Starting /dee2/code/volunteer_pipeline.sh SRR5578437 current disk space = 1523865296896 free memory = 1578616344 SRR5578437 SRAfilesize a45bd0590b5de71cf65f96de1689d5a2 SRR5578437.sra SRR5578437.sra file validated SRR5578437 is paired end SRR5578437 is conventional basespace SRR5578437 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578437_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.59025 34.0 33.0 34.0 32.0 34.0 2 33.13225 34.0 33.0 34.0 32.0 34.0 3 33.307 34.0 33.0 34.0 32.0 34.0 4 33.45675 34.0 33.0 34.0 33.0 34.0 5 33.5395 34.0 34.0 34.0 33.0 34.0 6 37.06225 38.0 37.0 38.0 36.0 38.0 7 37.41175 38.0 38.0 38.0 37.0 38.0 8 37.57225 38.0 38.0 38.0 38.0 38.0 9 37.58975 38.0 38.0 38.0 38.0 38.0 10-14 37.56965 38.0 38.0 38.0 38.0 38.0 15-19 37.53275 38.0 38.0 38.0 38.0 38.0 20-24 37.5546 38.0 38.0 38.0 38.0 38.0 25-29 37.537749999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.4841 38.0 38.0 38.0 38.0 38.0 35-39 37.50165 38.0 38.0 38.0 38.0 38.0 40-44 37.36195 38.0 38.0 38.0 37.0 38.0 45-49 37.2971 38.0 38.0 38.0 37.0 38.0 50-54 37.2958 38.0 38.0 38.0 36.8 38.0 55-59 37.19825 38.0 38.0 38.0 36.2 38.0 60-64 37.143600000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.06185000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.9935 38.0 38.0 38.0 35.8 38.0 75-79 36.9387 38.0 38.0 38.0 35.4 38.0 80-84 36.878949999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.8235 38.0 38.0 38.0 35.0 38.0 90-94 36.7205 38.0 38.0 38.0 34.6 38.0 95-99 36.529199999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.451299999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.3725 38.0 38.0 38.0 34.0 38.0 110-114 36.12435 38.0 37.2 38.0 33.2 38.0 115-119 35.86515000000001 38.0 36.6 38.0 32.2 38.0 120-124 35.6016 38.0 36.0 38.0 31.0 38.0 125-129 35.47285 38.0 36.0 38.0 31.2 38.0 130-134 35.177800000000005 38.0 35.2 38.0 29.0 38.0 135-139 34.7664 38.0 35.0 38.0 27.8 38.0 140-144 34.291999999999994 38.0 35.0 38.0 25.2 38.0 145-149 33.527550000000005 38.0 34.2 38.0 19.6 38.0 150-151 29.068125000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 4.0 20 4.0 21 6.0 22 4.0 23 10.0 24 9.0 25 14.0 26 14.0 27 10.0 28 27.0 29 30.0 30 40.0 31 52.0 32 64.0 33 99.0 34 134.0 35 292.0 36 723.0 37 2455.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.975583864118896 10.774946921443737 7.643312101910828 37.60615711252654 2 24.55 14.2 32.7 28.549999999999997 3 22.725 18.575 22.775000000000002 35.925000000000004 4 28.275 26.125 19.825 25.775 5 27.881970492623154 29.982495623905976 21.905476369092273 20.230057514378593 6 23.375 30.599999999999998 22.875 23.150000000000002 7 19.0 21.975 38.324999999999996 20.7 8 21.075 22.425 27.825 28.675 9 20.575 21.325 32.925 25.174999999999997 10-14 23.919999999999998 25.5 24.535 26.045 15-19 24.11 24.805 25.215 25.869999999999997 20-24 24.46 24.59 25.1 25.85 25-29 24.42 24.759999999999998 25.040000000000003 25.779999999999998 30-34 24.385 24.610000000000003 25.174999999999997 25.83 35-39 23.965 24.84 25.2 25.995 40-44 24.279999999999998 24.54 24.905 26.275 45-49 24.365000000000002 24.34 24.67 