 166.5 50 156.0 51 132.5 52 125.0 53 114.0 54 105.5 55 88.0 56 82.0 57 95.0 58 92.0 59 94.5 60 99.5 61 86.5 62 81.5 63 78.5 64 72.5 65 78.0 66 71.0 67 61.0 68 56.5 69 52.0 70 47.0 71 39.5 72 26.5 73 19.0 74 18.5 75 15.5 76 9.5 77 5.5 78 3.5 79 1.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.034999999999999996 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.03119406801329 95.85000000000001 2 1.6875479417028894 3.3000000000000003 3 0.25568908207619534 0.75 4 0.025568908207619537 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.2125000000000004 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.800000000000001 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGTCA 10 0.006830828 145.0 8 ATGTTGG 10 0.006830828 145.0 6 >>END_MODULE SRR5578435 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7585 33.0 32.0 33.0 28.0 34.0 2 32.0575 33.0 33.0 34.0 30.0 34.0 3 31.78875 33.0 33.0 34.0 28.0 34.0 4 31.892 33.0 33.0 34.0 30.0 34.0 5 32.03075 33.0 33.0 34.0 31.0 34.0 6 36.037 38.0 38.0 38.0 33.0 38.0 7 36.015 38.0 37.0 38.0 33.0 38.0 8 35.955 38.0 38.0 38.0 32.0 38.0 9 35.92925 38.0 38.0 38.0 33.0 38.0 10-14 35.878 38.0 37.4 38.0 32.0 38.0 15-19 35.772949999999994 38.0 37.0 38.0 31.0 38.0 20-24 35.58625 38.0 37.0 38.0 30.2 38.0 25-29 35.53085 38.0 37.0 38.0 29.0 38.0 30-34 35.28725 38.0 37.0 38.0 29.0 38.0 35-39 35.141149999999996 38.0 36.2 38.0 28.4 38.0 40-44 34.951350000000005 38.0 36.0 38.0 27.6 38.0 45-49 34.803999999999995 38.0 36.0 38.0 27.2 38.0 50-54 34.60055 38.0 35.8 38.0 26.6 38.0 55-59 34.25935 38.0 35.0 38.0 25.4 38.0 60-64 34.0755 38.0 34.6 38.0 22.8 38.0 65-69 33.668749999999996 38.0 34.0 38.0 17.6 38.0 70-74 33.34995000000001 38.0 34.0 38.0 16.0 38.0 75-79 32.890699999999995 37.8 33.0 38.0 15.4 38.0 80-84 32.50505 37.4 32.8 38.0 15.0 38.0 85-89 31.90045 37.0 29.8 38.0 15.0 38.0 90-94 31.27525 36.6 29.0 38.0 14.4 38.0 95-99 30.5822 36.0 27.2 38.0 13.4 38.0 100-104 29.91735 35.0 25.2 38.0 13.0 38.0 105-109 29.133099999999995 35.0 23.0 38.0 13.0 38.0 110-114 28.39055 34.4 21.4 38.0 4.2 38.0 115-119 27.31825 34.0 15.0 38.0 2.0 38.0 120-124 26.284000000000002 33.8 14.6 38.0 2.0 38.0 125-129 24.89315 31.6 13.6 37.0 2.0 38.0 130-134 23.36665 29.0 13.0 36.2 2.0 38.0 135-139 21.9463 25.6 2.0 35.4 2.0 38.0 140-144 20.31805 22.8 2.0 35.0 2.0 38.0 145-149 17.594350000000002 13.0 2.0 33.6 2.0 38.0 150-151 12.957875 2.0 2.0 29.5 2.0 35.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 8.0 4 8.0 5 3.0 6 10.0 7 4.0 8 9.0 9 13.0 10 10.0 11 8.0 12 9.0 13 20.0 14 20.0 15 21.0 16 29.0 17 31.0 18 28.0 19 43.0 20 47.0 21 52.0 22 72.0 23 82.0 24 90.0 25 92.0 26 112.0 27 115.0 28 151.0 29 139.0 30 195.0 31 243.0 32 301.0 33 375.0 34 444.0 35 523.0 36 461.0 37 198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.43557668251188 18.263697773329998 7.930948211158369 26.36977733299975 2 26.389584376564844 23.760640961442164 27.916875312969452 21.932899349023536 3 24.40491104986219 23.853670759208217 26.509646705086443 25.231771485843147 4 28.113254823352545 28.864946128789775 18.215985968428967 24.805813079428717 5 25.808068153345026 34.55274367326485 17.890253069406164 21.748935103983964 6 23.030757689422355 34.38359589897475 19.929982495623904 22.655663915978995 7 22.842131598699027 17.613209907430573 