Starting /dee2/code/volunteer_pipeline.sh SRR5578438 current disk space = 1523833286656 free memory = 1576271944 SRR5578438 SRAfilesize bd1448810666ce40c5afe42cb397c485 SRR5578438.sra SRR5578438.sra file validated SRR5578438 is paired end SRR5578438 is conventional basespace SRR5578438 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578438_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1945 34.0 34.0 34.0 33.0 34.0 2 33.252 34.0 34.0 34.0 33.0 34.0 3 33.30825 34.0 34.0 34.0 33.0 34.0 4 33.42125 34.0 34.0 34.0 33.0 34.0 5 33.48925 34.0 34.0 34.0 33.0 34.0 6 37.177 38.0 37.0 38.0 36.0 38.0 7 37.37125 38.0 38.0 38.0 37.0 38.0 8 37.512 38.0 38.0 38.0 37.0 38.0 9 37.59675 38.0 38.0 38.0 38.0 38.0 10-14 37.63275 38.0 38.0 38.0 38.0 38.0 15-19 37.64025 38.0 38.0 38.0 37.8 38.0 20-24 37.60185 38.0 38.0 38.0 37.8 38.0 25-29 37.6094 38.0 38.0 38.0 38.0 38.0 30-34 37.586 38.0 38.0 38.0 37.8 38.0 35-39 37.571 38.0 38.0 38.0 38.0 38.0 40-44 36.78375 38.0 38.0 38.0 34.0 38.0 45-49 37.468450000000004 38.0 38.0 38.0 37.2 38.0 50-54 37.3882 38.0 38.0 38.0 37.0 38.0 55-59 37.40939999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.280899999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.183949999999996 38.0 38.0 38.0 36.6 38.0 70-74 36.21265 38.0 37.8 38.0 29.2 38.0 75-79 31.79905 38.0 37.0 38.0 2.0 38.0 80-84 31.71325 38.0 36.4 38.0 2.0 38.0 85-89 31.6406 38.0 36.2 38.0 2.0 38.0 90-94 31.564600000000002 38.0 36.0 38.0 2.0 38.0 95-99 31.451150000000002 38.0 36.0 38.0 2.0 38.0 100-104 31.34005 38.0 35.6 38.0 2.0 38.0 105-109 31.128899999999998 38.0 34.8 38.0 2.0 38.0 110-114 30.99015 38.0 34.6 38.0 2.0 38.0 115-119 30.88245 38.0 34.2 38.0 2.0 38.0 120-124 30.62235 38.0 34.0 38.0 2.0 38.0 125-129 30.61115 38.0 33.8 38.0 2.0 38.0 130-134 30.359199999999998 38.0 33.0 38.0 2.0 38.0 135-139 30.129200000000004 38.0 32.2 38.0 2.0 38.0 140-144 29.7825 38.0 30.8 38.0 2.0 38.0 145-149 29.2134 38.0 28.2 38.0 2.0 38.0 150-151 25.823875 34.5 14.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 8.0 16 5.0 17 25.0 18 186.0 19 407.0 20 8.0 21 9.0 22 6.0 23 11.0 24 6.0 25 9.0 26 9.0 27 18.0 28 12.0 29 17.0 30 27.0 31 25.0 32 36.0 33 48.0 34 87.0 35 162.0 36 481.0 37 2393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.436325678496864 8.846555323590815 7.437369519832986 29.27974947807933 2 21.025 27.200000000000003 26.8 24.975 3 19.7 14.124999999999998 35.825 30.349999999999998 4 25.025 21.575 15.950000000000001 37.45 5 38.819409704852426 24.88744372186093 18.63431715857929 17.658829414707352 6 34.625 25.55 20.075000000000003 19.75 7 15.5 35.75 32.275 16.475 8 17.625 34.075 24.575 23.724999999999998 9 33.25 18.425 26.400000000000002 21.925 10-14 22.95 28.904999999999998 20.474999999999998 27.67 15-19 23.06 24.01 24.185000000000002 28.744999999999997 20-24 22.884999999999998 27.445000000000004 24.5 25.169999999999998 25-29 23.45 24.235 24.04 28.275 30-34 23.31 24.02 24.404999999999998 28.265 35-39 26.38 27.58 24.48 21.560000000000002 40-44 20.01 24.115000000000002 27.55 28.325 45-49 26.61 24.099999999999998 27.355 21.935 50-54 23.275000000000002 20.385 24.27 32.07 55-59 23.810000000000002 20.615 30.545 25.03 60-64 23.45 23.865 27.175 25.509999999999998 65-69 20.07 37.335 