Starting /dee2/code/volunteer_pipeline.sh SRR5578443 current disk space = 1523679895552 free memory = 1579211532 SRR5578443 SRAfilesize 1998a0fb9006529129b9e4474b749750 SRR5578443.sra SRR5578443.sra file validated SRR5578443 is paired end SRR5578443 is conventional basespace SRR5578443 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578443_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3125 34.0 34.0 34.0 33.0 34.0 2 33.37575 34.0 34.0 34.0 33.0 34.0 3 33.49525 34.0 34.0 34.0 33.0 34.0 4 33.63175 34.0 34.0 34.0 33.0 34.0 5 33.65625 34.0 34.0 34.0 33.0 34.0 6 37.3165 38.0 38.0 38.0 36.0 38.0 7 37.63025 38.0 38.0 38.0 37.0 38.0 8 37.71 38.0 38.0 38.0 38.0 38.0 9 37.67575 38.0 38.0 38.0 38.0 38.0 10-14 37.69605 38.0 38.0 38.0 38.0 38.0 15-19 37.6967 38.0 38.0 38.0 38.0 38.0 20-24 37.65675 38.0 38.0 38.0 38.0 38.0 25-29 37.64745 38.0 38.0 38.0 38.0 38.0 30-34 37.66985 38.0 38.0 38.0 38.0 38.0 35-39 37.61815 38.0 38.0 38.0 38.0 38.0 40-44 37.5242 38.0 38.0 38.0 38.0 38.0 45-49 37.4945 38.0 38.0 38.0 37.8 38.0 50-54 37.46225 38.0 38.0 38.0 37.0 38.0 55-59 37.421850000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.34385 38.0 38.0 38.0 37.0 38.0 65-69 37.3027 38.0 38.0 38.0 37.0 38.0 70-74 37.269 38.0 38.0 38.0 36.6 38.0 75-79 37.23004999999999 38.0 38.0 38.0 36.6 38.0 80-84 37.189099999999996 38.0 38.0 38.0 36.0 38.0 85-89 37.01875 38.0 38.0 38.0 35.8 38.0 90-94 37.0222 38.0 38.0 38.0 35.6 38.0 95-99 36.864 38.0 38.0 38.0 35.0 38.0 100-104 36.716899999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.6164 38.0 38.0 38.0 34.0 38.0 110-114 36.41265 38.0 38.0 38.0 34.0 38.0 115-119 36.25535 38.0 38.0 38.0 33.6 38.0 120-124 36.0595 38.0 37.4 38.0 33.0 38.0 125-129 35.84795 38.0 36.6 38.0 32.2 38.0 130-134 35.53295 38.0 36.0 38.0 31.2 38.0 135-139 35.165400000000005 38.0 35.6 38.0 29.6 38.0 140-144 34.759100000000004 38.0 35.0 38.0 28.0 38.0 145-149 34.11155 38.0 35.0 38.0 24.6 38.0 150-151 30.237 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 3.0 17 0.0 18 2.0 19 2.0 20 4.0 21 1.0 22 2.0 23 6.0 24 6.0 25 9.0 26 22.0 27 19.0 28 13.0 29 22.0 30 23.0 31 35.0 32 43.0 33 77.0 34 115.0 35 217.0 36 672.0 37 2704.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.84133611691023 10.673277661795407 9.629436325678496 35.855949895615865 2 25.525 14.45 31.775 28.249999999999996 3 22.55563890972743 19.579894973743436 24.88122030507627 32.98324581145287 4 27.85 25.775 20.724999999999998 25.650000000000002 5 25.7 30.8 22.175 21.325 6 22.025 33.675 22.575 21.725 7 17.075000000000003 23.599999999999998 39.975 19.35 8 20.724999999999998 22.625 29.549999999999997 27.1 9 19.275000000000002 20.9 33.75 26.075 10-14 22.835 27.16 25.235000000000003 24.77 15-19 23.585 25.779999999999998 25.745 24.89 20-24 23.294999999999998 26.06 25.745 24.9 25-29 23.78 25.56 25.555 25.105 30-34 22.81 26.145000000000003 25.715 25.330000000000002 35-39 23.380000000000003 26.215 25.165 25.240000000000002 40-44 23.52 25.124999999999996 25.77 25.585 45-49 23.315 25.759999999999998 25.445 25.480000000000004 50-54 23.1 26.145000000000003 25.074999999999996 25.679999999999996 55-59 23.655 25.72 25.119999999999997 25.505 60-64 23.549999999999997 25.590000000000003 25.165 25.695 65-69 23.31 25.935000000000002 25.695 25.06 70-74 24.279999999999998 25.46 24.89 25.369999999999997 75-79 23.635 25.8 25.115 25.45 80-84 23.674999999999997 25.005 25.77 25.55 85-89 23.655 25.115 25.545 25.685000000000002 90-94 23.794999999999998 25.005 25.2 26.0 95-99 23.849999999999998 25.245 25.2 25.705 100-104 23.86 25.124999999999996 25.245 25.77 105-109 23.494999999999997 25.525 