Starting /dee2/code/volunteer_pipeline.sh SRR5578442 current disk space = 1523680051200 free memory = 1580887156 SRR5578442 SRAfilesize 0e165bfd5163c7eeb7ecf2edf547d1c5 SRR5578442.sra SRR5578442.sra file validated SRR5578442 is paired end SRR5578442 is conventional basespace SRR5578442 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578442_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.15225 34.0 34.0 34.0 32.0 34.0 2 33.35275 34.0 34.0 34.0 33.0 34.0 3 33.46925 34.0 34.0 34.0 33.0 34.0 4 33.5345 34.0 34.0 34.0 33.0 34.0 5 33.49925 34.0 34.0 34.0 33.0 34.0 6 37.25825 38.0 38.0 38.0 36.0 38.0 7 37.53575 38.0 38.0 38.0 37.0 38.0 8 37.60425 38.0 38.0 38.0 38.0 38.0 9 37.6625 38.0 38.0 38.0 38.0 38.0 10-14 37.63035 38.0 38.0 38.0 38.0 38.0 15-19 37.62765 38.0 38.0 38.0 38.0 38.0 20-24 37.6167 38.0 38.0 38.0 38.0 38.0 25-29 37.6212 38.0 38.0 38.0 38.0 38.0 30-34 37.59965 38.0 38.0 38.0 38.0 38.0 35-39 37.57085 38.0 38.0 38.0 38.0 38.0 40-44 37.48385 38.0 38.0 38.0 38.0 38.0 45-49 37.43605 38.0 38.0 38.0 37.6 38.0 50-54 37.42025 38.0 38.0 38.0 37.0 38.0 55-59 37.364 38.0 38.0 38.0 37.0 38.0 60-64 37.326350000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.28505 38.0 38.0 38.0 37.0 38.0 70-74 37.245549999999994 38.0 38.0 38.0 36.8 38.0 75-79 37.2195 38.0 38.0 38.0 36.6 38.0 80-84 37.071299999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.98785 38.0 38.0 38.0 36.0 38.0 90-94 37.0064 38.0 38.0 38.0 36.0 38.0 95-99 36.84225 38.0 38.0 38.0 35.0 38.0 100-104 36.74815 38.0 38.0 38.0 34.4 38.0 105-109 36.616150000000005 38.0 38.0 38.0 34.4 38.0 110-114 36.4471 38.0 38.0 38.0 34.0 38.0 115-119 36.27335 38.0 38.0 38.0 34.0 38.0 120-124 36.0513 38.0 37.4 38.0 33.2 38.0 125-129 35.7821 38.0 36.4 38.0 32.2 38.0 130-134 35.6376 38.0 36.0 38.0 31.6 38.0 135-139 35.135450000000006 38.0 35.6 38.0 29.4 38.0 140-144 34.8839 38.0 35.6 38.0 28.8 38.0 145-149 33.90715 38.0 35.0 38.0 23.2 38.0 150-151 29.710375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 2.0 19 1.0 20 2.0 21 9.0 22 8.0 23 4.0 24 8.0 25 9.0 26 11.0 27 16.0 28 21.0 29 26.0 30 37.0 31 38.0 32 52.0 33 73.0 34 100.0 35 223.0 36 638.0 37 2716.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.920701387071446 10.206752159120649 8.767338393090814 38.10520806071709 2 24.45 13.100000000000001 35.3 27.150000000000002 3 22.95 17.599999999999998 25.0 34.449999999999996 4 26.575 25.45 21.2 26.775 5 24.3 29.975 22.95 22.775000000000002 6 22.980745186296573 31.282820705176295 24.23105776444111 21.50537634408602 7 17.549999999999997 21.575 40.625 20.25 8 19.0 24.025 29.25 27.725 9 19.975 21.75 33.025 25.25 10-14 22.8 26.384999999999998 25.540000000000003 25.275 15-19 22.925 25.66 26.1 25.314999999999998 20-24 22.415 25.474999999999998 26.009999999999998 26.1 25-29 22.79 25.5 26.040000000000003 25.669999999999998 30-34 22.63 25.235000000000003 26.405 25.729999999999997 35-39 23.335 24.9 25.505 26.26 40-44 23.105 25.505 25.61 25.779999999999998 45-49 22.71 25.205 25.415 26.669999999999998 50-54 23.275000000000002 25.495 25.324999999999996 25.905 55-59 23.380000000000003 