20.685000000000002 21.91 70-74 20.24 36.29 21.18 22.29 75-79 21.445 34.345 20.895 23.315 80-84 22.505 30.365 23.445 23.685000000000002 85-89 24.375 26.88 23.01 25.735000000000003 90-94 22.63 25.759999999999998 25.790000000000003 25.82 95-99 23.125 26.155 25.1 25.619999999999997 100-104 22.055 32.690000000000005 21.945 23.31 105-109 21.385 34.345 21.055 23.215 110-114 21.94 33.26 21.115000000000002 23.685000000000002 115-119 22.005 31.855 21.740000000000002 24.4 120-124 22.75 30.625000000000004 21.72 24.905 125-129 22.68 30.330000000000002 21.98 25.009999999999998 130-134 23.035 30.03 21.67 25.264999999999997 135-139 23.02 29.595 22.105 25.28 140-144 23.215 29.125 21.815 25.845000000000002 145-149 23.064999999999998 29.17 21.82 25.945 150-151 23.329997498123593 30.422817112834625 21.1408556417313 25.106329747310486 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.5 27 2.0 28 1.0 29 4.0 30 7.5 31 8.5 32 11.0 33 14.5 34 23.5 35 43.0 36 64.5 37 91.0 38 124.5 39 155.0 40 180.5 41 192.0 42 190.5 43 190.0 44 193.5 45 194.5 46 171.0 47 155.0 48 153.0 49 147.0 50 140.5 51 122.0 52 106.0 53 96.5 54 87.0 55 80.0 56 78.5 57 82.5 58 88.0 59 78.0 60 67.5 61 63.5 62 65.5 63 68.5 64 65.5 65 61.5 66 49.5 67 39.5 68 33.5 69 33.5 70 31.5 71 26.5 72 30.0 73 24.0 74 14.0 75 12.0 76 11.0 77 10.0 78 6.0 79 2.5 80 2.5 81 1.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.89453241708993 82.75 2 0.89632506722438 1.5 3 0.089632506722438 0.22499999999999998 4 0.05975500448162533 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029877502240812665 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.029877502240812665 14.75 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAGAGATCTCGTATGC 590 14.75 TruSeq Adapter, Index 3 (97% over 37bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACGTAGAGATCTCGTATGC 23 0.575 TruSeq Adapter, Index 18 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 0.7124999999999999 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.8624999999999998 0.0 0.0 0.0 0.0 100-101 2.0999999999999996 0.0 0.0 0.0 0.0 102-103 2.3499999999999996 0.0 0.0 0.0 0.0 104-105 2.6375 0.0 0.0 0.0 0.0 106-107 2.9125 0.0 0.0 0.0 0.0 108-109 3.4125 0.0 0.0 0.0 0.0 110-111 3.925 0.0 0.0 0.0 0.0 112-113 4.375 0.0 0.0 0.0 0.0 114-115 5.1 0.0 0.0 0.0 0.0 116-117 5.550000000000001 0.0 0.0 0.0 0.0 118-119 6.0375 0.0 0.0 0.0 0.0 120-121 6.875 0.0 0.0 0.0 0.0 122-123 7.612500000000001 0.0 0.0 0.0 0.0 124-125 8.162500000000001 0.0 0.0 0.0 0.0 126-127 8.7375 0.0 0.0 0.0 0.0 128-129 9.525 0.0 0.0 0.0 0.0 130-131 9.975 0.0 0.0 0.0 0.0 132-133 10.5875 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.1875 0.0 0.0 0.0 0.0 138-139 12.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACTA 10 0.006836113 144.9625 4 AAGAGCA 110 1.4551915E-11 59.302837 7 GAGCACA 110 1.4551915E-11 59.302837 9 AGAGCAC 110 1.4551915E-11 59.302837 8 CGGAAGA 120 3.45608E-11 54.360935 4 GATCGGA 125 3.45608E-11 54.219738 1 TCGGAAG 125 5.0931703E-11 52.186497 3 ATCGGAA 125 5.0931703E-11 52.186497 2 GAAGAGC 130 7.4578566E-11 50.17933 6 GGAAGAG 135 1.09139364E-10 48.32083 5 GCTTGAA 55 5.97538E-9 26.356817 55-59 CTGCTTG 50 7.077688E-8 26.09325 55-59 TTGAAAA 50 7.077688E-8 26.09325 60-64 CTTGAAA 50 7.077688E-8 