34.42581936452339 25.11883912934701 8 22.044088176352705 22.970941883767534 25.150300601202403 29.834669338677354 9 24.261392088132197 22.30846269404106 26.164246369554334 27.265898848272407 10-14 26.372470446804247 24.7595672209978 23.136645962732917 25.731316369465034 15-19 26.19453070219373 24.36141440448763 23.735350095161774 25.708704798156866 20-24 26.811195113403098 24.127572222500376 23.61187603264407 25.449356631452464 25-29 26.228359851896325 25.007505253677575 23.071149804863406 25.692985089562693 30-34 26.6068384638524 25.56903639827534 22.646144590394062 25.17798054747819 35-39 26.597452101514698 24.94232119570669 23.312268030895776 25.147958671882837 40-44 26.391184573002757 24.187327823691458 24.077134986225897 25.344352617079892 45-49 26.309720760014038 24.4046723818118 23.657692886148293 25.62791397202587 50-54 26.562813063514323 24.564215588058506 23.326988579442997 25.54598276898417 55-59 26.316053092912593 24.55296769346356 23.87678437265214 25.2541948409717 60-64 26.001602564102566 24.424078525641026 23.80809294871795 25.766225961538463 65-69 26.55913439863748 24.901066973901717 23.468416570655712 25.071382056805092 70-74 26.265711853372725 24.177475086383897 23.716760979518252 25.840052080725123 75-79 26.222689917819203 24.76949288434556 23.476648626979355 25.531168570855883 80-84 26.125043800370424 24.80352405266056 24.03764328978325 25.033788857185762 85-89 26.276020816653322 24.224379503602883 23.523819055244196 25.9757806244996 90-94 26.07171474358974 24.844751602564102 23.763020833333336 25.320512820512818 95-99 25.84393468897125 25.157768205950116 23.625162776720423 25.37313432835821 100-104 26.10674803661648 24.741133510079536 23.465559501775797 25.686558951528188 105-109 26.649974962443668 24.802203304957438 23.650475713570355 24.897346019028543 110-114 26.226471766119342 25.81097316780136 22.73227873448138 25.230276331597917 115-119 26.15246008308724 25.917213073727414 22.874017718604534 25.05630912458081 120-124 26.463524467126987 25.267687381166816 23.17121985389773 25.097568297808465 125-129 26.853938210405087 25.241600320464674 23.31380501727505 24.59065645185519 130-134 27.124837321053157 25.618179997997796 22.74001401541696 24.516968665532087 135-139 26.587281733126535 26.066943513283636 22.929904437884623 24.415870315705206 140-144 27.06217798009104 26.26181781801811 22.365064278925516 24.310939922965336 145-149 26.4629388816645 26.89306792037611 22.551765529658898 24.092227668300488 150-151 26.478309788723593 27.928491061382672 21.102637829728714 24.49056132016502 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 2.0 22 3.0 23 1.0 24 1.0 25 1.0 26 1.0 27 3.0 28 3.5 29 3.0 30 9.0 31 15.0 32 12.5 33 12.0 34 19.0 35 28.0 36 42.5 37 49.0 38 53.5 39 81.0 40 104.5 41 122.5 42 140.0 43 149.0 44 161.5 45 168.5 46 168.5 47 155.0 48 148.0 49 144.5 50 138.5 51 131.5 52 113.5 53 109.0 54 108.0 55 96.0 56 100.5 57 104.5 58 92.0 59 107.5 60 115.0 61 105.5 62 106.5 63 96.5 64 81.0 65 76.0 66 80.0 67 76.5 68 63.0 69 50.0 70 48.0 71 44.0 72 40.5 73 37.5 74 25.0 75 15.5 76 10.0 77 7.5 78 6.0 79 3.