Starting /dee2/code/volunteer_pipeline.sh SRR5578439 current disk space = 1523750981632 free memory = 1578395812 SRR5578439 SRAfilesize 0df9219071505fd6629225b4f6899a81 SRR5578439.sra SRR5578439.sra file validated SRR5578439 is paired end SRR5578439 is conventional basespace SRR5578439 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578439_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01 34.0 33.0 34.0 32.0 34.0 2 33.18575 34.0 33.0 34.0 32.0 34.0 3 33.30725 34.0 34.0 34.0 32.0 34.0 4 33.41125 34.0 34.0 34.0 33.0 34.0 5 33.4405 34.0 34.0 34.0 33.0 34.0 6 36.972 38.0 37.0 38.0 35.0 38.0 7 37.30125 38.0 38.0 38.0 36.0 38.0 8 37.5035 38.0 38.0 38.0 37.0 38.0 9 37.52475 38.0 38.0 38.0 37.0 38.0 10-14 37.5006 38.0 38.0 38.0 37.8 38.0 15-19 37.49995 38.0 38.0 38.0 37.8 38.0 20-24 37.467400000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.4335 38.0 38.0 38.0 37.2 38.0 30-34 37.3797 38.0 38.0 38.0 37.0 38.0 35-39 37.3143 38.0 38.0 38.0 37.0 38.0 40-44 37.22625 38.0 38.0 38.0 36.8 38.0 45-49 37.1418 38.0 38.0 38.0 36.0 38.0 50-54 37.072799999999994 38.0 38.0 38.0 36.0 38.0 55-59 37.018150000000006 38.0 38.0 38.0 35.8 38.0 60-64 36.93384999999999 38.0 38.0 38.0 35.2 38.0 65-69 36.849900000000005 38.0 38.0 38.0 35.0 38.0 70-74 36.8058 38.0 38.0 38.0 35.0 38.0 75-79 36.64335 38.0 38.0 38.0 34.4 38.0 80-84 36.5929 38.0 38.0 38.0 34.0 38.0 85-89 36.5021 38.0 38.0 38.0 34.0 38.0 90-94 36.33710000000001 38.0 38.0 38.0 33.8 38.0 95-99 36.18605 38.0 37.6 38.0 33.0 38.0 100-104 36.09535 38.0 37.0 38.0 33.4 38.0 105-109 35.86755 38.0 37.0 38.0 32.8 38.0 110-114 35.62339999999999 38.0 36.0 38.0 31.0 38.0 115-119 35.393350000000005 38.0 36.0 38.0 30.2 38.0 120-124 35.04215000000001 38.0 35.0 38.0 28.4 38.0 125-129 34.8941 38.0 35.0 38.0 28.0 38.0 130-134 34.56425 38.0 35.0 38.0 26.8 38.0 135-139 34.05045 38.0 34.4 38.0 23.4 38.0 140-144 33.510549999999995 38.0 34.0 38.0 20.6 38.0 145-149 32.63575 38.0 33.2 38.0 15.0 38.0 150-151 27.890375 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 1.0 15 4.0 16 3.0 17 5.0 18 3.0 19 6.0 20 4.0 21 11.0 22 7.0 23 9.0 24 6.0 25 19.0 26 19.0 27 17.0 28 31.0 29 43.0 30 39.0 31 54.0 32 93.0 33 111.0 34 164.0 35 356.0 36 895.0 37 2094.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.45899921404244 10.6366256222164 8.226355776788054 36.6780193869531 2 26.3 12.525 32.525 28.65 3 23.875 17.299999999999997 24.425 34.4 4 29.049999999999997 25.15 20.025000000000002 25.775 5 25.650000000000002 29.775000000000002 22.6 21.975 6 23.35 31.974999999999998 22.975 21.7 7 18.925 22.825 38.675 19.575 8 21.95 23.075000000000003 28.549999999999997 26.424999999999997 9 21.2 20.825 31.025000000000002 26.950000000000003 10-14 24.23 25.729999999999997 24.685000000000002 25.355 15-19 24.935 24.275 25.095 25.695 20-24 23.905 24.795 25.14 26.16 25-29 24.685000000000002 24.41 24.48 26.424999999999997 30-34 23.61 24.88 25.135 26.375 35-39 24.355 24.305 24.86 26.479999999999997 40-44 24.935 24.099999999999998 24.48 26.484999999999996 45-49 24.425 24.925 24.2 26.450000000000003 