26.625 50-54 24.245 24.375 24.884999999999998 26.495 55-59 24.44 24.779999999999998 24.48 26.3 60-64 25.009999999999998 24.625 24.485 25.88 65-69 24.48 24.495 24.6 26.424999999999997 70-74 24.605 24.295 24.945 26.155 75-79 24.77 24.89 24.57 25.77 80-84 25.105 24.42 24.285 26.19 85-89 25.095 24.185000000000002 24.279999999999998 26.44 90-94 25.34 24.635 24.04 25.985000000000003 95-99 24.965 24.735 24.03 26.27 100-104 25.045 25.324999999999996 23.595 26.035000000000004 105-109 25.555 24.625 24.11 25.71 110-114 24.72 24.895 24.48 25.905 115-119 25.474999999999998 24.955 23.785 25.785000000000004 120-124 25.41 24.765 23.69 26.135 125-129 25.605 24.625 23.925 25.845000000000002 130-134 25.074999999999996 25.115 23.66 26.150000000000002 135-139 24.865000000000002 25.355 23.74 26.040000000000003 140-144 24.985 25.505 23.47 26.040000000000003 145-149 24.895 26.174999999999997 23.1 25.83 150-151 25.156289072268066 25.85646411602901 22.83070767691923 26.156539134783696 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 2.0 28 3.5 29 6.0 30 11.0 31 13.5 32 15.0 33 18.5 34 27.0 35 38.5 36 53.0 37 63.0 38 70.0 39 88.5 40 107.5 41 133.0 42 159.0 43 162.5 44 176.0 45 182.0 46 178.0 47 170.5 48 156.0 49 154.5 50 139.0 51 128.5 52 130.0 53 113.5 54 98.5 55 90.0 56 96.0 57 100.0 58 91.5 59 86.5 60 82.0 61 83.0 62 74.0 63 70.0 64 77.0 65 80.0 66 63.5 67 62.5 68 66.0 69 57.0 70 52.5 71 41.5 72 32.5 73 26.0 74 20.5 75 14.0 76 9.0 77 7.0 78 6.5 79 3.0 80 3.0 81 3.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.800000000000001 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91166793216907 97.7 2 1.0124019235636548 2.0 3 0.05062009617818274 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02531004808909137 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.1124999999999998 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.2875 0.0 0.0 0.0 0.0 102-103 2.6624999999999996 0.0 0.0 0.0 0.0 104-105 3.0 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.375 0.0 0.0 0.0 0.0 112-113 5.0 0.0 0.0 0.0 0.0 114-115 5.612500000000001 0.0 0.0 0.0 0.0 116-117 6.3875 0.0 0.0 0.0 0.0 118-119 7.0 0.0 0.0 0.0 0.0 120-121 7.637499999999999 0.0 0.0 0.0 0.0 122-123 8.4 0.0 0.0 0.0 0.0 124-125 9.0875 0.0 0.0 0.0 0.0 126-127 9.649999999999999 0.0 0.0 0.0 0.0 128-129 10.25 0.0 0.0 0.0 0.0 130-131 11.075 0.0 0.0 0.0 0.0 132-133 11.7375 0.0 0.0 0.0 0.0 134-135 12.7125 0.0 0.0 0.0 0.0 136-137 13.8625 0.0 0.0 0.0 0.0 138-139 14.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATAT 10 0.006836113 144.9625 5 TCTTAAT 10 0.006836113 144.9625 6 >>END_MODULE SRR5578437 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578437_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8415 33.0 33.0 34.0 32.0 34.0 2 32.9825 33.0 33.0 34.0 32.0 34.0 3 32.94825 34.0 33.0 34.0 32.0 34.0 4 32.92525 34.0 33.0 34.0 32.0 34.0 5 32.985 34.0 33.0 34.0 32.0 34.0 6 37.04575 38.0 38.0 38.0 37.0 38.0 7 37.119 38.0 38.0 38.0 37.0 38.0 8 37.06425 38.0 38.0 38.0 37.0 38.0 9 37.02725 38.0 38.0 38.0 37.0 38.0 10-14 37.0617 38.0 38.0 38.0 37.0 38.0 15-19 37.0286 38.0 38.0 38.0 37.0 38.0 