Starting /dee2/code/volunteer_pipeline.sh SRR5578436 current disk space = 1523791093760 free memory = 1334306192 SRR5578436 SRAfilesize 003613f8e4ceadc2a79a239b306d1f9d SRR5578436.sra SRR5578436.sra file validated SRR5578436 is paired end SRR5578436 is conventional basespace SRR5578436 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48025 34.0 33.0 34.0 33.0 34.0 2 33.3725 34.0 34.0 34.0 33.0 34.0 3 33.46625 34.0 34.0 34.0 33.0 34.0 4 33.5205 34.0 34.0 34.0 33.0 34.0 5 33.52275 34.0 34.0 34.0 33.0 34.0 6 37.082 38.0 37.0 38.0 36.0 38.0 7 37.4105 38.0 38.0 38.0 37.0 38.0 8 37.50825 38.0 38.0 38.0 37.0 38.0 9 37.58225 38.0 38.0 38.0 38.0 38.0 10-14 37.55595 38.0 38.0 38.0 38.0 38.0 15-19 37.526450000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.52935 38.0 38.0 38.0 38.0 38.0 25-29 37.46495 38.0 38.0 38.0 38.0 38.0 30-34 37.4451 38.0 38.0 38.0 38.0 38.0 35-39 37.3536 38.0 38.0 38.0 37.0 38.0 40-44 37.17615 38.0 38.0 38.0 36.8 38.0 45-49 37.174850000000006 38.0 38.0 38.0 36.6 38.0 50-54 37.1315 38.0 38.0 38.0 36.0 38.0 55-59 37.06075 38.0 38.0 38.0 36.0 38.0 60-64 36.988350000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.92435 38.0 38.0 38.0 35.6 38.0 70-74 36.77205 38.0 38.0 38.0 35.0 38.0 75-79 36.4816 38.0 38.0 38.0 35.0 38.0 80-84 36.308550000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.198 38.0 38.0 38.0 33.8 38.0 90-94 36.1216 38.0 38.0 38.0 33.8 38.0 95-99 35.9534 38.0 38.0 38.0 33.2 38.0 100-104 35.7322 38.0 37.4 38.0 32.4 38.0 105-109 35.656 38.0 37.0 38.0 32.0 38.0 110-114 35.400150000000004 38.0 36.4 38.0 30.8 38.0 115-119 35.24595 38.0 36.0 38.0 30.6 38.0 120-124 34.9375 38.0 35.8 38.0 28.4 38.0 125-129 34.696000000000005 38.0 35.0 38.0 27.4 38.0 130-134 34.4111 38.0 35.0 38.0 26.2 38.0 135-139 33.90500000000001 38.0 34.6 38.0 23.0 38.0 140-144 33.44745 38.0 34.2 38.0 19.6 38.0 145-149 32.51055 38.0 33.8 38.0 13.6 38.0 150-151 27.959 34.5 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 3.0 13 3.0 14 6.0 15 2.0 16 6.0 17 5.0 18 16.0 19 22.0 20 3.0 21 8.0 22 11.0 23 14.0 24 11.0 25 10.0 26 16.0 27 24.0 28 32.0 29 35.0 30 45.0 31 57.0 32 66.0 33 102.0 34 136.0 35 268.0 36 803.0 37 2292.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.5627425614489 11.617076326002588 10.73738680465718 32.082794307891334 2 26.700000000000003 13.900000000000002 30.65 28.749999999999996 3 24.125 18.275 23.75 33.85 4 27.650000000000002 26.424999999999997 21.3 24.625 5 26.900000000000002 28.175 23.925 21.0 6 24.731182795698924 30.03250812703176 23.605901475368842 21.630407601900476 7 20.150000000000002 23.9 37.125 18.825 8 21.525 23.95 28.7 25.825 9 20.849999999999998 21.4 31.474999999999998 26.275 10-14 23.785 26.07 24.925 25.22 15-19 24.01 24.895 24.635 26.46 20-24 24.085 24.9 25.074999999999996 25.94 25-29 24.145 25.290000000000003 25.115 25.45 30-34 24.21 25.185000000000002 24.605 26.0 35-39 24.015 24.610000000000003 24.89 26.484999999999996 40-44 25.14 24.884999999999998 24.18 25.795 45-49 25.035 24.785 24.46 25.72 50-54 25.115 24.95 