Starting /dee2/code/volunteer_pipeline.sh SRR5578440 current disk space = 1523694628864 free memory = 1576076120 SRR5578440 SRAfilesize ef975bf310d8d7c45e6d98eac179c31f SRR5578440.sra SRR5578440.sra file validated SRR5578440 is paired end SRR5578440 is conventional basespace SRR5578440 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578440_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.898 34.0 34.0 34.0 33.0 34.0 2 33.3785 34.0 34.0 34.0 33.0 34.0 3 33.5175 34.0 34.0 34.0 33.0 34.0 4 33.55225 34.0 34.0 34.0 33.0 34.0 5 33.42125 34.0 34.0 34.0 33.0 34.0 6 37.199 38.0 38.0 38.0 36.0 38.0 7 37.497 38.0 38.0 38.0 37.0 38.0 8 37.53175 38.0 38.0 38.0 38.0 38.0 9 37.65375 38.0 38.0 38.0 38.0 38.0 10-14 37.625 38.0 38.0 38.0 38.0 38.0 15-19 37.63314999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.6235 38.0 38.0 38.0 38.0 38.0 25-29 37.622699999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5959 38.0 38.0 38.0 38.0 38.0 35-39 37.56105 38.0 38.0 38.0 38.0 38.0 40-44 37.45575 38.0 38.0 38.0 37.6 38.0 45-49 37.4232 38.0 38.0 38.0 37.0 38.0 50-54 37.376099999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.374900000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.3512 38.0 38.0 38.0 37.0 38.0 65-69 37.24685 38.0 38.0 38.0 36.6 38.0 70-74 37.2145 38.0 38.0 38.0 36.4 38.0 75-79 37.01325 38.0 38.0 38.0 36.0 38.0 80-84 36.9956 38.0 38.0 38.0 36.0 38.0 85-89 36.8387 38.0 38.0 38.0 35.2 38.0 90-94 36.787099999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.675999999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.5572 38.0 38.0 38.0 34.6 38.0 105-109 36.47905 38.0 38.0 38.0 34.0 38.0 110-114 36.30225 38.0 38.0 38.0 34.0 38.0 115-119 36.2279 38.0 38.0 38.0 33.6 38.0 120-124 35.97605 38.0 37.6 38.0 33.0 38.0 125-129 35.61905 38.0 36.2 38.0 32.0 38.0 130-134 35.3911 38.0 36.0 38.0 31.0 38.0 135-139 34.9966 38.0 35.6 38.0 28.4 38.0 140-144 34.659850000000006 38.0 35.0 38.0 27.8 38.0 145-149 34.1134 38.0 35.0 38.0 25.8 38.0 150-151 30.262874999999998 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 2.0 12 2.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 9.0 19 10.0 20 2.0 21 4.0 22 6.0 23 5.0 24 4.0 25 6.0 26 9.0 27 14.0 28 22.0 29 28.0 30 39.0 31 47.0 32 50.0 33 62.0 34 116.0 35 219.0 36 660.0 37 2679.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.2320244773075 10.68332483426823 9.153493115757266 34.931157572667004 2 27.500000000000004 12.125 29.65 30.725 3 24.081020255063766 15.753938484621155 22.355588897224308 37.80945236309077 4 28.675 23.400000000000002 20.875 27.05 5 29.23154193872426 26.971371170266195 21.747865394274235 22.049221496735306 6 25.275 29.175 22.45 23.1 7 20.225 21.275 37.6 20.9 8 22.675 21.85 28.349999999999998 27.125 9 20.974999999999998 21.65 31.324999999999996 26.05 10-14 25.480000000000004 24.575 23.595 26.35 15-19 25.180000000000003 23.77 24.845 26.205000000000002 20-24 25.590000000000003 23.615 24.44 26.355 25-29 24.665 24.005000000000003 24.075 27.255000000000003 30-34 25.185000000000002 23.74 24.025 27.05 35-39 25.5 23.41 24.365000000000002 26.724999999999998 40-44 25.495 23.78 23.810000000000002 26.915 