50-54 25.019999999999996 24.84 23.805 26.334999999999997 55-59 24.9 24.175 25.009999999999998 25.915 60-64 24.69 24.315 24.51 26.484999999999996 65-69 24.37 24.575 24.69 26.365 70-74 25.230000000000004 24.104999999999997 24.08 26.584999999999997 75-79 24.975 24.25 24.41 26.365 80-84 24.805 24.55 24.08 26.565 85-89 25.295 24.02 24.51 26.174999999999997 90-94 25.924999999999997 24.065 23.724999999999998 26.284999999999997 95-99 24.955 24.279999999999998 24.235 26.529999999999998 100-104 25.695 24.34 23.345 26.619999999999997 105-109 25.685000000000002 24.485 23.48 26.35 110-114 25.679999999999996 24.19 24.11 26.02 115-119 25.34 24.59 23.494999999999997 26.575 120-124 24.89 24.995 23.325000000000003 26.790000000000003 125-129 24.985 24.39 23.405 27.22 130-134 25.669999999999998 25.11 22.91 26.31 135-139 24.65 24.245 23.73 27.375 140-144 25.045 24.73 23.32 26.905 145-149 24.745 24.959999999999997 23.27 27.025 150-151 24.965620702587824 24.440555069383674 23.44043005375672 27.15339417427178 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 1.5 28 2.0 29 3.5 30 6.0 31 11.0 32 16.5 33 18.0 34 23.5 35 35.5 36 43.5 37 62.0 38 85.5 39 94.0 40 109.0 41 126.5 42 144.0 43 157.5 44 170.0 45 174.0 46 154.0 47 153.0 48 164.5 49 155.0 50 126.0 51 128.0 52 139.5 53 111.0 54 105.0 55 112.0 56 108.5 57 99.0 58 94.0 59 96.5 60 99.0 61 85.5 62 69.0 63 79.5 64 77.5 65 76.5 66 71.0 67 64.5 68 65.0 69 56.0 70 43.5 71 32.0 72 29.5 73 27.5 74 24.0 75 19.5 76 15.0 77 10.5 78 5.5 79 5.0 80 3.0 81 1.0 82 1.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.808489135927236 1.6 3 0.05053057099545225 0.15 4 0.05053057099545225 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.9125 0.0 0.0 0.0 0.0 98-99 2.2625 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 2.925 0.0 0.0 0.0 0.0 104-105 3.2 0.0 0.0 0.0 0.0 106-107 3.5375 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.4125 0.0 0.0 0.0 0.0 112-113 5.0 0.0 0.0 0.0 0.0 114-115 5.5625 0.0 0.0 0.0 0.0 116-117 6.074999999999999 0.0 0.0 0.0 0.0 118-119 6.6 0.0 0.0 0.0 0.0 120-121 7.175000000000001 0.0 0.0 0.0 0.0 122-123 7.825 0.0 0.0 0.0 0.0 124-125 8.5875 0.0 0.0 0.0 0.0 126-127 9.3125 0.0 0.0 0.0 0.0 128-129 9.9125 0.0 0.0 0.0 0.0 130-131 10.725000000000001 0.0 0.0 0.0 0.0 132-133 11.575 0.0 0.0 0.0 0.0 134-135 12.2375 0.0 0.0 0.0 0.0 136-137 13.0125 0.0 0.0 0.0 0.0 138-139 14.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578439 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578439_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8635 33.0 33.0 34.0 32.0 34.0 2 32.998 33.0 33.0 34.0 32.0 34.0 3 33.0095 34.0 33.0 34.0 32.0 34.0 4 32.98025 34.0 33.0 34.0 32.0 34.0 5 33.0315 34.0 33.0 34.0 32.0 34.0 6 37.0405 38.0 38.0 38.0 36.0 38.0 7 37.18775 38.0 38.0 38.0 37.0 38.0 8 37.1335 38.0 38.0 38.0 37.0 38.0 9 37.14325 38.0 38.0 38.0 37.0 38.0 10-14 37.083099999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.05535 38.0 38.0 38.0 36.6 38.0 20-24 37.0564 38.0 38.0 38.0 36.8 38.0 25-29 36.9778 38.0 38.0 38.0 36.4 38.0 30-34 