25.14 25.840000000000003 110-114 23.61 25.230000000000004 25.945 25.215 115-119 23.805 25.230000000000004 25.424999999999997 25.540000000000003 120-124 24.26 25.715 24.345 25.679999999999996 125-129 24.16 25.36 25.035 25.445 130-134 24.12 26.090000000000003 24.3 25.490000000000002 135-139 23.275000000000002 25.779999999999998 24.575 26.369999999999997 140-144 23.974999999999998 25.55 24.47 26.005 145-149 24.015 25.935000000000002 24.224999999999998 25.825 150-151 24.462500000000002 25.2375 24.625 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 4.0 28 3.5 29 5.5 30 7.5 31 15.0 32 22.0 33 21.0 34 30.0 35 49.5 36 62.0 37 78.5 38 91.0 39 101.5 40 122.5 41 145.5 42 161.0 43 172.0 44 197.5 45 207.5 46 201.0 47 198.5 48 190.0 49 178.5 50 157.0 51 137.0 52 124.0 53 112.5 54 102.5 55 94.5 56 83.5 57 78.5 58 83.0 59 75.5 60 71.0 61 63.5 62 56.0 63 62.5 64 64.5 65 61.5 66 51.5 67 40.0 68 38.0 69 38.0 70 32.5 71 25.0 72 19.5 73 14.5 74 13.0 75 10.5 76 8.0 77 4.0 78 1.0 79 1.5 80 1.0 81 1.0 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03967652261815 97.975 2 0.8845084660096033 1.7500000000000002 3 0.025271670457417232 0.075 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.7000000000000002 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.7625 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.5625 0.0 0.0 0.0 0.0 114-115 3.9375 0.0 0.0 0.0 0.0 116-117 4.6 0.0 0.0 0.0 0.0 118-119 5.0 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 6.012499999999999 0.0 0.0 0.0 0.0 124-125 6.525 0.0 0.0 0.0 0.0 126-127 7.2375 0.0 0.0 0.0 0.0 128-129 7.775 0.0 0.0 0.0 0.0 130-131 8.425 0.0 0.0 0.0 0.0 132-133 9.25 0.0 0.0 0.0 0.0 134-135 10.0375 0.0 0.0 0.0 0.0 136-137 10.9125 0.0 0.0 0.0 0.0 138-139 11.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATT 10 0.0068378756 144.95 9 AGATCGG 75 0.001240949 13.5286665 140-144 >>END_MODULE SRR5578443 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578443_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89875 33.0 33.0 34.0 32.0 34.0 2 33.052 34.0 33.0 34.0 32.0 34.0 3 33.0945 34.0 33.0 34.0 33.0 34.0 4 32.89975 34.0 33.0 34.0 33.0 34.0 5 32.98625 34.0 33.0 34.0 33.0 34.0 6 37.20675 38.0 38.0 38.0 37.0 38.0 7 37.2075 38.0 38.0 38.0 37.0 38.0 8 37.13075 38.0 38.0 38.0 37.0 38.0 9 37.12225 38.0 38.0 38.0 37.0 38.0 10-14 37.164300000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.12655 38.0 38.0 38.0 37.0 38.0 20-24 37.10655 38.0 38.0 38.0 37.0 38.0 25-29 37.07695 38.0 38.0 38.0 37.0 38.0 30-34 37.084 38.0 38.0 38.0 37.0 38.0 35-39 37.0636 38.0 38.0 38.0 37.0 38.0 40-44 37.080600000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.088 38.0 38.0 38.0 37.0 38.0 50-54 37.011100000000006 38.0 38.0 38.0 36.8 38.0 55-59 36.9778 38.0 38.0 38.0 36.6 38.0 60-64 36.913850000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.789750000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.713 38.0 38.0 38.0 35.6 38.0 75-79 36.66655 38.0 38.0 38.0 35.4 38.0 80-84 36.5681 38.0 38.0 38.0 35.0 38.0 85-89 36.47925 38.0 38.0 38.0 34.8 38.0 90-94 36.4029 38.0 38.0 38.0 34.4 38.0 95-99 36.1904 38.0 38.0 38.0 34.0 38.0 100-104 36.005649999999996 38.0 38.0 38.0 33.6 38.0 105-109 35.876349999999995 38.0 38.0 38.0 33.2 38.0 110-114 35.70819999999999 38.0 38.0 38.0 32.6 38.0 115-119 35.42265 38.0 37.2 38.0 31.8 38.0 120-124 35.234899999999996 38.0 36.2 38.0 30.6 38.0 125-129 34.89275 38.0 36.0 38.0 28.2 38.0 130-134 34.293850000000006 38.0 34.8 38.0 25.8 38.0 135-139 33.90915 38.0 33.6 38.0 23.8 38.0 140-144 33.08624999999999 38.0 33.0 38.0 16.6 38.0 145-149 31.984599999999993 38.0 33.0 38.0 8.2 38.0 150-151 26.720750000000002 34.