45-49 25.119999999999997 23.87 24.169999999999998 26.840000000000003 50-54 25.490000000000002 23.205000000000002 23.94 27.365000000000002 55-59 25.324999999999996 23.365 24.375 26.935 60-64 26.035000000000004 23.825 23.775 26.365 65-69 25.455 22.825 24.15 27.57 70-74 25.650000000000002 24.025 23.215 27.11 75-79 25.735000000000003 23.599999999999998 24.145 26.52 80-84 25.430000000000003 23.68 24.135 26.755000000000003 85-89 26.665 23.365 23.565 26.405 90-94 26.445 23.799999999999997 23.265 26.490000000000002 95-99 25.95 23.845 23.885 26.32 100-104 26.63 23.355 23.375 26.640000000000004 105-109 26.41 24.19 22.795 26.605 110-114 26.240000000000002 23.84 22.785 27.134999999999998 115-119 26.08 24.26 23.345 26.314999999999998 120-124 25.869402051538653 24.168126094570926 23.072304228171127 26.89016762571929 125-129 26.11002653051009 23.847424538218952 22.96641137307904 27.07613755819192 130-134 25.79595514617541 23.718462154585502 23.222867440929114 27.26271525830997 135-139 25.665665665665667 23.50850850850851 23.55855855855856 27.267267267267272 140-144 25.348802320348053 24.59868980347052 23.38350752612892 26.669000350052507 145-149 25.5962798139907 24.65123256162808 23.171158557927896 26.581329066453325 150-151 25.544976196441993 24.7557003257329 22.964169381107492 26.73515409671762 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 2.0 28 1.5 29 2.5 30 4.5 31 9.0 32 12.0 33 15.5 34 18.5 35 23.0 36 36.0 37 49.0 38 62.5 39 82.0 40 102.5 41 112.0 42 124.0 43 125.0 44 127.5 45 147.0 46 169.0 47 174.5 48 153.0 49 151.0 50 147.5 51 136.5 52 124.5 53 112.5 54 112.5 55 116.5 56 104.5 57 97.0 58 103.5 59 104.0 60 106.0 61 95.0 62 87.5 63 89.5 64 84.5 65 75.0 66 74.0 67 68.0 68 64.5 69 68.5 70 62.5 71 49.0 72 42.5 73 42.5 74 37.5 75 27.0 76 15.0 77 12.0 78 10.0 79 9.0 80 6.0 81 1.5 82 1.0 83 3.0 84 2.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.025 4 0.0 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.075 125-129 0.11499999999999999 130-134 0.12 135-139 0.1 140-144 0.015 145-149 0.005 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.7029501525941 97.02499999999999 2 1.0681586978636826 2.1 3 0.1780264496439471 0.525 4 0.025432349949135298 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025432349949135298 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 10 0.25 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.7875 0.0 0.0 0.0 0.0 82-83 1.05 0.0 0.0 0.0 0.0 84-85 1.35 0.0 0.0 0.0 0.0 86-87 1.5875 0.0 0.0 0.0 0.0 88-89 1.925 0.0 0.0 0.0 0.0 90-91 2.2750000000000004 0.0 0.0 0.0 0.0 92-93 2.575 0.0 0.0 0.0 0.0 94-95 3.0374999999999996 0.0 0.0 0.0 0.0 96-97 3.55 0.0 0.0 0.0 0.0 98-99 4.15 0.0 0.0 0.0 0.0 100-101 4.625 0.0 0.0 0.0 0.0 102-103 4.949999999999999 0.0 0.0 0.0 0.0 104-105 5.4625 0.0 0.0 0.0 0.0 106-107 5.9625 0.0 0.0 0.0 0.0 108-109 6.637499999999999 0.0 0.0 0.0 0.0 110-111 7.375 0.0 0.0 0.0 0.0 112-113 7.975 0.0 0.0 0.0 0.0 114-115 8.4875 0.0 0.0 0.0 0.0 116-117 9.024999999999999 0.0 0.0 0.0 0.0 118-119 9.925 0.0 0.0 0.0 0.0 120-121 10.5875 0.0 0.0 0.0 0.0 122-123 11.525 0.0 0.0 0.0 0.0 124-125 12.3875 0.0 0.0 0.0 0.0 126-127 13.2125 0.0 0.0 0.0 0.0 128-129 14.05 0.0 0.0 0.0 0.0 130-131 14.5375 0.0 0.0 0.0 0.0 132-133 15.1375 0.0 0.0 0.0 0.0 134-135 15.987499999999999 0.0 0.0 0.0 0.0 136-137 16.75 0.0 0.0 0.0 0.0 138-139 17.