20-24 37.00849999999999 38.0 38.0 38.0 37.0 38.0 25-29 36.93795 38.0 38.0 38.0 36.8 38.0 30-34 36.99210000000001 38.0 38.0 38.0 36.8 38.0 35-39 36.977500000000006 38.0 38.0 38.0 37.0 38.0 40-44 36.97735 38.0 38.0 38.0 36.8 38.0 45-49 36.95545 38.0 38.0 38.0 36.8 38.0 50-54 36.91655 38.0 38.0 38.0 36.2 38.0 55-59 36.83425 38.0 38.0 38.0 36.0 38.0 60-64 36.75625 38.0 38.0 38.0 36.0 38.0 65-69 36.643249999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.572750000000006 38.0 38.0 38.0 35.2 38.0 75-79 36.489599999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.42755 38.0 38.0 38.0 34.8 38.0 85-89 36.2392 38.0 38.0 38.0 34.2 38.0 90-94 36.1819 38.0 38.0 38.0 34.0 38.0 95-99 35.9964 38.0 38.0 38.0 33.6 38.0 100-104 35.80175 38.0 38.0 38.0 32.6 38.0 105-109 35.64125 38.0 38.0 38.0 32.6 38.0 110-114 35.43095000000001 38.0 37.4 38.0 31.6 38.0 115-119 35.2002 38.0 36.8 38.0 30.2 38.0 120-124 34.8986 38.0 36.0 38.0 28.4 38.0 125-129 34.515600000000006 38.0 35.2 38.0 25.8 38.0 130-134 34.109899999999996 38.0 34.4 38.0 23.6 38.0 135-139 33.73995 38.0 33.2 38.0 22.2 38.0 140-144 33.0054 38.0 33.0 38.0 15.6 38.0 145-149 31.83825 38.0 33.0 38.0 8.2 38.0 150-151 26.337875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 4.0 5 1.0 6 1.0 7 3.0 8 2.0 9 5.0 10 1.0 11 4.0 12 2.0 13 7.0 14 6.0 15 9.0 16 4.0 17 8.0 18 7.0 19 9.0 20 8.0 21 9.0 22 16.0 23 18.0 24 12.0 25 14.0 26 25.0 27 22.0 28 27.0 29 42.0 30 45.0 31 51.0 32 75.0 33 97.0 34 152.0 35 282.0 36 649.0 37 2371.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 18.25 10.725 30.775000000000002 2 29.375 23.425 26.950000000000003 20.25 3 22.25 26.0 25.424999999999997 26.325 4 27.575 31.6 18.6 22.225 5 27.400000000000002 32.5 18.6 21.5 6 22.786393196598297 35.29264632316158 20.01000500250125 21.91095547773887 7 22.45 16.925 35.75 24.875 8 23.875 21.349999999999998 24.15 30.625000000000004 9 23.736868434217108 22.461230615307652 27.888944472236116 25.912956478239117 10-14 25.90295147573787 25.237618809404704 22.64632316158079 26.21310655327664 15-19 26.423211605802898 24.83741870935468 23.401700850425215 25.337668834417208 20-24 26.329481214668064 24.868677772775026 23.8281054580019 24.973735554555006 25-29 26.267073597838596 24.726071946765398 23.450242657727525 25.55661179766848 30-34 26.00470446924578 25.349081627546166 23.36219408438016 25.284019818827886 35-39 25.719289467100324 25.303977983487613 23.54265699274456 25.4340755566675 40-44 26.138069034517258 24.487243621810904 23.69184592296148 25.682841420710357 45-49 26.014307869328128 24.028215518535195 24.003201760968533 25.95427485116814 50-54 26.21203782458598 24.711062190423775 23.790463801470956 25.28643618351929 55-59 26.747385800770502 24.305798769199978 23.8204833141542 25.12633211587532 60-64 26.272331481759498 24.22559175299004 23.68012810889256 25.8219486563579 65-69 26.394312606388304 24.481826374286573 23.71082407129268 25.413036948032442 70-74 25.74718397997497 24.32540675844806 23.62453066332916 26.30287859824781 75-79 26.337139423076923 24.338942307692307 23.63782051282051 25.68609775641026 80-84 26.520803084163617 