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 2.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 5.0 12 3.0 13 3.0 14 6.0 15 7.0 16 5.0 17 7.0 18 11.0 19 4.0 20 9.0 21 10.0 22 6.0 23 15.0 24 13.0 25 19.0 26 18.0 27 26.0 28 26.0 29 37.0 30 40.0 31 46.0 32 68.0 33 73.0 34 152.0 35 269.0 36 696.0 37 2405.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.275 17.65 12.1 28.975 2 29.95 23.275000000000002 26.025 20.75 3 21.9 25.2 28.175 24.725 4 26.900000000000002 30.7 20.599999999999998 21.8 5 27.474999999999998 32.925 19.525000000000002 20.075000000000003 6 22.425 36.025 19.375 22.175 7 22.925 18.95 35.3 22.825 8 22.55 24.275 24.075 29.099999999999998 9 23.225 22.925 26.450000000000003 27.400000000000002 10-14 26.035000000000004 26.045 23.445 24.474999999999998 15-19 25.676283814190707 25.691284564228212 23.881194059702985 24.751237561878096 20-24 25.515 25.124999999999996 24.635 24.725 25-29 25.85887883182477 25.2437865679852 24.323648547282094 24.573686052907938 30-34 25.796608473813215 25.016257315792107 24.51102996348357 24.67610424691111 35-39 25.772731819545864 25.277583274982497 24.127238171451435 24.822446734020208 40-44 25.50882632394859 25.278791818772817 24.413662049307398 24.798719807971196 45-49 25.998899834975248 24.898734810221534 24.798719807971196 24.303645546832026 50-54 26.288943341501223 25.01875281292194 24.64369655448317 24.048607291093663 55-59 26.080432172869152 25.505202080832333 24.18467386954782 24.2296918767507 60-64 25.885354141656663 25.01500600240096 24.56982793117247 24.52981192476991 65-69 26.239679759819868 24.373279959969977 24.768576432324245 24.618463847885916 70-74 25.54288001601121 25.14259981987391 25.01751225858101 24.297007905533874 75-79 25.986694012305538 24.8361762793257 24.656095242859287 24.521034465509477 80-84 25.90813569498649 25.162613829680776 24.68227759431602 24.246972881016713 85-89 25.637563756375638 25.28252825282528 24.78747874787479 24.292429242924293 90-94 25.58255825582558 25.22252225222522 24.837483748374837 24.357435743574356 95-99 25.292529252925295 25.302530253025303 25.012501250125013 24.392439243924393 100-104 26.444255489421298 25.518931626069126 24.298504476566798 23.738308407942778 105-109 26.163081540770385 25.307653826913455 24.662331165582792 23.866933466733368 110-114 26.162237902216884 25.581744482810386 24.235600260221187 24.02041735475154 115-119 26.590260747710325 26.19988989540063 24.21300235223462 22.996847004654423 120-124 26.787769604163543 25.296502026722717 24.680978832007206 23.23474953710654 125-129 26.9792813532179 25.89330397357622 24.301871684516062 22.825542988689822 130-134 26.851481184947957 26.175940752602084 24.0242193755004 22.94835868694956 135-139 26.64932726454259 26.134146951433003 24.778672535387386 22.437853248637023 140-144 26.934427049467313 26.97444105436903 24.168458960636222 21.922672935527434 145-149 27.881970492623154 26.191547886971744 24.23605901475369 21.690422605651413 150-151 27.425 26.875 23.775 21.925 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 3.5 28 6.0 29 6.0 30 7.5 31 11.5 32 16.0 33 20.0 34 27.5 35 30.0 36 42.0 37 56.5 38 67.0 39 94.0 40 127.5 41 147.5 42 146.0 43 153.5 44 184.0 45 188.5 46 167.0 47 176.0 48 198.0 49 179.5 50 157.0 51 150.0 52 128.5 53 111.5 54 109.5 55 101.5 56 90.5 57 86.5 58 90.0 59 87.5 60 83.0 61 79.5 62 76.0 63 71.5 64 69.0 65 66.0 66 57.5 67 53.5 68 53.5 69 50.0 70 41.0 71 34.5 72 22.5 73 19.0 74 15.5 75 11.5 76 10.0 77 5.5 78 2.5 79 2.0 80 2.