23.535 26.400000000000002 55-59 25.064999999999998 24.59 24.4 25.945 60-64 24.425 25.03 24.16 26.384999999999998 65-69 24.685000000000002 25.45 24.05 25.814999999999998 70-74 25.074999999999996 25.53 23.265 26.13 75-79 24.5 24.955 23.549999999999997 26.995 80-84 25.374999999999996 24.959999999999997 23.535 26.13 85-89 25.03 24.395 24.169999999999998 26.405 90-94 25.82 24.125 24.01 26.045 95-99 25.025 24.535 24.305 26.135 100-104 25.89 24.715 23.494999999999997 25.900000000000002 105-109 25.19 25.924999999999997 22.605 26.279999999999998 110-114 24.745 24.765 23.3 27.189999999999998 115-119 25.130000000000003 25.264999999999997 23.380000000000003 26.224999999999998 120-124 25.64 24.79 23.07 26.5 125-129 25.085 25.629999999999995 22.355 26.93 130-134 25.305 25.224999999999998 22.725 26.745 135-139 25.130000000000003 25.040000000000003 23.305 26.525 140-144 25.645 24.85 23.07 26.435 145-149 24.36 24.85 23.39 27.400000000000002 150-151 25.2375 24.1875 23.5625 27.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 1.5 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.0 29 3.5 30 11.0 31 22.5 32 28.5 33 28.5 34 39.5 35 47.5 36 60.5 37 97.0 38 99.5 39 98.0 40 123.5 41 136.0 42 136.0 43 138.0 44 137.5 45 139.5 46 159.0 47 165.5 48 146.0 49 124.5 50 114.5 51 115.5 52 119.5 53 122.5 54 114.0 55 97.0 56 98.0 57 92.5 58 85.5 59 85.5 60 82.5 61 84.0 62 82.5 63 79.0 64 77.0 65 71.5 66 64.0 67 64.5 68 52.0 69 51.0 70 57.0 71 47.5 72 44.5 73 35.5 74 26.0 75 24.5 76 22.0 77 15.0 78 8.0 79 6.5 80 4.5 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.89473684210526 92.05 2 2.394736842105263 4.55 3 0.3684210526315789 1.05 4 0.10526315789473684 0.4 5 0.07894736842105263 0.375 6 0.07894736842105263 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.02631578947368421 0.22499999999999998 >10 0.05263157894736842 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATGC 21 0.525 TruSeq Adapter, Index 27 (98% over 50bp) AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATG 15 0.375 TruSeq Adapter, Index 27 (97% over 49bp) GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 9 0.22499999999999998 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit GGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATA 6 0.15 No Hit GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 6 0.15 No Hit GGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTA 5 0.125 No Hit CCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAAT 5 0.125 No Hit GGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.375 0.0 0.0 0.0 0.0 2 0.375 0.0 0.0 0.0 0.0 3 0.375 0.0 0.0 0.0 0.0 4 0.375 0.0 0.0 0.0 0.0 5 0.375 0.0 0.0 0.0 0.0 6 0.375 0.0 0.0 0.0 0.0 7 0.375 0.0 0.0 0.0 0.0 8 0.375 0.0 0.0 0.0 0.0 9 0.375 0.0 0.0 0.0 0.0 10-11 0.375 0.0 0.0 0.0 0.0 12-13 0.375 0.0 0.0 0.0 0.0 14-15 0.375 0.0 0.0 0.0 0.0 16-17 0.375 0.0 0.0 0.0 0.0 18-19 0.375 0.0 0.0 0.0 0.0 20-21 0.375 0.0 0.0 0.0 0.0 22-23 0.375 0.0 0.0 0.0 0.0 24-25 0.375 0.0 0.0 0.0 0.0 26-27 0.375 0.0 0.0 0.0 0.0 28-29 0.375 0.0 0.0 