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCGGT 10 0.006338066 148.6282 1 TTGTTTT 10 0.006843168 144.91249 9 AAAAAAA 170 7.2902883E-4 8.524265 65-69 >>END_MODULE SRR5578440 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578440_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.966 33.0 33.0 34.0 32.0 34.0 2 33.0625 34.0 33.0 34.0 32.0 34.0 3 33.10575 34.0 33.0 34.0 32.0 34.0 4 33.015 34.0 33.0 34.0 32.0 34.0 5 33.06625 34.0 33.0 34.0 33.0 34.0 6 37.194 38.0 38.0 38.0 37.0 38.0 7 37.2925 38.0 38.0 38.0 37.0 38.0 8 37.29075 38.0 38.0 38.0 37.0 38.0 9 37.1765 38.0 38.0 38.0 37.0 38.0 10-14 37.261799999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.217099999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.19685 38.0 38.0 38.0 37.0 38.0 25-29 37.17785 38.0 38.0 38.0 37.0 38.0 30-34 37.14555 38.0 38.0 38.0 37.0 38.0 35-39 37.102250000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.10775 38.0 38.0 38.0 37.0 38.0 45-49 37.10549999999999 38.0 38.0 38.0 36.8 38.0 50-54 36.97485 38.0 38.0 38.0 36.0 38.0 55-59 36.89825 38.0 38.0 38.0 36.0 38.0 60-64 36.773250000000004 38.0 38.0 38.0 35.4 38.0 65-69 36.6134 38.0 38.0 38.0 35.0 38.0 70-74 36.4476 38.0 38.0 38.0 34.2 38.0 75-79 36.37005 38.0 38.0 38.0 34.0 38.0 80-84 36.28845 38.0 38.0 38.0 34.0 38.0 85-89 36.1355 38.0 38.0 38.0 33.8 38.0 90-94 35.9917 38.0 38.0 38.0 33.4 38.0 95-99 35.7884 38.0 37.6 38.0 32.6 38.0 100-104 35.54515 38.0 37.0 38.0 31.4 38.0 105-109 35.2663 38.0 36.2 38.0 29.8 38.0 110-114 35.035450000000004 38.0 35.8 38.0 28.8 38.0 115-119 34.69245 38.0 35.2 38.0 26.8 38.0 120-124 34.20649999999999 38.0 35.0 38.0 23.6 38.0 125-129 33.62365 38.0 34.4 38.0 20.6 38.0 130-134 33.077299999999994 38.0 34.0 38.0 15.6 38.0 135-139 31.884549999999997 38.0 31.0 38.0 13.0 38.0 140-144 30.91945 36.4 30.6 38.0 10.8 38.0 145-149 29.198400000000003 36.0 27.0 38.0 2.0 38.0 150-151 23.64675 31.0 7.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 2.0 6 2.0 7 2.0 8 1.0 9 4.0 10 2.0 11 2.0 12 2.0 13 2.0 14 7.0 15 6.0 16 3.0 17 16.0 18 5.0 19 4.0 20 7.0 21 11.0 22 21.0 23 11.0 24 14.0 25 25.0 26 31.0 27 40.0 28 38.0 29 37.0 30 72.0 31 70.0 32 115.0 33 141.0 34 263.0 35 394.0 36 860.0 37 1784.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.125 17.875 12.25 30.75 2 29.80745186296574 23.605901475368842 24.33108277069267 22.255563890972745 3 25.1 24.85 24.099999999999998 25.95 4 29.507376844211052 29.382345586396596 18.35458864716179 22.755688922230558 5 28.907226806701676 30.48262065516379 19.079769942485623 21.530382595648913 6 24.675 32.25 18.85 24.224999999999998 7 22.775000000000002 19.825 32.675 24.725 8 24.275 22.275 21.725 31.724999999999998 9 23.825 22.650000000000002 25.874999999999996 27.650000000000002 10-14 25.905 25.25 21.275 27.57 15-19 26.345000000000002 23.635 22.945 27.075 20-24 26.334999999999997 24.065 22.095000000000002 27.505000000000003 25-29 26.045 25.155 21.98 26.82 30-34 26.505000000000003 