37.004949999999994 38.0 38.0 38.0 36.6 38.0 35-39 37.0011 38.0 38.0 38.0 36.4 38.0 40-44 36.98155 38.0 38.0 38.0 36.4 38.0 45-49 36.9511 38.0 38.0 38.0 36.2 38.0 50-54 36.89639999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.8763 38.0 38.0 38.0 36.0 38.0 60-64 36.8123 38.0 38.0 38.0 36.0 38.0 65-69 36.763 38.0 38.0 38.0 35.8 38.0 70-74 36.65355 38.0 38.0 38.0 35.0 38.0 75-79 36.549350000000004 38.0 38.0 38.0 34.8 38.0 80-84 36.51495 38.0 38.0 38.0 34.6 38.0 85-89 36.40575 38.0 38.0 38.0 34.2 38.0 90-94 36.24595 38.0 38.0 38.0 34.0 38.0 95-99 36.097449999999995 38.0 38.0 38.0 34.0 38.0 100-104 35.9841 38.0 38.0 38.0 33.4 38.0 105-109 35.8295 38.0 37.8 38.0 33.0 38.0 110-114 35.58505 38.0 37.2 38.0 31.6 38.0 115-119 35.35695 38.0 36.6 38.0 30.6 38.0 120-124 34.91215 38.0 35.8 38.0 28.2 38.0 125-129 34.5074 38.0 35.0 38.0 26.2 38.0 130-134 34.171 38.0 34.4 38.0 24.0 38.0 135-139 33.72285 38.0 33.0 38.0 22.8 38.0 140-144 33.0673 38.0 33.0 38.0 18.8 38.0 145-149 31.892549999999993 38.0 32.6 38.0 8.2 38.0 150-151 26.33575 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 4.0 5 0.0 6 1.0 7 4.0 8 2.0 9 0.0 10 2.0 11 1.0 12 2.0 13 2.0 14 4.0 15 3.0 16 7.0 17 8.0 18 8.0 19 9.0 20 8.0 21 8.0 22 11.0 23 10.0 24 24.0 25 20.0 26 21.0 27 18.0 28 36.0 29 40.0 30 46.0 31 67.0 32 69.0 33 100.0 34 144.0 35 316.0 36 685.0 37 2310.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.0 17.424999999999997 11.799999999999999 30.775000000000002 2 29.575000000000003 23.175 24.95 22.3 3 24.55 24.025 25.95 25.474999999999998 4 27.325 30.85 18.8 23.025000000000002 5 28.475 30.85 19.15 21.525 6 23.325000000000003 33.375 20.4 22.900000000000002 7 24.125 16.875 33.925 25.074999999999996 8 24.95 21.55 23.225 30.275000000000002 9 24.725 20.9 26.8 27.575 10-14 26.475590236094437 25.210084033613445 22.283913565426168 26.030412164865947 15-19 26.66366456519564 24.061843290303212 23.226258380866607 26.048233763634542 20-24 26.700025018764073 24.96872654490868 22.897172879659745 25.4340755566675 25-29 26.905560282268155 24.38816876032231 22.49637155297533 26.20989940443421 30-34 26.495469790258795 24.017620263302796 23.221704960704812 26.265204985733593 35-39 26.943290454977724 24.57079933930627 22.768907352720355 25.717002852995645 40-44 26.880160120090068 24.22316737553165 22.96222166624969 25.934450838128598 45-49 26.36108887109688 24.119295436349077 23.488791032826263 26.03082465972778 50-54 26.627633488465197 24.17554921683431 23.68012810889256 25.51668918580794 55-59 26.49251864084472 23.710153630586 23.71515788420157 26.082169844367716 60-64 26.45277541418489 24.125331598178086 23.67485860153161 25.747034386105412 65-69 26.568210262828533 23.844806007509387 23.67959949937422 25.90738423028786 70-74 26.958698372966204 24.09511889862328 22.943679599499376 26.002503128911137 75-79 26.347934918648306 23.909887359198997 23.714643304130163 26.02753441802253 80-84 26.763454317897374 23.9549436795995 23.88986232790989 25.39173967459324 85-89 26.7704319103148 23.767579200240228 23.46228917471598 25.99969971472899 