0.0 0.0 30-31 0.375 0.0 0.0 0.0 0.0 32-33 0.375 0.0 0.0 0.0 0.0 34-35 0.375 0.0 0.0 0.0 0.0 36-37 0.375 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.375 0.0 0.0 0.0 0.0 42-43 0.375 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.375 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.375 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.375 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.3875 0.0 0.0 0.0 0.0 60-61 0.425 0.0 0.0 0.0 0.0 62-63 0.45 0.0 0.0 0.0 0.0 64-65 0.45 0.0 0.0 0.0 0.0 66-67 0.45 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.5125 0.0 0.0 0.0 0.0 76-77 0.5625 0.0 0.0 0.0 0.0 78-79 0.625 0.0 0.0 0.0 0.0 80-81 0.7 0.0 0.0 0.0 0.0 82-83 0.775 0.0 0.0 0.0 0.0 84-85 1.0499999999999998 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.5375 0.0 0.0 0.0 0.0 90-91 1.8125 0.0 0.0 0.0 0.0 92-93 2.1625 0.0 0.0 0.0 0.0 94-95 2.5375 0.0 0.0 0.0 0.0 96-97 3.0125 0.0 0.0 0.0 0.0 98-99 3.475 0.0 0.0 0.0 0.0 100-101 3.8499999999999996 0.0 0.0 0.0 0.0 102-103 4.425 0.0 0.0 0.0 0.0 104-105 4.875 0.0 0.0 0.0 0.0 106-107 5.275 0.0 0.0 0.0 0.0 108-109 5.85 0.0 0.0 0.0 0.0 110-111 6.375 0.0 0.0 0.0 0.0 112-113 6.925 0.0 0.0 0.0 0.0 114-115 7.55 0.0 0.0 0.0 0.0 116-117 8.2375 0.0 0.0 0.0 0.0 118-119 8.9875 0.0 0.0 0.0 0.0 120-121 9.7375 0.0 0.0 0.0 0.0 122-123 10.5375 0.0 0.0 0.0 0.0 124-125 11.25 0.0 0.0 0.0 0.0 126-127 12.2125 0.0 0.0 0.0 0.0 128-129 12.95 0.0 0.0 0.0 0.0 130-131 13.9875 0.0 0.0 0.0 0.0 132-133 15.0125 0.0 0.0 0.0 0.0 134-135 15.9875 0.0 0.0 0.0 0.0 136-137 16.799999999999997 0.0 0.0 0.0 0.0 138-139 17.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCGTAT 10 0.006577216 146.82278 1 TTGCAAA 10 0.006832588 144.9875 6 TTCCGGG 10 0.006832588 144.9875 9 GCGTATC 10 0.006832588 144.9875 2 TCTTCCG 10 0.006832588 144.9875 7 >>END_MODULE SRR5578436 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86075 33.0 33.0 34.0 32.0 34.0 2 32.94825 34.0 33.0 34.0 32.0 34.0 3 32.9455 34.0 33.0 34.0 33.0 34.0 4 32.81425 34.0 33.0 34.0 32.0 34.0 5 32.8375 34.0 33.0 34.0 32.0 34.0 6 36.90275 38.0 38.0 38.0 37.0 38.0 7 36.96325 38.0 38.0 38.0 37.0 38.0 8 36.90675 38.0 38.0 38.0 37.0 38.0 9 36.92025 38.0 38.0 38.0 37.0 38.0 10-14 36.8856 38.0 38.0 38.0 37.0 38.0 15-19 36.78985 38.0 38.0 38.0 37.0 38.0 20-24 36.75295 38.0 38.0 38.0 37.0 38.0 25-29 36.72505 38.0 38.0 38.0 37.0 38.0 30-34 36.7692 38.0 38.0 38.0 37.0 38.0 35-39 36.7293 38.0 38.0 38.0 37.0 38.0 40-44 36.751099999999994 38.0 38.0 38.0 37.0 38.0 45-49 36.64975 38.0 38.0 38.0 36.8 38.0 50-54 36.619550000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.5909 38.0 38.0 38.0 36.6 38.0 60-64 36.539300000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.40820000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.0747 38.0 38.0 38.0 34.8 38.0 75-79 36.02455 38.0 38.0 38.0 34.6 38.0 80-84 35.986900000000006 38.0 38.0 38.0 34.2 38.0 85-89 35.8489 38.0 38.0 38.0 34.4 38.0 90-94 35.8181 38.0 38.0 38.0 34.0 38.0 95-99 35.648649999999996 38.0 38.0 38.0 33.4 38.0 100-104 