23.585 23.400000000000002 26.51 35-39 27.02 24.22 22.335 26.424999999999997 40-44 26.645000000000003 23.805 22.725 26.825 45-49 27.41 23.385 22.57 26.634999999999998 50-54 27.055 23.815 22.715 26.415 55-59 26.86 23.244999999999997 22.575 27.32 60-64 26.52 24.265 22.689999999999998 26.525 65-69 26.665 24.365000000000002 22.869999999999997 26.1 70-74 26.805 23.155 23.294999999999998 26.745 75-79 26.695 23.35 23.34 26.615 80-84 27.16 23.64 23.165 26.035000000000004 85-89 26.650000000000002 23.880000000000003 23.035 26.435 90-94 27.834999999999997 24.11 22.45 25.605 95-99 27.810000000000002 23.9 22.445 25.845000000000002 100-104 28.384999999999998 24.075 22.35 25.19 105-109 27.87 24.37 22.189999999999998 25.569999999999997 110-114 27.834999999999997 24.465 22.56 25.14 115-119 28.494999999999997 25.040000000000003 21.875 24.59 120-124 28.82 24.785 21.584999999999997 24.81 125-129 28.625 25.06 21.775 24.54 130-134 29.695 24.455 21.75 24.099999999999998 135-139 29.054999999999996 24.435000000000002 22.314999999999998 24.195 140-144 29.459999999999997 25.105 22.08 23.355 145-149 28.79 26.605 21.73 22.875 150-151 29.515583927900863 26.411315558893477 21.21667292527225 22.85642758793341 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.0 28 2.0 29 1.0 30 3.0 31 5.0 32 6.0 33 7.0 34 11.5 35 19.5 36 24.5 37 38.5 38 56.5 39 67.5 40 93.5 41 108.0 42 109.0 43 126.0 44 139.5 45 145.0 46 155.0 47 162.0 48 146.5 49 130.5 50 131.0 51 131.5 52 124.5 53 118.0 54 122.5 55 118.0 56 121.0 57 119.5 58 108.5 59 106.5 60 105.0 61 100.0 62 104.0 63 110.0 64 90.5 65 83.5 66 89.5 67 78.0 68 77.0 69 77.5 70 67.5 71 57.0 72 46.5 73 44.5 74 31.5 75 18.5 76 13.0 77 13.5 78 9.5 79 6.0 80 6.0 81 1.5 82 2.5 83 4.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.30899308224443 95.92500000000001 2 1.2042018959774532 2.35 3 0.3843197540353574 1.125 4 0.05124263387138099 0.2 5 0.025621316935690495 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025621316935690495 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 11 0.27499999999999997 Illumina Single End PCR Primer 1 (100% over 50bp) CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.075 0.0 0.0 0.0 0.0 7 0.075 0.0 0.0 0.0 0.0 8 0.075 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.7625 0.0 0.0 0.0 0.0 82-83 1.0625 0.0 0.0 0.0 0.0 84-85 1.375 0.0 0.0 0.0 0.0 86-87 1.6 0.0 0.0 0.0 0.0 88-89 1.925 0.0 0.0 0.0 0.0 90-91 2.25 0.0 0.0 0.0 0.0 92-93 2.5375 0.0 0.0 0.0 0.0 94-95 2.95 0.0 0.0 0.0 0.0 96-97 3.45 0.0 0.0 0.0 0.0 98-99 4.0 0.0 0.0 0.0 0.0 100-101 4.4125 0.0 0.0 0.0 0.0 102-103 4.725 0.0 0.0 0.0 0.0 104-105 5.2625 0.0 0.0 0.0 0.0 106-107 5.7375 0.0125 0.0 0.0 0.0 108-109 6.35 0.025 0.0 0.0 0.0 110-111 7.075 0.025 0.0 0.0 0.0 112-113 7.6875 0.025 0.0 0.0 0.0 114-115 8.2125 0.025 0.0 0.0 0.0 116-117 8.75 0.025 0.0 0.0 0.0 118-119 9.7 0.025 0.0 0.0 0.0 120-121 10.3875 0.025 0.0 0.0 0.0 122-123 11.35 0.025 0.0 0.0 0.0 124-125 12.2375 0.025 0.0 0.0 0.0 126-127 13.0625 0.025 0.0 0.0 0.0 128-129 13.875 0.025 0.0 0.0 0.0 130-131 14.3375 0.025 0.0 0.0 0.0 132-133 14.95 0.025 0.0 0.0 0.0 134-135 15.7625 0.025 0.0 0.0 0.0 136-137 16.5 0.025 0.0 0.0 0.0 138-139 17.65 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGCT 10 0.006830828 145.0 1 AAAAAAA 125 3.2420918E-5 11.6 60-64 >>END_MODULE Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805170 spots for SRR5578440.sra Written 805170 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra Read 805164 spots for SRR5578440.sra Written 805164 spots for SRR5578440.sra SRR ids: ['SRR5578440.