24.51809943423622 23.451659740649877 25.50943774095028 85-89 26.82878014610227 24.22195536875813 23.8116681677174 25.137596317422194 90-94 26.574616038821354 24.06323477912852 23.918154985241884 25.443994196808244 95-99 26.233363354348043 24.942459721805264 23.591514059841888 25.2326628640048 100-104 26.91114668801281 24.439663798278968 23.394036421853112 25.255153091855114 105-109 26.58994245684263 23.997998498874157 24.113084813610207 25.298974230673004 110-114 26.68869861298883 24.871063041410043 23.43898653046918 25.00125181513194 115-119 27.637637637637635 24.964964964964963 22.95795795795796 24.43943943943944 120-124 27.865078570713642 25.337804023621256 23.0307276548894 23.766389750775698 125-129 27.376901521216972 25.075060048038434 23.37369895916733 24.174339471577262 130-134 28.211158368776584 25.389041781336 22.76207155366525 23.637728296222164 135-139 27.908954477238616 25.1775887943972 23.316658329164582 23.5967983991996 140-144 28.16408204102051 25.817908954477236 22.63631815907954 23.38169084542271 145-149 28.569284642321165 25.68784392196098 23.1815907953977 22.56128064032016 150-151 29.069767441860467 25.6064016004001 22.83070767691923 22.493123280820203 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.5 28 2.5 29 6.0 30 9.0 31 12.0 32 12.5 33 18.5 34 25.0 35 31.5 36 49.0 37 55.0 38 65.5 39 89.0 40 106.5 41 107.5 42 123.0 43 145.5 44 156.0 45 153.0 46 152.0 47 160.5 48 159.5 49 151.5 50 149.5 51 150.0 52 123.0 53 106.5 54 107.0 55 113.0 56 105.5 57 99.5 58 101.5 59 98.5 60 92.0 61 82.5 62 91.0 63 101.0 64 91.0 65 75.5 66 69.5 67 69.5 68 75.0 69 71.0 70 59.5 71 43.5 72 33.0 73 30.0 74 22.5 75 15.0 76 8.0 77 5.0 78 4.5 79 3.0 80 1.0 81 2.5 82 3.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.05 10-14 0.05 15-19 0.05 20-24 0.055 25-29 0.065 30-34 0.095 35-39 0.075 40-44 0.05 45-49 0.055 50-54 0.065 55-59 0.065 60-64 0.08499999999999999 65-69 0.13 70-74 0.125 75-79 0.16 80-84 0.135 85-89 0.06999999999999999 90-94 0.055 95-99 0.06999999999999999 100-104 0.06 105-109 0.075 110-114 0.145 115-119 0.1 120-124 0.09 125-129 0.08 130-134 0.075 135-139 0.05 140-144 0.05 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13012295081968 95.775 2 1.5625 3.05 3 0.15368852459016394 0.44999999999999996 4 0.07684426229508197 0.3 5 0.05122950819672131 0.25 6 0.0 0.0 7 0.025614754098360656 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 7 0.17500000000000002 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.48750000000000004 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.325 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.9875 0.0 0.0 0.0 0.0 100-101 2.3375 0.0 0.0 0.0 0.0 102-103 2.7125000000000004 0.0 0.0 0.0 0.0 104-105 3.0 0.0 0.0 0.0 0.0 106-107 3.3625 0.0 0.0 0.0 0.0 108-109 3.8875 0.0 0.0 0.0 0.0 110-111 4.3875 0.0 0.0 0.0 0.0 112-113 5.025 0.0 0.0 0.0 0.0 114-115 5.637499999999999 0.0 0.0 0.0 0.0 116-117 6.4 0.0 0.0 0.0 0.0 118-119 6.987500000000001 0.0 0.0 0.0 0.0 120-121 7.612500000000001 0.0 0.0 0.0 0.0 122-123 8.3625 0.0 0.0 0.0 0.0 124-125 9.05 0.0 0.0 0.0 0.0 126-127 9.625 0.0 0.0 0.0 0.0 128-129 10.2125 0.0 0.0 0.0 0.0 130-131 11.05 0.0 0.0 0.0 0.0 132-133 11.725000000000001 0.0 0.0 0.0 0.0 134-135 12.75 0.0 0.0 0.0 0.0 136-137 13.8375 0.0 0.0 0.0 0.0 138-139 14.