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.15 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.025 7 0.075 8 0.2 9 0.15 10-14 0.18 15-19 0.16999999999999998 20-24 0.135 25-29 0.06999999999999999 30-34 0.27 35-39 0.31 40-44 0.17500000000000002 45-49 0.265 50-54 0.18 55-59 0.17500000000000002 60-64 0.16 65-69 0.185 70-74 0.155 75-79 0.22 80-84 0.11499999999999999 85-89 0.08 90-94 0.16 95-99 0.16999999999999998 100-104 0.045 105-109 0.15 110-114 0.12 115-119 0.105 120-124 0.06999999999999999 125-129 0.145 130-134 0.11 135-139 0.065 140-144 0.045 145-149 0.03 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13632882307888 96.1 2 1.6594332397242788 3.25 3 0.15317845289762574 0.44999999999999996 4 0.051059484299208584 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.5375 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869130 spots for SRR5578435.sra Written 869130 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra Read 869122 spots for SRR5578435.sra Written 869122 spots for SRR5578435.sra SRR ids: ['SRR5578435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l8mg906t SRR5578435.sra spots: 17382448 blocks: [[1, 869122], [869123, 1738244], [1738245, 2607366], [2607367, 3476488], [3476489, 4345610], [4345611, 5214732], [5214733, 6083854], [6083855, 6952976], [6952977, 7822098], [7822099, 8691220], [8691221, 9560342], [9560343, 10429464], [10429465, 11298586], [11298587, 12167708], [12167709, 13036830], [13036831, 13905952], [13905953, 14775074], [14775075, 15644196], [15644197, 16513318], [16513319, 17382448]] SRR5578435 file size 5868640 SRR5578435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578435 SRR5578435_1.fastq SRR5578435_2.fastq Input file: SRR5578435_1.fastq Paired file: SRR5578435_2.fastq trimmed: SRR5578435-trimmed-pair1.fastq, SRR5578435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:26:57 2024 >> started Mon Dec 9 17:27:17 2024 >> done (19.932s) 17382448 read pairs processed; of these: 58872 ( 0.34%) short read pairs filtered out after trimming by size control 55701 ( 0.32%) empty read pairs filtered out after trimming by size control 17267875 (99.34%) read pairs available; of these: 9310302 (53.92%) trimmed read pairs available after processing 7957573 (46.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 17 0.00% 20 7 0.00% 21 14 0.00% 22 10 0.00% 23 8 0.00% 24 17 0.00% 25 20 0.00% 26 13 0.00% 27 22 0.00% 28 15 0.00% 29 20 0.00% 30 14 0.00% 31 19 0.00% 32 17 0.00% 33 27 0.00% 34 19 0.00% 35 19 0.00% 36 26 0.00% 37 39 0.00% 38 35 0.00% 39 34 0.00% 40 39 0.00% 41 47 0.00% 42 52 0.00% 43 56 0.00% 44 61 0.00% 45 56 0.00% 46 68 0.00% 47 71 0.00% 48 82 0.00% 49 101 0.00% 50 144 0.00% 51 128 0.00% 52 138 0.00% 53 167 0.00% 54 195 0.00% 55 178 0.00% 56 243 0.00% 57 262 0.00% 58 289 0.00% 59 315 0.00% 60 369 0.00% 61 406 0.00% 62 506 0.00% 63 559 0.00% 64 662 0.00% 65 718 0.00% 66 761 0.00% 67 839 0.00% 68 961 0.01% 69 1102 0.01% 70 1398 0.01% 71 1399 0.01% 72 1634 0.01% 73 1824 0.01% 74 2004 0.01% 75 2226 0.01% 76 2409 0.01% 77 2747 0.02% 78 3057 0.02% 79 3315 0.02% 80 3788 0.02% 81 4228 0.02% 82 4956 0.03% 83 5614 0.03% 84 7871 0.05% 85 9482 0.05% 86 9833 0.06% 87 10366 0.06% 88 10763 0.06% 89 11433 0.07% 90 12169 0.07% 91 12228 0.07% 92 12634 0.07% 93 13419 0.08% 94 14358 0.08% 95 15270 0.09% 96 16216 0.09% 97 17142 0.10% 98 17616 0.10% 99 18678 0.11% 100 19729 0.11% 101 20863 0.12% 102 22092 0.13% 103 23221 0.13% 104 24457 0.14% 105 25472 0.15% 106 27425 0.16% 107 