35.5257 38.0 38.0 38.0 33.0 38.0 105-109 35.29905 38.0 38.0 38.0 31.8 38.0 110-114 35.18005 38.0 37.8 38.0 31.6 38.0 115-119 34.89245000000001 38.0 37.0 38.0 29.2 38.0 120-124 34.60455 38.0 36.0 38.0 27.8 38.0 125-129 34.249 38.0 35.4 38.0 24.4 38.0 130-134 33.82619999999999 38.0 35.0 38.0 21.8 38.0 135-139 33.2113 38.0 33.4 38.0 16.6 38.0 140-144 32.6012 38.0 33.0 38.0 13.0 38.0 145-149 31.359 38.0 32.2 38.0 5.6 38.0 150-151 26.290625 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 14.0 4 11.0 5 3.0 6 2.0 7 3.0 8 4.0 9 4.0 10 3.0 11 4.0 12 2.0 13 8.0 14 5.0 15 5.0 16 13.0 17 35.0 18 7.0 19 5.0 20 9.0 21 8.0 22 13.0 23 11.0 24 8.0 25 10.0 26 8.0 27 14.0 28 21.0 29 29.0 30 26.0 31 52.0 32 62.0 33 87.0 34 146.0 35 270.0 36 649.0 37 2419.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.125 17.299999999999997 13.825000000000001 27.750000000000004 2 30.490245122561284 22.086043021510758 23.011505752876438 24.412206103051524 3 24.312156078039017 24.412206103051524 26.538269134567283 24.73736868434217 4 27.938969484742373 28.58929464732366 19.084542271135568 24.387193596798397 5 27.863931965982992 29.989994997498748 19.13456728364182 23.011505752876438 6 23.53088272068017 30.857714428607153 21.530382595648913 24.081020255063766 7 24.006001500375092 18.854713678419603 31.282820705176295 25.85646411602901 8 24.275 22.875 21.15 31.7 9 23.88097024256064 22.930732683170792 25.381345336334082 27.806951737934483 10-14 26.770077558168627 24.463347510632975 22.34175631723793 26.424818613960472 15-19 26.778200761370467 23.567421358445202 23.552394309757563 26.101983570426768 20-24 27.169830219862774 24.24500425702409 22.99794661190965 25.587218911203486 25-29 26.783567134268537 24.46392785571142 22.52004008016032 26.232464929859717 30-34 27.56513026052104 24.178356713426854 23.1563126252505 25.100200400801604 35-39 26.889746030155788 23.85913940790462 23.032610329108852 26.218504232830735 40-44 27.803633088124908 23.109643196717208 23.44993244257619 25.636791272581693 45-49 26.93520140105079 23.042281711283465 23.792844633475106 26.229672254190646 50-54 27.008358776715554 23.319485459732718 23.850042544671908 25.82211321887982 55-59 26.365320118135855 23.371877659308204 24.348000200230267 25.914802022325674 60-64 26.528056112224448 23.42685370741483 23.77755511022044 26.26753507014028 65-69 25.85153275896614 24.55419755560008 24.343818873973152 25.250450811460627 70-74 26.113309622802184 23.95932475078896 23.82908380503932 26.098281821369536 75-79 25.899569008720057 24.005211987571414 23.96511977548361 26.130099228224918 80-84 26.054926330560292 24.155557782900672 23.729578029467778 26.059937857071265 85-89 26.594253679046954 24.296726399038942 23.425768345179698 25.683251576734406 90-94 27.130347760820616 24.513385038779084 23.137353014761068 25.21891418563923 95-99 27.037315301778115 24.387678437265215 23.75657400450789 24.818432256448787 100-104 26.987625870447374 25.20414808877311 23.170181854616505 24.638044186163018 105-109 27.104208416833668 25.05511022044088 