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284817 spots for SRR5578437.sra Written 1284817 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra Read 1284808 spots for SRR5578437.sra Written 1284808 spots for SRR5578437.sra SRR ids: ['SRR5578437.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n7wzfnzs SRR5578437.sra spots: 25696169 blocks: [[1, 1284808], [1284809, 2569616], [2569617, 3854424], [3854425, 5139232], [5139233, 6424040], [6424041, 7708848], [7708849, 8993656], [8993657, 10278464], [10278465, 11563272], [11563273, 12848080], [12848081, 14132888], [14132889, 15417696], [15417697, 16702504], [16702505, 17987312], [17987313, 19272120], [19272121, 20556928], [20556929, 21841736], [21841737, 23126544], [23126545, 24411352], [24411353, 25696169]] SRR5578437 file size 8685888 SRR5578437 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578437 SRR5578437_1.fastq SRR5578437_2.fastq Input file: SRR5578437_1.fastq Paired file: SRR5578437_2.fastq trimmed: SRR5578437-trimmed-pair1.fastq, SRR5578437-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:31:27 2024 >> started Mon Dec 9 17:32:14 2024 >> done (46.911s) 25696169 read pairs processed; of these: 39093 ( 0.15%) short read pairs filtered out after trimming by size control 24578 ( 0.10%) empty read pairs filtered out after trimming by size control 25632498 (99.75%) read pairs available; of these: 14390019 (56.14%) trimmed read pairs available after processing 11242479 (43.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 17 0.00% 20 24 0.00% 21 12 0.00% 22 24 0.00% 23 26 0.00% 24 28 0.00% 25 26 0.00% 26 23 0.00% 27 25 0.00% 28 32 0.00% 29 34 0.00% 30 44 0.00% 31 40 0.00% 32 38 0.00% 33 45 0.00% 34 45 0.00% 35 51 0.00% 36 58 0.00% 37 70 0.00% 38 86 0.00% 39 98 0.00% 40 102 0.00% 41 101 0.00% 42 105 0.00% 43 137 0.00% 44 132 0.00% 45 187 0.00% 46 170 0.00% 47 207 0.00% 48 254 0.00% 49 276 0.00% 50 327 0.00% 51 349 0.00% 52 353 0.00% 53 435 0.00% 54 493 0.00% 55 542 0.00% 56 598 0.00% 57 729 0.00% 58 845 0.00% 59 932 0.00% 60 1136 0.00% 61 1283 0.01% 62 1461 0.01% 63 1697 0.01% 64 1913 0.01% 65 2033 0.01% 66 2328 0.01% 67 2651 0.01% 68 3002 0.01% 69 3564 0.01% 70 4277 0.02% 71 4635 0.02% 72 5188 0.02% 73 6026 0.02% 74 6576 0.03% 75 7276 0.03% 76 8209 0.03% 77 9248 0.04% 78 9920 0.04% 79 11534 0.04% 80 12680 0.05% 81 14154 0.06% 82 16126 0.06% 83 17646 0.07% 84 20802 0.08% 85 22804 0.09% 86 23985 0.09% 87 26035 0.10% 88 28425 0.11% 89 29687 0.12% 90 31108 0.12% 91 33878 0.13% 92 36391 0.14% 93 38923 0.15% 94 42241 0.16% 95 43927 0.17% 96 46473 0.18% 97 48531 0.19% 98 50308 0.20% 99 52900 0.21% 100 55510 0.22% 101 58073 0.23% 102 60795 0.24% 103 64563 0.25% 104 66695 0.26% 105 69155 0.27% 106 72371 0.28% 107 75031 0.29% 108 75823 0.30% 109 79108 0.31% 110 80168 0.31% 111 83607 0.33% 112 86435 0.34% 113 89767 0.35% 114 93185 0.36% 115 96542 0.38% 116 97960 0.38% 117 100215 0.39% 