26.09325 60-64 TGAAAAA 50 7.077688E-8 26.09325 60-64 TCTGCTT 60 1.5092155E-8 24.160418 55-59 CGTATGC 60 1.5092155E-8 24.160418 40-44 GCCGTCT 60 1.5092155E-8 24.160418 45-49 CTTCTGC 60 1.5092155E-8 24.160418 50-54 TTCTGCT 55 1.7806269E-7 23.721136 55-59 >>END_MODULE SRR5578438 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578438_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8505 33.0 33.0 34.0 32.0 34.0 2 32.95 34.0 33.0 34.0 32.0 34.0 3 32.94275 34.0 33.0 34.0 32.0 34.0 4 32.863 34.0 33.0 34.0 32.0 34.0 5 32.9465 34.0 33.0 34.0 32.0 34.0 6 37.066 38.0 38.0 38.0 37.0 38.0 7 37.075 38.0 38.0 38.0 37.0 38.0 8 37.13125 38.0 38.0 38.0 37.0 38.0 9 37.1165 38.0 38.0 38.0 37.0 38.0 10-14 37.1443 38.0 38.0 38.0 37.0 38.0 15-19 37.073800000000006 38.0 38.0 38.0 36.8 38.0 20-24 37.0733 38.0 38.0 38.0 37.0 38.0 25-29 37.01565 38.0 38.0 38.0 37.0 38.0 30-34 36.950599999999994 38.0 38.0 38.0 36.6 38.0 35-39 36.87624999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.80485 38.0 38.0 38.0 36.0 38.0 45-49 36.57705 38.0 38.0 38.0 35.0 38.0 50-54 36.523 38.0 38.0 38.0 35.2 38.0 55-59 36.61 38.0 38.0 38.0 35.6 38.0 60-64 36.7093 38.0 38.0 38.0 36.0 38.0 65-69 34.72495 38.0 37.6 38.0 22.2 38.0 70-74 31.40195 38.0 36.2 38.0 2.0 38.0 75-79 31.263399999999997 38.0 36.0 38.0 2.0 38.0 80-84 31.21075 38.0 35.8 38.0 2.0 38.0 85-89 31.146250000000002 38.0 35.4 38.0 2.0 38.0 90-94 31.0148 38.0 35.2 38.0 2.0 38.0 95-99 30.936700000000002 38.0 35.0 38.0 2.0 38.0 100-104 30.790399999999998 38.0 34.6 38.0 2.0 38.0 105-109 30.606 38.0 34.0 38.0 2.0 38.0 110-114 30.4493 38.0 33.4 38.0 2.0 38.0 115-119 30.29925 38.0 33.0 38.0 2.0 38.0 120-124 29.9754 38.0 31.2 38.0 2.0 38.0 125-129 29.8202 38.0 31.0 38.0 2.0 38.0 130-134 29.567700000000002 38.0 29.4 38.0 2.0 38.0 135-139 28.94105 38.0 25.8 38.0 2.0 38.0 140-144 28.237450000000003 38.0 21.0 38.0 2.0 38.0 145-149 26.9527 36.6 9.8 38.0 2.0 38.0 150-151 22.250999999999998 29.5 2.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 1.0 4 5.0 5 2.0 6 0.0 7 1.0 8 3.0 9 3.0 10 7.0 11 5.0 12 7.0 13 15.0 14 22.0 15 27.0 16 46.0 17 471.0 18 43.0 19 8.0 20 8.0 21 6.0 22 15.0 23 17.0 24 16.0 25 14.0 26 22.0 27 22.0 28 20.0 29 20.0 30 36.0 31 27.0 32 54.0 33 71.0 34 130.0 35 214.0 36 533.0 37 2092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.88666499874906 14.460845634225668 10.557918438829123 26.09457092819615 2 25.806451612903224 35.608902225556385 21.355338834708675 17.22930732683171 3 21.79134350763072 19.78984238178634 37.152864648486364 21.26594946209657 4 23.992994746059544 25.8443832874656 15.561671253440078 34.60095071303478 5 39.34467233616809 26.88844422211106 15.107553776888444 18.659329664832416 6 36.75 27.825 16.525000000000002 18.9 7 19.575 32.0 28.799999999999997 19.625 8 19.875 35.225 19.925 24.975 9 36.6 18.95 23.200000000000003 21.25 10-14 28.785 24.2 22.275 24.740000000000002 15-19 28.854999999999997 21.005 25.525 24.615000000000002 20-24 31.395 27.075 20.044999999999998 21.485000000000003 25-29 28.494999999999997 30.3 19.61 21.595 30-34 28.299999999999997 24.135 26.295 21.27 35-39 22.205 23.97 26.085 27.74 40-44 35.075 20.575 22.994999999999997 21.355 45-49 25.840000000000003 21.099999999999998 22.515 30.545 