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8i35fauh SRR5578440.sra spots: 16103286 blocks: [[1, 805164], [805165, 1610328], [1610329, 2415492], [2415493, 3220656], [3220657, 4025820], [4025821, 4830984], [4830985, 5636148], [5636149, 6441312], [6441313, 7246476], [7246477, 8051640], [8051641, 8856804], [8856805, 9661968], [9661969, 10467132], [10467133, 11272296], [11272297, 12077460], [12077461, 12882624], [12882625, 13687788], [13687789, 14492952], [14492953, 15298116], [15298117, 16103286]] SRR5578440 file size 5435174 SRR5578440 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578440 SRR5578440_1.fastq SRR5578440_2.fastq Input file: SRR5578440_1.fastq Paired file: SRR5578440_2.fastq trimmed: SRR5578440-trimmed-pair1.fastq, SRR5578440-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:39:23 2024 >> started Mon Dec 9 17:39:41 2024 >> done (18.932s) 16103286 read pairs processed; of these: 20606 ( 0.13%) short read pairs filtered out after trimming by size control 68909 ( 0.43%) empty read pairs filtered out after trimming by size control 16013771 (99.44%) read pairs available; of these: 9434224 (58.91%) trimmed read pairs available after processing 6579547 (41.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 17 0.00% 20 13 0.00% 21 14 0.00% 22 21 0.00% 23 17 0.00% 24 22 0.00% 25 20 0.00% 26 30 0.00% 27 23 0.00% 28 21 0.00% 29 29 0.00% 30 28 0.00% 31 29 0.00% 32 32 0.00% 33 29 0.00% 34 35 0.00% 35 49 0.00% 36 41 0.00% 37 84 0.00% 38 57 0.00% 39 58 0.00% 40 73 0.00% 41 94 0.00% 42 86 0.00% 43 134 0.00% 44 126 0.00% 45 148 0.00% 46 201 0.00% 47 218 0.00% 48 242 0.00% 49 255 0.00% 50 336 0.00% 51 392 0.00% 52 443 0.00% 53 528 0.00% 54 549 0.00% 55 565 0.00% 56 677 0.00% 57 781 0.00% 58 957 0.01% 59 1008 0.01% 60 1244 0.01% 61 1396 0.01% 62 1581 0.01% 63 1808 0.01% 64 2069 0.01% 65 2600 0.02% 66 3055 0.02% 67 3656 0.02% 68 4408 0.03% 69 8703 0.05% 70 9421 0.06% 71 6554 0.04% 72 6326 0.04% 73 6762 0.04% 74 7353 0.05% 75 8243 0.05% 76 9094 0.06% 77 10019 0.06% 78 10971 0.07% 79 12298 0.08% 80 13585 0.08% 81 15109 0.09% 82 16821 0.11% 83 18158 0.11% 84 20165 0.13% 85 22255 0.14% 86 23477 0.15% 87 24984 0.16% 88 26471 0.17% 89 27909 0.17% 90 29697 0.19% 91 32004 0.20% 92 33674 0.21% 93 35498 0.22% 94 37157 0.23% 95 38810 0.24% 96 40239 0.25% 97 42030 0.26% 98 43281 0.27% 99 45090 0.28% 100 46429 0.29% 101 48088 0.30% 102 49687 0.31% 103 52403 0.33% 104 53612 0.33% 105 54838 0.34% 106 56824 0.35% 107 58188 0.36% 108 59149 0.37% 109 59929 0.37% 110 61238 0.38% 111 63108 0.39% 112 65569 0.41% 113 66839 0.42% 114 69120 0.43% 115 70765 0.44% 116 71485 0.45% 117 72481 0.45% 118 72298 0.45% 119 73323 0.46% 120 74955 0.47% 121 75640 0.47% 122 76941 0.48% 123 78661 0.49% 