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.015 30-34 0.045 35-39 0.03 40-44 0.015 45-49 0.015 50-54 0.015 55-59 0.04 60-64 0.04 65-69 0.075 70-74 0.06999999999999999 75-79 0.045 80-84 0.06999999999999999 85-89 0.01 90-94 0.01 95-99 0.01 100-104 0.034999999999999996 105-109 0.05 110-114 0.08499999999999999 115-119 0.095 120-124 0.08499999999999999 125-129 0.09 130-134 0.08 135-139 0.034999999999999996 140-144 0.034999999999999996 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80619761239522 97.25 2 0.9652019304038608 1.9 3 0.17780035560071122 0.525 4 0.0 0.0 5 0.0 0.0 6 0.025400050800101596 0.15 7 0.025400050800101596 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAG 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8999999999999999 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.7000000000000002 0.0 0.0 0.0 0.0 102-103 1.8625 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.2874999999999996 0.0 0.0 0.0 0.0 108-109 2.6875 0.0 0.0 0.0 0.0 110-111 3.1875 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.875 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.4375 0.0 0.0 0.0 0.0 122-123 5.8875 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 7.0375 0.0 0.0 0.0 0.0 128-129 7.6 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.8375 0.0 0.0 0.0 0.0 136-137 10.7125 0.0 0.0 0.0 0.0 138-139 11.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACTGAG 10 0.0069519696 144.15001 145 >>END_MODULE Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra Read 910255 spots for SRR5578443.sra Written 910255 spots for SRR5578443.sra SRR ids: ['SRR5578443.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9zwxxfdf SRR5578443.sra spots: 18205100 blocks: [[1, 910255], [910256, 1820510], [1820511, 2730765], [2730766, 3641020], [3641021, 4551275], [4551276, 5461530], [5461531, 6371785], [6371786, 7282040], [7282041, 8192295], [8192296, 9102550], [9102551, 10012805], [10012806, 10923060], [10923061, 11833315], [11833316, 12743570], [12743571, 13653825], [13653826, 14564080], [14564081, 15474335], [15474336, 16384590], [16384591, 17294845], [17294846, 18205100]] SRR5578443 file size 6147410 SRR5578443 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578443 SRR5578443_1.fastq SRR5578443_2.fastq Input file: SRR5578443_1.fastq Paired file: SRR5578443_2.fastq trimmed: SRR5578443-trimmed-pair1.fastq, SRR5578443-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:42:01 2024 >> started Mon Dec 9 17:42:22 2024 >> done (21.103s) 18205100 read pairs processed; of these: 24659 ( 0.14%) short read pairs filtered out after trimming by size control 37602 ( 0.21%) empty read pairs filtered out after trimming by size control 18142839 (99.66%) read pairs available; of these: 9433507 (52.00%) trimmed read pairs available after processing 8709332 (48.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 9 0.00% 21 13 0.00% 22 12 0.00% 23 8 0.00% 24 15 0.00% 25 11 0.00% 26 15 0.00% 27 7 0.00% 28 18 0.00% 29 11 0.00% 30 28 0.00% 31 23 0.00% 32 20 0.00% 33 15 0.00% 34 23 0.00% 35 21 0.00% 36 29 0.00% 37 35 0.00% 38 38 0.00% 39 52 0.00% 40 52 0.00% 41 62 0.00% 42 44 0.00% 43 53 0.00% 44 81 0.00% 45 64 0.00% 46 63 0.00% 47 98 0.00% 48 122 0.00% 49 140 0.00% 50 177 0.00% 51 177 0.00% 52 212 0.00% 53 212 0.00% 54 225 0.00% 55 269 0.00% 56 285 0.00% 57 330 0.00% 58 379 0.00% 59 455 0.00% 60 481 0.00% 61 612 0.00% 62 688 0.00% 63 798 0.00% 64 952 0.01% 65 1010 0.01% 66 1120 0.01% 67 1387 0.01% 68 1562 0.01% 69 1941 0.01% 70 2275 0.01% 71 2363 0.01% 72 2605 0.01% 73 2923 0.02% 74 3203 0.02% 75 3560 0.02% 76 3966 0.02% 77 4348 0.02% 78 4931 0.03% 79 5562 0.03% 80 6273 0.03% 81 7034 0.04% 82 7850 0.04% 83 8893 0.05% 