25.385 25.705 25.53 60-64 23.005 25.27 25.869999999999997 25.855 65-69 23.1 25.14 26.08 25.679999999999996 70-74 23.405 24.94 25.7 25.955000000000002 75-79 23.1 24.69 25.919999999999998 26.290000000000003 80-84 24.02 24.75 25.779999999999998 25.45 85-89 23.5 24.62 26.240000000000002 25.64 90-94 23.96 25.47 25.235000000000003 25.335 95-99 23.645 25.319999999999997 25.445 25.590000000000003 100-104 24.15 25.165 25.174999999999997 25.509999999999998 105-109 23.48 25.224999999999998 25.669999999999998 25.624999999999996 110-114 23.735 24.93 25.445 25.89 115-119 23.369999999999997 25.590000000000003 25.074999999999996 25.965 120-124 24.104999999999997 24.815 24.915000000000003 26.165 125-129 23.715 25.430000000000003 25.4 25.455 130-134 24.025 25.180000000000003 25.25 25.545 135-139 24.175 25.915 24.785 25.124999999999996 140-144 24.285 25.28 24.33 26.105 145-149 24.4 25.885 24.295 25.419999999999998 150-151 24.474999999999998 25.275 24.337500000000002 25.912499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 1.0 27 2.5 28 4.5 29 7.5 30 10.5 31 10.5 32 14.5 33 20.0 34 25.0 35 44.5 36 64.0 37 64.5 38 80.0 39 102.0 40 121.5 41 157.5 42 167.5 43 158.5 44 171.0 45 194.0 46 203.0 47 199.5 48 196.5 49 181.5 50 156.0 51 145.0 52 133.5 53 118.0 54 123.5 55 111.5 56 105.0 57 107.5 58 93.0 59 82.0 60 75.5 61 73.0 62 60.5 63 56.0 64 55.5 65 43.0 66 37.0 67 41.5 68 36.5 69 29.5 70 27.0 71 24.0 72 19.5 73 17.5 74 13.0 75 6.0 76 3.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.1125 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.95 0.0 0.0 0.0 0.0 102-103 2.175 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.025 0.0 0.0 106-107 2.85 0.0 0.025 0.0 0.0 108-109 3.25 0.0 0.025 0.0 0.0 110-111 3.6125 0.0 0.025 0.0 0.0 112-113 4.075 0.0 0.025 0.0 0.0 114-115 4.5625 0.0 0.025 0.0 0.0 116-117 5.0625 0.0 0.025 0.0 0.0 118-119 5.475 0.0 0.025 0.0 0.0 120-121 5.925000000000001 0.0 0.025 0.0 0.0 122-123 6.425000000000001 0.0 0.025 0.0 0.0 124-125 6.875 0.0 0.025 0.0 0.0 126-127 7.5625 0.0 0.025 0.0 0.0 128-129 8.3 0.0 0.025 0.0 0.0 130-131 9.162500000000001 0.0 0.025 0.0 0.0 132-133 9.975 0.0 0.025 0.0 0.0 134-135 10.775 0.0 0.025 0.0 0.0 136-137 11.587499999999999 0.0 0.025 0.0 0.0 138-139 12.350000000000001 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGTC 10 0.0068343505 144.975 8 >>END_MODULE SRR5578442 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578442_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96775 33.0 33.0 34.0 32.0 34.0 2 33.014 34.0 33.0 34.0 32.0 34.0 3 33.0725 34.0 33.0 34.0 32.0 34.0 4 32.9935 34.0 33.0 34.0 33.0 34.0 5 33.0535 34.0 33.0 34.0 33.0 34.0 6 37.20475 38.0 38.0 38.0 37.0 38.0 7 37.11375 38.0 38.0 38.0 37.0 38.0 8 37.2245 38.0 38.0 38.0 37.0 38.0 9 37.1585 38.0 38.0 38.0 37.0 38.0 10-14 37.16505 38.0 38.0 38.0 37.0 38.0 15-19 37.1678 38.0 38.0 38.0 37.0 38.0 20-24 37.15500000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.14985 38.0 38.0 38.0 37.0 38.0 30-34 37.13535 38.0 38.0 38.0 37.0 38.0 35-39 37.13415 38.0 38.0 38.0 37.0 38.0 40-44 