124 80903 0.51% 125 82374 0.51% 126 83533 0.52% 127 83927 0.52% 128 84224 0.53% 129 86608 0.54% 130 86910 0.54% 131 87604 0.55% 132 90426 0.56% 133 92516 0.58% 134 94046 0.59% 135 96144 0.60% 136 97722 0.61% 137 99557 0.62% 138 102130 0.64% 139 105891 0.66% 140 110189 0.69% 141 115220 0.72% 142 123807 0.77% 143 132049 0.82% 144 145756 0.91% 145 166354 1.04% 146 197361 1.23% 147 255150 1.59% 148 368884 2.30% 149 722869 4.51% 150 3398011 21.22% 151 6579547 41.09% 16013771 reads passed initial QC criterion=sequence-density sequence-density=1.06 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=11 prefix-density=1.13 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=13.19 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.2 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=12 prefix-density=0.97 prefix-fanout=3.2 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=23.32 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.4 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5578440 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:40:36 Started mapping on | Dec 09 17:40:36 Finished on | Dec 09 17:44:15 Mapping speed, Million of reads per hour | 263.24 Number of input reads | 16013771 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 14778159 Uniquely mapped reads % | 92.28% Average mapped length | 283.67 Number of splices: Total | 13710804 Number of splices: Annotated (sjdb) | 12941921 Number of splices: GT/AG | 13548649 Number of splices: GC/AG | 147960 Number of splices: AT/AC | 5535 Number of splices: Non-canonical | 8660 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 133651 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 17996 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.28% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1112555 1112555 1112555 N_multimapping 133651 133651 133651 N_noFeature 310847 14379609 437870 N_ambiguous 323044 1499 51805 UnstrandedReadsAssigned:14144268 PositiveStrandReadsAssigned:397051 NegativeStrandReadsAssigned:14288484 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=136 echo kmer=131 SRR5578440 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578440-trimmed-pair1.fastq SRR5578440-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,013,771 reads, 14,327,043 reads pseudoaligned [quant] estimated average fragment length: 222.828 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52973 SRR5578440.ke.tsv 35125 SRR5578440.se.tsv 88098 total ==> SRR5578440.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.592 14.52 1.83365 PNS24247 1044 822.172 20.3799 2.23691 PNS24249 1928 1706.17 74.0602 3.91716 PNS24246 1044 822.172 20.3799 2.23691 PNS24248 1044 822.172 20.3799 2.23691 PNS24244 1471 1249.17 30.28 2.18748 PNS24243 293 117.036 0 0 KQK14069 1603 1381.17 1494.76 97.6634 KQK14071 474 266.03 110.341 37.4295 ==> SRR5578440.se.tsv <== BRADI_1g14170v3 2058 BRADI_1g53295v3 5 BRADI_1g59795v3 116 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1442 BRADI_1g74790v3 310 BRADI_1g09890v3 5 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR5578440 completed mapping pipeline successfully