84 11063 0.06% 85 11948 0.07% 86 12559 0.07% 87 13487 0.07% 88 14793 0.08% 89 15096 0.08% 90 15842 0.09% 91 17007 0.09% 92 18348 0.10% 93 19184 0.11% 94 21172 0.12% 95 22405 0.12% 96 23288 0.13% 97 24054 0.13% 98 25349 0.14% 99 26761 0.15% 100 28235 0.16% 101 29046 0.16% 102 31101 0.17% 103 32755 0.18% 104 33792 0.19% 105 35431 0.20% 106 36719 0.20% 107 37852 0.21% 108 39195 0.22% 109 39880 0.22% 110 41318 0.23% 111 43207 0.24% 112 45541 0.25% 113 46900 0.26% 114 49441 0.27% 115 51132 0.28% 116 52398 0.29% 117 53389 0.29% 118 55263 0.30% 119 56206 0.31% 120 57706 0.32% 121 59466 0.33% 122 60645 0.33% 123 63793 0.35% 124 66155 0.36% 125 68091 0.38% 126 70106 0.39% 127 71411 0.39% 128 72163 0.40% 129 74240 0.41% 130 76169 0.42% 131 77131 0.43% 132 79632 0.44% 133 82025 0.45% 134 84859 0.47% 135 87990 0.48% 136 90530 0.50% 137 93525 0.52% 138 98081 0.54% 139 103095 0.57% 140 107480 0.59% 141 115279 0.64% 142 123992 0.68% 143 133357 0.74% 144 150069 0.83% 145 175235 0.97% 146 211649 1.17% 147 276963 1.53% 148 409403 2.26% 149 811496 4.47% 150 4170357 22.99% 151 8709332 48.00% 18142839 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=30 prefix-density=0.79 prefix-fanout=2.6 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=51.28 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=6.2 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=32 prefix-density=0.47 prefix-fanout=2.5 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=75.89 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR5578443 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:43:11 Started mapping on | Dec 09 17:43:11 Finished on | Dec 09 17:46:03 Mapping speed, Million of reads per hour | 379.73 Number of input reads | 18142839 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16962066 Uniquely mapped reads % | 93.49% Average mapped length | 290.28 Number of splices: Total | 17503848 Number of splices: Annotated (sjdb) | 16445400 Number of splices: GT/AG | 17283873 Number of splices: GC/AG | 200335 Number of splices: AT/AC | 7307 Number of splices: Non-canonical | 12333 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209466 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 20873 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.60% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 985928 985928 985928 N_multimapping 209466 209466 209466 N_noFeature 673594 16411388 840706 N_ambiguous 453367 2426 70010 UnstrandedReadsAssigned:15835105 PositiveStrandReadsAssigned:548252 NegativeStrandReadsAssigned:16051350 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5578443 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578443-trimmed-pair1.fastq SRR5578443-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,142,839 reads, 16,117,495 reads pseudoaligned [quant] estimated average fragment length: 241.726 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR5578443.ke.tsv 35125 SRR5578443.se.tsv 88098 total ==> SRR5578443.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 695.806 0 0 PNS24247 1044 803.274 53.4435 5.60469 PNS24249 1928 1687.27 61.0794 3.0495 PNS24246 1044 803.274 53.4435 5.60469 PNS24248 1044 803.274 53.4435 5.60469 PNS24244 1471 1230.27 130.59 8.94187 PNS24243 293 104.722 0 0 KQK14069 1603 1362.27 12455.7 770.234 KQK14071 474 250.368 339.777 114.323 ==> SRR5578443.se.tsv <== BRADI_1g14170v3 14396 BRADI_1g53295v3 134 BRADI_1g59795v3 870 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 268 BRADI_1g74790v3 85 BRADI_1g09890v3 0 BRADI_1g77505v3 405 BRADI_1g48960v3 0 SRR5578443 completed mapping pipeline successfully