37.12250000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.160399999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.03175 38.0 38.0 38.0 37.0 38.0 55-59 37.00565 38.0 38.0 38.0 36.8 38.0 60-64 37.0175 38.0 38.0 38.0 36.2 38.0 65-69 36.89905 38.0 38.0 38.0 36.0 38.0 70-74 36.7811 38.0 38.0 38.0 35.8 38.0 75-79 36.675349999999995 38.0 38.0 38.0 35.2 38.0 80-84 36.750099999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.62495 38.0 38.0 38.0 35.0 38.0 90-94 36.5664 38.0 38.0 38.0 35.0 38.0 95-99 36.4433 38.0 38.0 38.0 34.6 38.0 100-104 36.30284999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.104049999999994 38.0 38.0 38.0 33.6 38.0 110-114 35.971199999999996 38.0 38.0 38.0 33.2 38.0 115-119 35.7744 38.0 37.4 38.0 32.6 38.0 120-124 35.589549999999996 38.0 37.0 38.0 32.0 38.0 125-129 35.25975 38.0 36.0 38.0 30.6 38.0 130-134 34.83705 38.0 35.6 38.0 28.4 38.0 135-139 34.389599999999994 38.0 34.4 38.0 27.2 38.0 140-144 33.8698 38.0 33.6 38.0 23.6 38.0 145-149 32.62075 38.0 33.0 38.0 12.0 38.0 150-151 27.6955 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 1.0 6 0.0 7 1.0 8 2.0 9 1.0 10 4.0 11 1.0 12 2.0 13 1.0 14 4.0 15 3.0 16 5.0 17 6.0 18 4.0 19 5.0 20 7.0 21 6.0 22 10.0 23 11.0 24 10.0 25 13.0 26 21.0 27 22.0 28 25.0 29 28.0 30 40.0 31 49.0 32 57.0 33 103.0 34 136.0 35 243.0 36 622.0 37 2544.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.425 18.25 11.275 30.049999999999997 2 29.54716037027771 23.54265699274456 27.77082812109082 19.139354515886914 3 24.043032274205654 24.96872654490868 26.64498373780335 24.34325744308231 4 27.09532149111834 30.572929697272954 20.815611708781585 21.51613710282712 5 26.044533400050035 33.500125093820365 20.140105078809107 20.31523642732049 6 22.486243121560783 34.91745872936468 21.160580290145074 21.435717858929465 7 22.230557639409852 18.404601150287572 35.033758439609905 24.33108277069267 8 23.25 24.275 23.9 28.575 9 24.143107330497873 23.117338003502628 26.194645984488368 26.54490868151113 10-14 26.232297452834906 25.932042235900514 22.479107241154985 25.356553070109594 15-19 25.973570928020823 25.893482831114223 23.961357493242566 24.171588747622387 20-24 25.957255117873768 25.67696080884929 24.075279042995145 24.290505030281796 25-29 25.857321652065078 25.451814768460572 24.8360450563204 23.85481852315394 30-34 25.30796194291437 25.42313470205308 24.351527290936403 24.917376064096146 35-39 26.146605247346283 26.587222110955338 23.3026236731424 23.96354896855598 40-44 25.68054443554844 25.910728582866295 23.668935148118493 24.739791833466775 45-49 25.715572457966374 25.225180144115296 24.469575660528424 24.589671737389914 50-54 25.783204884395953 25.638074266840157 24.767290561505355 23.811430287258535 55-59 26.314999249286824 25.56929082628497 24.573344677443572 23.542365246984637 60-64 25.846015218261915 25.49058870644774 24.46936323588306 24.19403283940729 65-69 26.01381796335236 24.92239911885451 24.927405627315512 24.136377290477622 70-74 25.490686961746444 26.261766473062288 23.86841578209493 24.379130783096333 75-79 25.63999799609238 25.55984169129803 24.592956264716197 