50-54 25.290000000000003 23.735 26.314999999999998 24.66 55-59 21.825 30.585 25.995 21.595 60-64 22.255 36.720000000000006 20.330000000000002 20.695 65-69 22.64613230661533 35.83179158957948 19.9909995499775 21.531076553827692 70-74 24.131206560328017 33.36166808340417 20.93104655232762 21.576078803940195 75-79 24.46489297859572 31.691338267653528 20.809161832366474 23.034606921384277 80-84 24.995 30.235 21.77 23.0 85-89 26.669999999999998 28.110000000000003 21.7 23.52 90-94 27.255000000000003 26.865 22.065 23.815 95-99 26.595000000000002 27.365000000000002 22.99 23.05 100-104 26.419999999999998 28.89 21.990000000000002 22.7 105-109 25.424999999999997 30.12 21.41 23.044999999999998 110-114 25.691284564228212 29.906495324766237 21.6110805540277 22.79113955697785 115-119 26.08 29.79 21.154999999999998 22.975 120-124 26.47 29.354999999999997 21.34 22.835 125-129 27.400000000000002 29.12 21.115000000000002 22.365 130-134 27.96 28.68 21.055 22.305 135-139 27.735 28.485 21.709999999999997 22.07 140-144 28.605000000000004 28.660000000000004 21.685 21.05 145-149 29.15 27.915 21.12 21.815 150-151 30.65 27.737499999999997 20.1 21.512500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 3.5 30 7.0 31 8.0 32 11.5 33 21.0 34 31.0 35 43.0 36 63.0 37 88.0 38 110.5 39 131.0 40 151.0 41 155.5 42 161.0 43 170.5 44 181.0 45 190.0 46 175.5 47 166.0 48 150.5 49 131.0 50 125.0 51 114.0 52 103.0 53 108.0 54 106.5 55 87.0 56 77.5 57 81.0 58 92.0 59 86.0 60 76.5 61 75.5 62 76.5 63 73.5 64 66.0 65 65.0 66 55.5 67 53.5 68 58.5 69 55.0 70 49.0 71 42.0 72 32.5 73 26.5 74 20.5 75 12.0 76 7.0 77 6.5 78 5.0 79 3.5 80 3.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.075 4 0.075 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.005 75-79 0.02 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80952380952381 83.0 2 1.0119047619047619 1.7000000000000002 3 0.11904761904761905 0.3 4 0.029761904761904764 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.029761904761904764 14.899999999999999 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 596 14.899999999999999 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 0.9874999999999999 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.6125 0.0 0.0 0.0 0.0 98-99 1.8875000000000002 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.0125 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 4.025 0.0 0.0 0.0 0.0 112-113 4.4625 0.0 0.0 0.0 0.0 114-115 5.175 0.0 0.0 0.0 0.0 116-117 5.6625 0.0 0.0 0.0 0.0 118-119 6.125 0.0 0.0 0.0 0.0 120-121 6.9125 0.0 0.0 0.0 0.0 122-123 7.65 0.0 0.0 0.0 0.0 124-125 8.2375 0.0 0.0 0.0 0.0 126-127 8.837499999999999 0.0 0.0 0.0 0.0 128-129 9.575 0.0 0.0 0.0 0.0 130-131 10.0375 0.0 0.0 0.0 0.0 132-133 10.6625 0.0 0.0 0.0 0.0 134-135 11.4875 0.0 0.0 0.0 0.0 136-137 12.275 0.0 0.0 0.0 0.0 138-139 12.