23.18637274549098 24.65430861723447 110-114 26.613549809581077 25.32070555221487 23.035678492683907 25.030066145520145 115-119 27.467682132478206 25.298126064735943 22.943180679426796 24.291011123359056 120-124 27.500000000000004 25.5310621242485 22.680360721442884 24.288577154308616 125-129 28.311623246492985 25.495991983967937 22.580160320641284 23.612224448897795 130-134 28.174444221910676 24.6044462247146 23.933506909673543 23.287602643701184 135-139 28.692215329197516 25.390234140484292 22.933760256153693 22.983790274164498 140-144 29.43177270908363 25.665266106442573 22.428971588635456 22.473989595838333 145-149 29.258406725380304 24.959967974379506 23.108486789431545 22.673138510808645 150-151 28.89472368092023 25.98149537384346 22.50562640660165 22.61815453863466 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.5 16 3.0 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.5 24 1.0 25 0.5 26 2.0 27 2.0 28 1.5 29 2.0 30 5.5 31 12.0 32 12.5 33 16.0 34 28.0 35 34.0 36 40.5 37 58.5 38 78.0 39 88.5 40 120.0 41 123.5 42 109.5 43 136.5 44 140.0 45 126.5 46 123.0 47 128.5 48 142.0 49 139.0 50 124.0 51 105.5 52 111.0 53 118.0 54 114.0 55 113.5 56 111.5 57 110.5 58 102.0 59 107.0 60 108.5 61 98.0 62 92.5 63 94.5 64 93.0 65 88.5 66 74.0 67 66.0 68 78.0 69 78.0 70 68.0 71 55.0 72 47.5 73 37.5 74 26.0 75 24.0 76 19.5 77 17.0 78 11.0 79 6.5 80 6.0 81 2.5 82 3.0 83 3.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.05 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.075 15-19 0.18 20-24 0.165 25-29 0.2 30-34 0.2 35-39 0.185 40-44 0.08499999999999999 45-49 0.075 50-54 0.105 55-59 0.11499999999999999 60-64 0.2 65-69 0.18 70-74 0.185 75-79 0.22999999999999998 80-84 0.22999999999999998 85-89 0.11 90-94 0.075 95-99 0.17500000000000002 100-104 0.19499999999999998 105-109 0.2 110-114 0.22 115-119 0.21 120-124 0.2 125-129 0.2 130-134 0.13999999999999999 135-139 0.06 140-144 0.04 145-149 0.08 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.77848775292864 90.875 2 2.2896698615548456 4.3 3 0.34611288604898827 0.975 4 0.1863684771033014 0.7000000000000001 5 0.07987220447284345 0.375 6 0.05324813631522897 0.3 7 0.10649627263045794 0.7000000000000001 8 0.026624068157614485 0.2 9 0.05324813631522897 0.44999999999999996 >10 0.07987220447284345 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 21 0.525 Illumina Single End PCR Primer 1 (100% over 50bp) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 10 0.25 No Hit GCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGG 9 0.22499999999999998 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 9 0.22499999999999998 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 8 0.2 No Hit CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 7 0.17500000000000002 No Hit AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 7 0.17500000000000002 No Hit TAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGT 7 0.17500000000000002 No Hit ATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAG 7 0.17500000000000002 