24.20720404789339 80-84 26.125945593908124 25.81533991283002 24.66309303141125 23.395621461850606 85-89 25.963367030327294 25.427885096586927 24.712241016915222 23.896506856170554 90-94 26.070856685348275 25.465372297838268 24.799839871897518 23.663931144915935 95-99 26.10001501726986 25.319116984532215 24.558241978275017 24.02262601992291 100-104 25.625750901081297 25.610732879455345 24.814777733279936 23.948738486183423 105-109 26.085215040304412 25.564512091323287 24.878586091223152 23.471686777149152 110-114 26.252254057303148 26.167100781406532 24.65437788018433 22.926267281105993 115-119 26.556162051179328 26.235665281185838 24.117381942010116 23.090790725624718 120-124 27.04651279226956 26.34556651479497 23.671957142141892 22.93596355079357 125-129 27.12161417914184 25.839883843188304 24.202673609372653 22.8358283682972 130-134 27.4251676844529 26.278906797477227 24.31174291720893 21.984182600860947 135-139 27.08666933546838 26.14591673338671 24.234387510008006 22.53302642113691 140-144 27.1703777833375 26.489867400550416 24.093069802351764 22.24668501376032 145-149 27.962369895916733 26.195956765412333 23.894115292233785 21.94755804643715 150-151 28.223083656371138 26.372389646117295 23.533825184444165 21.8707015130674 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 1.0 29 3.0 30 6.5 31 10.0 32 12.0 33 20.0 34 25.0 35 28.5 36 43.0 37 62.0 38 77.5 39 91.5 40 119.5 41 138.0 42 151.0 43 162.5 44 179.5 45 198.5 46 190.0 47 180.0 48 174.0 49 174.0 50 166.0 51 143.5 52 136.5 53 128.0 54 121.5 55 110.0 56 94.0 57 99.5 58 92.0 59 81.0 60 91.0 61 82.5 62 68.5 63 75.5 64 74.5 65 57.0 66 48.0 67 54.5 68 48.0 69 40.5 70 38.0 71 26.5 72 20.5 73 18.5 74 10.5 75 6.0 76 5.5 77 4.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.05 7 0.025 8 0.0 9 0.075 10-14 0.08499999999999999 15-19 0.11 20-24 0.105 25-29 0.125 30-34 0.15 35-39 0.13999999999999999 40-44 0.08 45-49 0.08 50-54 0.09 55-59 0.095 60-64 0.12 65-69 0.13 70-74 0.13999999999999999 75-79 0.19499999999999998 80-84 0.19499999999999998 85-89 0.09 90-94 0.08 95-99 0.11499999999999999 100-104 0.12 105-109 0.135 110-114 0.18 115-119 0.155 120-124 0.135 125-129 0.135 130-134 0.11 135-139 0.08 140-144 0.075 145-149 0.08 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98811029597773 97.82499999999999 2 0.9107007336200355 1.7999999999999998 3 0.05059448520111307 0.15 4 0.025297242600556536 0.1 5 0.025297242600556536 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.6375000000000002 0.0 0.0 0.0 0.0 100-101 1.9375 0.0 0.0 0.0 0.0 102-103 2.175 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.825 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.6624999999999996 0.0 0.0 0.0 0.0 112-113 4.1375 0.0 0.0 0.0 0.0 114-115 4.637499999999999 0.0 0.0 0.0 0.0 116-117 5.1375 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 5.9625 0.0 0.0 0.0 0.0 122-123 6.425000000000001 0.0 0.0 0.0 0.0 124-125 6.8875 0.0 0.0 0.0 0.0 126-127 7.5875 0.0 0.0 0.0 0.0 128-129 8.287500000000001 0.0 0.0 0.0 0.0 130-131 9.125 0.0 0.0 0.0 0.0 132-133 9.925 0.0 0.0 0.0 0.0 134-135 10.725 0.0 0.0 0.0 0.0 136-137 11.5 0.0 0.0 0.0 0.0 138-139 12.