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 95 3.6379788E-12 68.68421 9 AGAGCGT 105 9.094947E-12 62.142857 8 GAAGAGC 115 2.1827873E-11 56.739132 6 GATCGGA 120 3.45608E-11 54.375 1 TCGGAAG 120 3.45608E-11 54.375 3 AAGAGCG 125 5.0931703E-11 52.2 7 CGGAAGA 125 5.0931703E-11 52.2 4 ATCGGAA 125 5.0931703E-11 52.2 2 GGAAGAG 125 5.0931703E-11 52.2 5 ATTAAAA 45 2.538036E-8 28.999998 55-59 TCATTAA 45 2.538036E-8 28.999998 50-54 TTAAAAA 45 2.538036E-8 28.999998 55-59 CATTAAA 50 7.0600436E-8 26.1 50-54 CGTATCA 45 8.383813E-7 25.777777 45-49 ATCATTA 45 8.383813E-7 25.777777 50-54 TAAAAAA 55 1.7761704E-7 23.727274 55-59 GGTCGCC 55 1.7761704E-7 23.727274 40-44 TGGTCGC 50 2.0994885E-6 23.199999 40-44 TCGGTGG 50 2.0994885E-6 23.199999 35-39 GTATCAT 50 2.0994885E-6 23.199999 50-54 >>END_MODULE Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125021 spots for SRR5578438.sra Written 1125021 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra Read 1125017 spots for SRR5578438.sra Written 1125017 spots for SRR5578438.sra SRR ids: ['SRR5578438.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y2ld79ow SRR5578438.sra spots: 22500344 blocks: [[1, 1125017], [1125018, 2250034], [2250035, 3375051], [3375052, 4500068], [4500069, 5625085], [5625086, 6750102], [6750103, 7875119], [7875120, 9000136], [9000137, 10125153], [10125154, 11250170], [11250171, 12375187], [12375188, 13500204], [13500205, 14625221], [14625222, 15750238], [15750239, 16875255], [16875256, 18000272], [18000273, 19125289], [19125290, 20250306], [20250307, 21375323], [21375324, 22500344]] SRR5578438 file size 7602927 SRR5578438 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578438 SRR5578438_1.fastq SRR5578438_2.fastq Input file: SRR5578438_1.fastq Paired file: SRR5578438_2.fastq trimmed: SRR5578438-trimmed-pair1.fastq, SRR5578438-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:32:40 2024 >> started Mon Dec 9 17:33:07 2024 >> done (26.811s) 22500344 read pairs processed; of these: 32655 ( 0.15%) short read pairs filtered out after trimming by size control 3667568 (16.30%) empty read pairs filtered out after trimming by size control 18800121 (83.55%) read pairs available; of these: 10131170 (53.89%) trimmed read pairs available after processing 8668951 (46.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 29 0.00% 20 30 0.00% 21 1985 0.01% 22 39 0.00% 23 29 0.00% 24 25 0.00% 25 18 0.00% 26 34 0.00% 27 35 0.00% 28 29 0.00% 29 42 0.00% 30 44 0.00% 31 57 0.00% 32 49 0.00% 33 39 0.00% 34 58 0.00% 35 47 0.00% 36 52 0.00% 37 59 0.00% 38 56 0.00% 39 62 0.00% 40 97 0.00% 41 75 0.00% 42 112 0.00% 43 145 0.00% 44 323 0.00% 45 544 0.00% 46 876 0.00% 47 824 0.00% 48 772 0.00% 49 736 0.00% 50 703 0.00% 51 756 0.00% 52 824 0.00% 53 808 0.00% 54 874 0.00% 55 918 0.00% 56 1029 0.01% 57 1003 0.01% 58 1038 0.01% 59 1079 0.01% 60 1145 0.01% 61 1254 0.01% 62 1425 0.01% 63 1540 0.01% 64 1736 0.01% 65 3135 0.02% 66 3162 0.02% 67 2688 0.01% 68 3228 0.02% 69 5943 0.03% 70 8385 0.04% 71 5589 0.03% 72 4817 0.03% 73 4802 0.03% 74 5295 0.03% 75 5569 0.03% 76 6091 0.03% 77 6801 0.04% 78 7413 0.04% 79 8332 0.04% 80 9214 0.05% 81 10233 0.05% 82 11569 0.06% 83 12977 0.07% 84 14973 0.08% 85 15978 0.08% 86 16915 0.09% 87 18450 0.10% 88 19710 0.10% 89 20459 0.11% 90 22399 0.12% 91 23843 0.13% 92 25477 0.14% 93 27274 0.15% 94 29089 0.15% 95 30620 0.16% 96 32239 0.17% 97 33554 0.18% 98 35065 0.19% 99 36677 0.20% 100 38461 0.20% 101 40310 0.21% 102 42138 0.22% 103 44368 0.24% 104 46122 0.25% 105 47787 0.25% 106 49834 0.27% 107 51944 0.28% 108 53332 0.28% 109 54856 0.29% 110 56316 0.30% 111 58348 0.31% 112 60630 0.32% 113 62269 