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 6 0.15 No Hit CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit AGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTT 5 0.125 No Hit AGGAATGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.375 0.0 0.0 0.0 0.0 2 0.375 0.0 0.0 0.0 0.0 3 0.375 0.0 0.0 0.0 0.0 4 0.375 0.0 0.0 0.0 0.0 5 0.375 0.0 0.0 0.0 0.0 6 0.375 0.0 0.0 0.0 0.0 7 0.375 0.0 0.0 0.0 0.0 8 0.375 0.0 0.0 0.0 0.0 9 0.375 0.0 0.0 0.0 0.0 10-11 0.375 0.0 0.0 0.0 0.0 12-13 0.375 0.0 0.0 0.0 0.0 14-15 0.375 0.0 0.0 0.0 0.0 16-17 0.375 0.0 0.0 0.0 0.0 18-19 0.375 0.0 0.0 0.0 0.0 20-21 0.375 0.0 0.0 0.0 0.0 22-23 0.375 0.0 0.0 0.0 0.0 24-25 0.375 0.0 0.0 0.0 0.0 26-27 0.375 0.0 0.0 0.0 0.0 28-29 0.375 0.0 0.0 0.0 0.0 30-31 0.375 0.0 0.0 0.0 0.0 32-33 0.375 0.0 0.0 0.0 0.0 34-35 0.375 0.0 0.0 0.0 0.0 36-37 0.375 0.0 0.0 0.0 0.0 38-39 0.375 0.0 0.0 0.0 0.0 40-41 0.375 0.0 0.0 0.0 0.0 42-43 0.375 0.0 0.0 0.0 0.0 44-45 0.375 0.0 0.0 0.0 0.0 46-47 0.375 0.0 0.0 0.0 0.0 48-49 0.375 0.0 0.0 0.0 0.0 50-51 0.375 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.375 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.3875 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.4 0.0 0.0 0.0 0.0 64-65 0.4 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.45 0.0 0.0 0.0 0.0 70-71 0.45 0.0 0.0 0.0 0.0 72-73 0.45 0.0 0.0 0.0 0.0 74-75 0.4875 0.0 0.0 0.0 0.0 76-77 0.5375000000000001 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 1.0 0.0 0.0 0.0 0.0 86-87 1.25 0.0 0.0 0.0 0.0 88-89 1.4875 0.0 0.0 0.0 0.0 90-91 1.775 0.0 0.0 0.0 0.0 92-93 2.1500000000000004 0.0 0.0 0.0 0.0 94-95 2.5375 0.0 0.0 0.0 0.0 96-97 2.9875 0.0 0.0 0.0 0.0 98-99 3.4625000000000004 0.0 0.0 0.0 0.0 100-101 3.8375 0.0 0.0 0.0 0.0 102-103 4.4125 0.0 0.0 0.0 0.0 104-105 4.8125 0.0 0.0 0.0 0.0 106-107 5.2 0.0 0.0 0.0 0.0 108-109 5.7625 0.0 0.0 0.0 0.0 110-111 6.275 0.0 0.0 0.0 0.0 112-113 6.85 0.0 0.0 0.0 0.0 114-115 7.5125 0.0 0.0 0.0 0.0 116-117 8.1875 0.0 0.0 0.0 0.0 118-119 8.9375 0.0 0.0 0.0 0.0 120-121 9.7 0.0 0.0 0.0 0.0 122-123 10.525 0.0 0.0 0.0 0.0 124-125 11.274999999999999 0.0 0.0 0.0 0.0 126-127 12.175 0.0 0.0 0.0 0.0 128-129 12.962499999999999 0.0 0.0 0.0 0.0 130-131 13.962499999999999 0.0 0.0 0.0 0.0 132-133 15.0125 0.0 0.0 0.0 0.0 134-135 16.1375 0.0 0.0 0.0 0.0 136-137 16.975 0.0 0.0 0.0 0.0 138-139 17.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCTCC 10 0.006830828 145.0 5 CGCTCAT 10 0.006830828 145.0 1 CGAAAGC 10 0.006830828 145.0 2 >>END_MODULE Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841293 spots for SRR5578436.sra Written 841293 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra Read 841286 spots for SRR5578436.sra Written 841286 spots for SRR5578436.sra SRR ids: ['SRR5578436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hpyfl242 SRR5578436.sra spots: 16825727 blocks: [[1, 841286], [841287, 1682572], [1682573, 2523858], [2523859, 3365144], [3365145, 4206430], [4206431, 5047716], [5047717, 5889002], [5889003, 