90-94 27.120340255191394 24.108081060795598 23.74781085814361 25.023767825869403 95-99 26.31236551068408 25.281489265875994 22.999549617174598 25.406595606265327 100-104 27.586206896551722 23.77758870927381 23.42225113858165 25.213953255592813 105-109 27.420162178396236 24.51196315947542 22.674942436680347 25.392932225447996 110-114 27.52941176470588 24.30538172715895 23.1639549436796 25.00125156445557 115-119 27.939924906132667 24.220275344180227 22.543178973717147 25.296620775969963 120-124 27.952144966711717 25.128898232967913 22.495870250788407 24.423086549531963 125-129 27.563942139246205 24.195405175434207 23.66484809049502 24.575804594824564 130-134 28.597167308943494 24.958710775236476 22.87172814173465 23.57239377408538 135-139 28.696522391793845 25.38403802852139 22.727045283962973 23.19239429572179 140-144 29.1739630759994 24.836143493270626 22.69975484064642 23.290138590083554 145-149 28.836627470602956 25.42907180385289 22.992244183137352 22.742056542406804 150-151 29.361010378892082 25.397023883956482 22.808553207452796 22.433412529698636 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 2.0 29 4.0 30 2.0 31 5.5 32 10.5 33 14.5 34 22.0 35 29.5 36 33.0 37 48.0 38 63.5 39 71.0 40 86.5 41 115.5 42 131.0 43 129.5 44 138.5 45 155.0 46 157.5 47 152.5 48 158.0 49 158.5 50 140.0 51 131.0 52 132.5 53 119.5 54 109.0 55 108.5 56 107.5 57 109.0 58 108.5 59 117.0 60 119.5 61 99.5 62 96.5 63 92.5 64 82.5 65 75.0 66 74.0 67 76.5 68 65.0 69 63.5 70 66.0 71 47.5 72 33.0 73 34.0 74 31.5 75 22.5 76 16.5 77 12.0 78 6.5 79 3.0 80 2.0 81 2.0 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.04 15-19 0.06999999999999999 20-24 0.075 25-29 0.095 30-34 0.11499999999999999 35-39 0.105 40-44 0.075 45-49 0.08 50-54 0.08499999999999999 55-59 0.08499999999999999 60-64 0.105 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.095 90-94 0.075 95-99 0.08499999999999999 100-104 0.095 105-109 0.11 110-114 0.125 115-119 0.125 120-124 0.11499999999999999 125-129 0.105 130-134 0.095 135-139 0.075 140-144 0.065 145-149 0.075 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67617107942974 96.89999999999999 2 0.9928716904276985 1.95 3 0.17820773930753564 0.525 4 0.12729124236252545 0.5 5 0.02545824847250509 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2000000000000002 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.8625 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.825 0.0 0.0 0.0 0.0 104-105 3.0999999999999996 0.0 0.0 0.0 0.0 106-107 3.4375 0.0 0.0 0.0 0.0 108-109 3.8 0.0 0.0 0.0 0.0 110-111 4.300000000000001 0.0 0.0 0.0 0.0 112-113 4.925 0.0 0.0 0.0 0.0 114-115 5.5 0.0 0.0 0.0 0.0 116-117 6.075 0.0 0.0 0.0 0.0 118-119 6.6625 0.0 0.0 0.0 0.0 120-121 7.2 0.0 0.0 0.0 0.0 122-123 7.825 0.0 0.0 0.0 0.0 124-125 8.575 0.0 0.0 0.0 0.0 126-127 9.325 0.0 0.0 0.0 0.0 128-129 9.9375 0.0 0.0 0.0 0.0 130-131 10.7375 0.0 0.0 0.0 0.0 132-133 11.55 0.0 0.0 0.0 0.0 134-135 12.2 0.0 0.0 0.0 0.0 136-137 12.9625 0.0 0.0 0.0 0.0 138-139 14.