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCCCC 10 0.006830828 145.0 145 >>END_MODULE Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136865 spots for SRR5578442.sra Written 1136865 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra Read 1136859 spots for SRR5578442.sra Written 1136859 spots for SRR5578442.sra SRR ids: ['SRR5578442.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v5ru4v2k SRR5578442.sra spots: 22737186 blocks: [[1, 1136859], [1136860, 2273718], [2273719, 3410577], [3410578, 4547436], [4547437, 5684295], [5684296, 6821154], [6821155, 7958013], [7958014, 9094872], [9094873, 10231731], [10231732, 11368590], [11368591, 12505449], [12505450, 13642308], [13642309, 14779167], [14779168, 15916026], [15916027, 17052885], [17052886, 18189744], [18189745, 19326603], [19326604, 20463462], [20463463, 21600321], [21600322, 22737186]] SRR5578442 file size 7683185 SRR5578442 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578442 SRR5578442_1.fastq SRR5578442_2.fastq Input file: SRR5578442_1.fastq Paired file: SRR5578442_2.fastq trimmed: SRR5578442-trimmed-pair1.fastq, SRR5578442-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:42:30 2024 >> started Mon Dec 9 17:42:56 2024 >> done (25.908s) 22737186 read pairs processed; of these: 28686 ( 0.13%) short read pairs filtered out after trimming by size control 26423 ( 0.12%) empty read pairs filtered out after trimming by size control 22682077 (99.76%) read pairs available; of these: 11612447 (51.20%) trimmed read pairs available after processing 11069630 (48.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 9 0.00% 20 12 0.00% 21 13 0.00% 22 21 0.00% 23 20 0.00% 24 20 0.00% 25 18 0.00% 26 26 0.00% 27 34 0.00% 28 31 0.00% 29 24 0.00% 30 32 0.00% 31 33 0.00% 32 29 0.00% 33 41 0.00% 34 34 0.00% 35 43 0.00% 36 47 0.00% 37 35 0.00% 38 33 0.00% 39 52 0.00% 40 69 0.00% 41 72 0.00% 42 76 0.00% 43 99 0.00% 44 83 0.00% 45 102 0.00% 46 106 0.00% 47 134 0.00% 48 160 0.00% 49 187 0.00% 50 195 0.00% 51 243 0.00% 52 268 0.00% 53 263 0.00% 54 299 0.00% 55 355 0.00% 56 392 0.00% 57 501 0.00% 58 528 0.00% 59 558 0.00% 60 621 0.00% 61 732 0.00% 62 858 0.00% 63 1004 0.00% 64 1122 0.00% 65 1283 0.01% 66 1438 0.01% 67 1710 0.01% 68 1883 0.01% 69 2687 0.01% 70 3039 0.01% 71 2753 0.01% 72 3130 0.01% 73 3623 0.02% 74 4071 0.02% 75 4595 0.02% 76 5105 0.02% 77 5690 0.03% 78 6109 0.03% 79 7030 0.03% 80 7717 0.03% 81 8778 0.04% 82 9961 0.04% 83 11323 0.05% 84 13087 0.06% 85 14685 0.06% 86 15457 0.07% 87 16578 0.07% 88 17706 0.08% 89 18492 0.08% 90 20427 0.09% 91 22102 0.10% 92 23865 0.11% 93 25349 0.11% 94 27860 0.12% 95 29135 0.13% 96 30744 0.14% 97 31996 0.14% 98 33374 0.15% 99 35305 0.16% 100 36898 0.16% 101 39231 0.17% 102 41240 0.18% 103 43555 0.19% 104 45691 0.20% 105 47531 0.21% 106 50078 0.22% 107 50655 0.22% 108 52137 0.23% 109 53801 0.24% 110 55449 0.24% 111 57492 0.25% 112 60305 0.27% 113 62703 0.28% 114 66348 0.29% 115 68509 0.30% 116 69803 0.31% 117 71361 0.31% 118 72841 0.32% 119 73921 0.33% 120 76474 