6730288], [6730289, 7571574], [7571575, 8412860], [8412861, 9254146], [9254147, 10095432], [10095433, 10936718], [10936719, 11778004], [11778005, 12619290], [12619291, 13460576], [13460577, 14301862], [14301863, 15143148], [15143149, 15984434], [15984435, 16825727]] SRR5578436 file size 5679986 SRR5578436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578436 SRR5578436_1.fastq SRR5578436_2.fastq Input file: SRR5578436_1.fastq Paired file: SRR5578436_2.fastq trimmed: SRR5578436-trimmed-pair1.fastq, SRR5578436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:28:54 2024 >> started Mon Dec 9 17:30:23 2024 >> done (88.169s) 16825727 read pairs processed; of these: 53591 ( 0.32%) short read pairs filtered out after trimming by size control 174724 ( 1.04%) empty read pairs filtered out after trimming by size control 16597412 (98.64%) read pairs available; of these: 9940256 (59.89%) trimmed read pairs available after processing 6657156 (40.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 23 0.00% 20 21 0.00% 21 15 0.00% 22 17 0.00% 23 28 0.00% 24 26 0.00% 25 26 0.00% 26 19 0.00% 27 37 0.00% 28 31 0.00% 29 38 0.00% 30 34 0.00% 31 37 0.00% 32 35 0.00% 33 32 0.00% 34 35 0.00% 35 43 0.00% 36 47 0.00% 37 44 0.00% 38 65 0.00% 39 72 0.00% 40 81 0.00% 41 82 0.00% 42 99 0.00% 43 128 0.00% 44 160 0.00% 45 174 0.00% 46 201 0.00% 47 220 0.00% 48 286 0.00% 49 319 0.00% 50 387 0.00% 51 477 0.00% 52 563 0.00% 53 520 0.00% 54 570 0.00% 55 630 0.00% 56 725 0.00% 57 758 0.00% 58 906 0.01% 59 1006 0.01% 60 1121 0.01% 61 1382 0.01% 62 1504 0.01% 63 1732 0.01% 64 1986 0.01% 65 2282 0.01% 66 2812 0.02% 67 3757 0.02% 68 5950 0.04% 69 11637 0.07% 70 10252 0.06% 71 5618 0.03% 72 5663 0.03% 73 6021 0.04% 74 6708 0.04% 75 7406 0.04% 76 8072 0.05% 77 8809 0.05% 78 9929 0.06% 79 10969 0.07% 80 12126 0.07% 81 13413 0.08% 82 15080 0.09% 83 16976 0.10% 84 19952 0.12% 85 22177 0.13% 86 23836 0.14% 87 24901 0.15% 88 26670 0.16% 89 27896 0.17% 90 29659 0.18% 91 31145 0.19% 92 33022 0.20% 93 34967 0.21% 94 37193 0.22% 95 39057 0.24% 96 40822 0.25% 97 42493 0.26% 98 43833 0.26% 99 45723 0.28% 100 48149 0.29% 101 49729 0.30% 102 52413 0.32% 103 54760 0.33% 104 56578 0.34% 105 58858 0.35% 106 60971 0.37% 107 62826 0.38% 108 63992 0.39% 109 64209 0.39% 110 66062 0.40% 111 67841 0.41% 112 71271 0.43% 113 74842 0.45% 114 77267 0.47% 115 80379 0.48% 116 80926 0.49% 117 81109 0.49% 118 80910 0.49% 119 81615 0.49% 120 83638 0.50% 121 84231 0.51% 122 87014 0.52% 123 89218 0.54% 124 91829 0.55% 125 92888 0.56% 126 95279 0.57% 127 94817 0.57% 128 95243 0.57% 129 98099 0.59% 130 97669 0.59% 131 100007 0.60% 132 103153 0.62% 133 104679 0.63% 134 106367 0.64% 135 108533 0.65% 136 110252 0.66% 137 111532 0.67% 138 115825 0.70% 139 119873 0.72% 140 122634 0.74% 141 126982 0.77% 142 137047 0.83% 143 145027 0.87% 144 159030 0.96% 145 178138 1.07% 146 209212 1.26% 147 262039 1.58% 148 374892 2.26% 149 722871 4.36% 150 3473949 20.93% 151 6657156 40.11% 16597412 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=20 