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTGTC 10 0.006830828 145.0 6 >>END_MODULE Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185231 spots for SRR5578439.sra Written 1185231 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra Read 1185213 spots for SRR5578439.sra Written 1185213 spots for SRR5578439.sra SRR ids: ['SRR5578439.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dt6ovrzs SRR5578439.sra spots: 23704278 blocks: [[1, 1185213], [1185214, 2370426], [2370427, 3555639], [3555640, 4740852], [4740853, 5926065], [5926066, 7111278], [7111279, 8296491], [8296492, 9481704], [9481705, 10666917], [10666918, 11852130], [11852131, 13037343], [13037344, 14222556], [14222557, 15407769], [15407770, 16592982], [16592983, 17778195], [17778196, 18963408], [18963409, 20148621], [20148622, 21333834], [21333835, 22519047], [22519048, 23704278]] SRR5578439 file size 8010901 SRR5578439 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578439 SRR5578439_1.fastq SRR5578439_2.fastq Input file: SRR5578439_1.fastq Paired file: SRR5578439_2.fastq trimmed: SRR5578439-trimmed-pair1.fastq, SRR5578439-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:36:41 2024 >> started Mon Dec 9 17:37:06 2024 >> done (25.047s) 23704278 read pairs processed; of these: 52711 ( 0.22%) short read pairs filtered out after trimming by size control 53294 ( 0.22%) empty read pairs filtered out after trimming by size control 23598273 (99.55%) read pairs available; of these: 13522156 (57.30%) trimmed read pairs available after processing 10076117 (42.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 15 0.00% 20 28 0.00% 21 16 0.00% 22 16 0.00% 23 14 0.00% 24 29 0.00% 25 9 0.00% 26 22 0.00% 27 22 0.00% 28 34 0.00% 29 20 0.00% 30 43 0.00% 31 39 0.00% 32 34 0.00% 33 44 0.00% 34 36 0.00% 35 58 0.00% 36 81 0.00% 37 64 0.00% 38 76 0.00% 39 93 0.00% 40 87 0.00% 41 131 0.00% 42 151 0.00% 43 105 0.00% 44 135 0.00% 45 169 0.00% 46 222 0.00% 47 214 0.00% 48 279 0.00% 49 290 0.00% 50 369 0.00% 51 382 0.00% 52 464 0.00% 53 448 0.00% 54 575 0.00% 55 568 0.00% 56 662 0.00% 57 771 0.00% 58 879 0.00% 59 1050 0.00% 60 1165 0.00% 61 1369 0.01% 62 1575 0.01% 63 1811 0.01% 64 1980 0.01% 65 2181 0.01% 66 2518 0.01% 67 2881 0.01% 68 3324 0.01% 69 4272 0.02% 70 4687 0.02% 71 4867 0.02% 72 5758 0.02% 73 6250 0.03% 74 6853 0.03% 75 7694 0.03% 76 8347 0.04% 77 9141 0.04% 78 10394 0.04% 79 11706 0.05% 80 12586 0.05% 81 14140 0.06% 82 16266 0.07% 83 17878 0.08% 84 20947 0.09% 85 22918 0.10% 86 24151 0.10% 87 26104 0.11% 88 27552 0.12% 89 28836 0.12% 90 30261 0.13% 91 32611 0.14% 92 34332 0.15% 93 37033 0.16% 94 39216 0.17% 95 40965 0.17% 96 43165 0.18% 97 45171 0.19% 98 46320 0.20% 99 48377 0.21% 100 50079 0.21% 101 52842 0.22% 102 55247 0.23% 103 57635 0.24% 104 60025 0.25% 105 62180 0.26% 106 64450 0.27% 107 66073 0.28% 108 67188 0.28% 109 70208 0.30% 110 71338 0.30% 111 74161 0.31% 112 77171 0.33% 113 79531 0.34% 114 82134 0.35% 115 85740 0.36% 116 87398 0.37% 117 88801 0.38% 118 90634 0.38% 119 90711 0.38% 120 93470 0.40% 121 95485 0.40% 122 98252 0.42% 123 