0.34% 121 78054 0.34% 122 80885 0.36% 123 84243 0.37% 124 86591 0.38% 125 89842 0.40% 126 92663 0.41% 127 93618 0.41% 128 95062 0.42% 129 96753 0.43% 130 99520 0.44% 131 100593 0.44% 132 104273 0.46% 133 108229 0.48% 134 110967 0.49% 135 116047 0.51% 136 119682 0.53% 137 122346 0.54% 138 127275 0.56% 139 134189 0.59% 140 138829 0.61% 141 146981 0.65% 142 159278 0.70% 143 171971 0.76% 144 191617 0.84% 145 219509 0.97% 146 262142 1.16% 147 337646 1.49% 148 485040 2.14% 149 944178 4.16% 150 4940668 21.78% 151 11069630 48.80% 22682077 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=27 prefix-density=0.64 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=27.12 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.5 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.55 fanout-score-rank=23 prefix-density=0.70 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=47.07 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.2 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578442 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:43:46 Started mapping on | Dec 09 17:43:46 Finished on | Dec 09 17:49:27 Mapping speed, Million of reads per hour | 239.46 Number of input reads | 22682077 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20987113 Uniquely mapped reads % | 92.53% Average mapped length | 289.92 Number of splices: Total | 23433269 Number of splices: Annotated (sjdb) | 22030788 Number of splices: GT/AG | 23122843 Number of splices: GC/AG | 283948 Number of splices: AT/AC | 11920 Number of splices: Non-canonical | 14558 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373496 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 52150 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.30% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1334628 1334628 1334628 N_multimapping 373496 373496 373496 N_noFeature 896507 20401357 1083568 N_ambiguous 478096 3086 80028 UnstrandedReadsAssigned:19612510 PositiveStrandReadsAssigned:582670 NegativeStrandReadsAssigned:19823517 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5578442 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578442-trimmed-pair1.fastq SRR5578442-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,682,077 reads, 20,012,014 reads pseudoaligned [quant] estimated average fragment length: 243.046 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR5578442.ke.tsv 35125 SRR5578442.se.tsv 88098 total ==> SRR5578442.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.54 0 0 PNS24247 1044 801.954 61.1785 5.51586 PNS24249 1928 1685.95 74.7876 3.20736 PNS24246 1044 801.954 61.1785 5.51586 PNS24248 1044 801.954 61.1785 5.51586 PNS24244 1471 1228.95 118.677 6.98224 PNS24243 293 106.707 0 0 KQK14069 1603 1360.95 4213.08 223.831 KQK14071 474 251.261 134.038 38.5716 ==> SRR5578442.se.tsv <== BRADI_1g14170v3 4884 BRADI_1g53295v3 108 BRADI_1g59795v3 477 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 2694 BRADI_1g74790v3 207 BRADI_1g09890v3 1 BRADI_1g77505v3 341 BRADI_1g48960v3 0 SRR5578442 completed mapping pipeline successfully