28977 0.17% 108 29662 0.17% 109 31813 0.18% 110 33577 0.19% 111 35376 0.20% 112 37357 0.22% 113 39203 0.23% 114 41314 0.24% 115 43537 0.25% 116 45783 0.27% 117 47862 0.28% 118 50055 0.29% 119 51753 0.30% 120 54580 0.32% 121 57528 0.33% 122 58703 0.34% 123 61845 0.36% 124 65074 0.38% 125 68184 0.39% 126 71475 0.41% 127 74276 0.43% 128 76986 0.45% 129 80493 0.47% 130 83208 0.48% 131 87842 0.51% 132 92308 0.53% 133 95914 0.56% 134 100429 0.58% 135 105456 0.61% 136 111557 0.65% 137 116850 0.68% 138 124601 0.72% 139 132739 0.77% 140 141687 0.82% 141 152543 0.88% 142 168530 0.98% 143 186736 1.08% 144 208121 1.21% 145 242342 1.40% 146 295927 1.71% 147 387214 2.24% 148 541759 3.14% 149 924655 5.35% 150 3401139 19.70% 151 7957573 46.08% 17267875 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=1.06 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.34 sequence-density-rank=29 fanout-score=11.92 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=3.9 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=1.09 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=13 prefix-density=1.22 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=33.69 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578435 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:28:16 Started mapping on | Dec 09 17:28:16 Finished on | Dec 09 17:32:29 Mapping speed, Million of reads per hour | 245.71 Number of input reads | 17267875 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16057723 Uniquely mapped reads % | 92.99% Average mapped length | 290.41 Number of splices: Total | 15963253 Number of splices: Annotated (sjdb) | 15135621 Number of splices: GT/AG | 15755926 Number of splices: GC/AG | 190389 Number of splices: AT/AC | 4800 Number of splices: Non-canonical | 12138 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 140074 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 11008 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.70% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1106351 1106351 1106351 N_multimapping 140074 140074 140074 N_noFeature 521419 15538537 652909 N_ambiguous 452669 1720 66121 UnstrandedReadsAssigned:15083635 PositiveStrandReadsAssigned:517466 NegativeStrandReadsAssigned:15338693 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR5578435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578435-trimmed-pair1.fastq SRR5578435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,267,875 reads, 15,343,710 reads pseudoaligned [quant] estimated average fragment length: 243.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR5578435.ke.tsv 35125 SRR5578435.se.tsv 88098 total ==> SRR5578435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.696 0 0 PNS24247 1044 801.26 24.3965 2.67578 PNS24249 1928 1685.26 33.321 1.73759 PNS24246 1044 801.26 24.3965 2.67578 PNS24248 1044 801.26 24.3965 2.67578 PNS24244 1471 1228.26 68.4893 4.90036 PNS24243 293 96.1798 0 0 KQK14069 1603 1360.26 3322.55 214.657 KQK14071 474 244.057 108.779 39.1694 ==> SRR5578435.se.tsv <== BRADI_1g14170v3 3923 BRADI_1g53295v3 61 BRADI_1g59795v3 513 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 374 BRADI_1g74790v3 36 BRADI_1g09890v3 0 BRADI_1g77505v3 186 BRADI_1g48960v3 0 SRR5578435 completed mapping pipeline successfully