0.33% 114 64798 0.34% 115 67429 0.36% 116 68596 0.36% 117 70950 0.38% 118 72318 0.38% 119 73155 0.39% 120 74826 0.40% 121 77045 0.41% 122 78561 0.42% 123 80878 0.43% 124 83058 0.44% 125 85601 0.46% 126 87835 0.47% 127 89357 0.48% 128 90835 0.48% 129 92833 0.49% 130 93938 0.50% 131 95449 0.51% 132 97763 0.52% 133 100336 0.53% 134 102292 0.54% 135 105381 0.56% 136 108488 0.58% 137 111082 0.59% 138 114102 0.61% 139 119237 0.63% 140 123079 0.65% 141 129727 0.69% 142 138799 0.74% 143 147769 0.79% 144 162109 0.86% 145 182507 0.97% 146 214803 1.14% 147 273435 1.45% 148 396056 2.11% 149 772298 4.11% 150 4026288 21.42% 151 8668951 46.11% 18800121 reads passed initial QC criterion=sequence-density sequence-density=1.03 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=17 prefix-density=1.10 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=44.64 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.0 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=9 prefix-density=0.99 prefix-fanout=3.2 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=22 fanout-score=88.17 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578438 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:33:55 Started mapping on | Dec 09 17:33:55 Finished on | Dec 09 17:37:00 Mapping speed, Million of reads per hour | 365.84 Number of input reads | 18800121 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 17459100 Uniquely mapped reads % | 92.87% Average mapped length | 287.65 Number of splices: Total | 17815517 Number of splices: Annotated (sjdb) | 16797079 Number of splices: GT/AG | 17577960 Number of splices: GC/AG | 216695 Number of splices: AT/AC | 8765 Number of splices: Non-canonical | 12097 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294185 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 46433 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.03% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1058578 1058578 1058578 N_multimapping 294185 294185 294185 N_noFeature 595902 16956868 761107 N_ambiguous 402124 2401 65377 UnstrandedReadsAssigned:16461074 PositiveStrandReadsAssigned:499831 NegativeStrandReadsAssigned:16632616 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5578438 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578438-trimmed-pair1.fastq SRR5578438-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,800,121 reads, 16,750,649 reads pseudoaligned [quant] estimated average fragment length: 229.046 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52973 SRR5578438.ke.tsv 35125 SRR5578438.se.tsv 88098 total ==> SRR5578438.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 708.31 0 0 PNS24247 1044 815.954 40.4613 4.01262 PNS24249 1928 1699.95 101.478 4.83046 PNS24246 1044 815.954 40.4613 4.01262 PNS24248 1044 815.954 40.4613 4.01262 PNS24244 1471 1242.95 76.1382 4.9568 PNS24243 293 111.313 0 0 KQK14069 1603 1374.95 448.633 26.4032 KQK14071 474 260.379 14.3619 4.46333 ==> SRR5578438.se.tsv <== BRADI_1g14170v3 476 BRADI_1g53295v3 62 BRADI_1g59795v3 271 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 2190 BRADI_1g74790v3 251 BRADI_1g09890v3 5 BRADI_1g77505v3 324 BRADI_1g48960v3 0 SRR5578438 completed mapping pipeline successfully