118 101229 0.39% 119 102412 0.40% 120 106004 0.41% 121 108177 0.42% 122 110233 0.43% 123 114286 0.45% 124 117617 0.46% 125 121285 0.47% 126 124042 0.48% 127 125911 0.49% 128 127859 0.50% 129 130950 0.51% 130 133474 0.52% 131 135901 0.53% 132 138850 0.54% 133 142676 0.56% 134 146133 0.57% 135 150238 0.59% 136 155496 0.61% 137 158453 0.62% 138 163972 0.64% 139 171553 0.67% 140 179230 0.70% 141 189138 0.74% 142 203612 0.79% 143 219539 0.86% 144 243890 0.95% 145 279424 1.09% 146 331079 1.29% 147 424711 1.66% 148 614765 2.40% 149 1154099 4.50% 150 5519661 21.53% 151 11242479 43.86% 25632498 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=16 prefix-density=0.99 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=83.05 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=6.9 sequence=GCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=17 prefix-density=0.65 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=59.10 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.7 sequence=AGGAAAGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTT SRR5578437 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:33:27 Started mapping on | Dec 09 17:33:28 Finished on | Dec 09 17:37:17 Mapping speed, Million of reads per hour | 402.96 Number of input reads | 25632498 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 24525913 Uniquely mapped reads % | 95.68% Average mapped length | 286.98 Number of splices: Total | 24818561 Number of splices: Annotated (sjdb) | 23408044 Number of splices: GT/AG | 24502164 Number of splices: GC/AG | 290778 Number of splices: AT/AC | 8148 Number of splices: Non-canonical | 17471 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197706 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 17755 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 927689 927689 927689 N_multimapping 197706 197706 197706 N_noFeature 817979 23808247 1031958 N_ambiguous 599225 2764 97717 UnstrandedReadsAssigned:23108709 PositiveStrandReadsAssigned:714902 NegativeStrandReadsAssigned:23396238 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR5578437 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578437-trimmed-pair1.fastq SRR5578437-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,632,498 reads, 23,416,267 reads pseudoaligned [quant] estimated average fragment length: 230.308 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR5578437.ke.tsv 35125 SRR5578437.se.tsv 88098 total ==> SRR5578437.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.036 0 0 PNS24247 1044 814.692 43.8651 3.24258 PNS24249 1928 1698.69 85.6543 3.03669 PNS24246 1044 814.692 43.8651 3.24258 PNS24248 1044 814.692 43.8651 3.24258 PNS24244 1471 1241.69 81.7505 3.96499 PNS24243 293 111.94 0 0 KQK14069 1603 1373.69 2884.06 126.439 KQK14071 474 260.535 116.638 26.9612 ==> SRR5578437.se.tsv <== BRADI_1g14170v3 3369 BRADI_1g53295v3 137 BRADI_1g59795v3 802 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 300 BRADI_1g74790v3 69 BRADI_1g09890v3 0 BRADI_1g77505v3 294 BRADI_1g48960v3 0 SRR5578437 completed mapping pipeline successfully