101543 0.43% 124 104970 0.44% 125 107580 0.46% 126 110071 0.47% 127 111576 0.47% 128 113054 0.48% 129 116661 0.49% 130 118305 0.50% 131 119888 0.51% 132 124150 0.53% 133 127468 0.54% 134 131113 0.56% 135 135250 0.57% 136 138691 0.59% 137 143305 0.61% 138 148866 0.63% 139 157064 0.67% 140 163561 0.69% 141 173684 0.74% 142 187760 0.80% 143 203739 0.86% 144 227785 0.97% 145 262137 1.11% 146 315404 1.34% 147 411327 1.74% 148 601730 2.55% 149 1147656 4.86% 150 5280710 22.38% 151 10076117 42.70% 23598273 reads passed initial QC criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=15 prefix-density=1.02 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=10.04 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.7 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=13 prefix-density=0.73 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=65.56 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578439 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:37:53 Started mapping on | Dec 09 17:37:53 Finished on | Dec 09 17:41:51 Mapping speed, Million of reads per hour | 356.95 Number of input reads | 23598273 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 21817763 Uniquely mapped reads % | 92.45% Average mapped length | 286.94 Number of splices: Total | 20578169 Number of splices: Annotated (sjdb) | 19477621 Number of splices: GT/AG | 20320733 Number of splices: GC/AG | 234664 Number of splices: AT/AC | 9560 Number of splices: Non-canonical | 13212 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324720 % of reads mapped to multiple loci | 1.38% Number of reads mapped to too many loci | 48298 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.89% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1481079 1481079 1481079 N_multimapping 324720 324720 324720 N_noFeature 620546 21187961 800595 N_ambiguous 525707 2108 77507 UnstrandedReadsAssigned:20671510 PositiveStrandReadsAssigned:627694 NegativeStrandReadsAssigned:20939661 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR5578439 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578439-trimmed-pair1.fastq SRR5578439-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,598,273 reads, 21,033,652 reads pseudoaligned [quant] estimated average fragment length: 226.962 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR5578439.ke.tsv 35125 SRR5578439.se.tsv 88098 total ==> SRR5578439.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 710.333 22.3478 1.97473 PNS24247 1044 818.038 38.1867 2.93003 PNS24249 1928 1702.04 76.5482 2.82293 PNS24246 1044 818.038 38.1867 2.93003 PNS24248 1044 818.038 38.1867 2.93003 PNS24244 1471 1245.04 91.544 4.6151 PNS24243 293 110.56 0 0 KQK14069 1603 1377.04 284.272 12.9575 KQK14071 474 260.564 7.87187 1.89626 ==> SRR5578439.se.tsv <== BRADI_1g14170v3 311 BRADI_1g53295v3 118 BRADI_1g59795v3 352 BRADI_1g07683v3 0 BRADI_1g00485v3 38 BRADI_1g20270v3 1455 BRADI_1g74790v3 140 BRADI_1g09890v3 7 BRADI_1g77505v3 346 BRADI_1g48960v3 0 SRR5578439 completed mapping pipeline successfully