prefix-density=1.09 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.35 sequence-density-rank=24 fanout-score=9.87 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=3.7 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=10 prefix-density=1.10 prefix-fanout=3.2 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=13.95 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.8 sequence=TCATCTCCTCTAACTTTGGAGAGGTAGGAATGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGTTTTTACTATGTTGGGTATGCTGTTCGATTTCTTAAAGGACTGAATATTCGGTGGCAGTATGGGATTTCTAAAAATAATGTTAAGAATTTTTGCTGGTTTTTTGCGACGTTGGTGTTGTATTCTATAGCTCCATTATGGCCGTTATATGGAATCATTGGAGTGCCAGTAATTCTACCACGCCTTATATTTAAAGACAAAAAGAAGTGTCTAACAACAACATCCACACTACTACTCCTTGTCATATTTCTTCCTGAATTGCTGATTCTTATTGGATTTCTGATATTTCCTATTGTTATGGGCTATTACATCTCTAAGGAATTGGTGAAGTAAAATGGTGAAGCTTATGAATTTGTGGAGTGAGAGGATTAAAGATAGGGAAGTTGTTGAAGTTATTGGCTGTGAGAGAGTGCCATTGATGAAAC SRR5578436 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:34:56 Started mapping on | Dec 09 17:34:56 Finished on | Dec 09 18:19:07 Mapping speed, Million of reads per hour | 22.54 Number of input reads | 16597412 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 13286655 Uniquely mapped reads % | 80.05% Average mapped length | 282.93 Number of splices: Total | 10836543 Number of splices: Annotated (sjdb) | 10239936 Number of splices: GT/AG | 10704289 Number of splices: GC/AG | 118594 Number of splices: AT/AC | 4106 Number of splices: Non-canonical | 9554 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 129712 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 31524 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.08% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3201125 3201125 3201125 N_multimapping 129712 129712 129712 N_noFeature 262656 12888753 363631 N_ambiguous 363845 1336 67230 UnstrandedReadsAssigned:12660154 PositiveStrandReadsAssigned:396566 NegativeStrandReadsAssigned:12855794 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=134 echo kmer=129 SRR5578436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578436-trimmed-pair1.fastq SRR5578436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,597,412 reads, 12,888,643 reads pseudoaligned [quant] estimated average fragment length: 204.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52973 SRR5578436.ke.tsv 35125 SRR5578436.se.tsv 88098 total ==> SRR5578436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.563 0 0 PNS24247 1044 840.428 10.3041 1.07585 PNS24249 1928 1724.43 35.9273 1.8282 PNS24246 1044 840.428 10.3041 1.07585 PNS24248 1044 840.428 10.3041 1.07585 PNS24244 1471 1267.43 55.1605 3.819 PNS24243 293 119.302 0 0 KQK14069 1603 1399.43 3695.03 231.692 KQK14071 474 277.296 34.4745 10.9093 ==> SRR5578436.se.tsv <== BRADI_1g14170v3 3835 BRADI_1g53295v3 15 BRADI_1g59795v3 368 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 1357 BRADI_1g74790v3 101 BRADI_1g09890v3 10 BRADI_1g77505v3 326 BRADI_1g48960v3 0 SRR5578436 completed mapping pipeline successfully