Starting /dee2/code/volunteer_pipeline.sh SRR5578444 current disk space = 1523679895552 free memory = 1579208924 SRR5578444 SRAfilesize 237d54043b48f24298f02d7af5c15cbb SRR5578444.sra SRR5578444.sra file validated SRR5578444 is paired end SRR5578444 is conventional basespace SRR5578444 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578444_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.797 34.0 33.0 34.0 32.0 34.0 2 33.12725 34.0 33.0 34.0 32.0 34.0 3 33.309 34.0 33.0 34.0 32.0 34.0 4 33.419 34.0 33.0 34.0 33.0 34.0 5 33.44525 34.0 33.0 34.0 33.0 34.0 6 36.9895 38.0 37.0 38.0 36.0 38.0 7 37.308 38.0 38.0 38.0 37.0 38.0 8 37.52 38.0 38.0 38.0 37.0 38.0 9 37.526 38.0 38.0 38.0 37.0 38.0 10-14 37.50165 38.0 38.0 38.0 37.6 38.0 15-19 37.49974999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.4604 38.0 38.0 38.0 37.2 38.0 25-29 37.44505 38.0 38.0 38.0 37.4 38.0 30-34 37.3811 38.0 38.0 38.0 37.0 38.0 35-39 37.3211 38.0 38.0 38.0 37.2 38.0 40-44 37.15385 38.0 38.0 38.0 36.6 38.0 45-49 37.07189999999999 38.0 38.0 38.0 36.0 38.0 50-54 37.05695 38.0 38.0 38.0 36.0 38.0 55-59 37.0219 38.0 38.0 38.0 36.0 38.0 60-64 36.983000000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.892100000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.73605 38.0 38.0 38.0 34.8 38.0 75-79 36.56375 38.0 38.0 38.0 34.2 38.0 80-84 36.45565 38.0 38.0 38.0 34.0 38.0 85-89 36.3648 38.0 38.0 38.0 34.0 38.0 90-94 36.291199999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.060199999999995 38.0 38.0 38.0 33.0 38.0 100-104 35.97865 38.0 37.4 38.0 33.0 38.0 105-109 35.75875 38.0 37.2 38.0 31.8 38.0 110-114 35.53255 38.0 36.4 38.0 31.2 38.0 115-119 35.3702 38.0 36.0 38.0 31.0 38.0 120-124 35.02159999999999 38.0 35.6 38.0 28.8 38.0 125-129 34.83200000000001 38.0 35.0 38.0 28.2 38.0 130-134 34.662600000000005 38.0 35.0 38.0 27.8 38.0 135-139 34.141 38.0 35.0 38.0 24.2 38.0 140-144 33.673500000000004 38.0 34.0 38.0 21.8 38.0 145-149 32.77025 38.0 33.8 38.0 15.0 38.0 150-151 28.384625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 2.0 14 4.0 15 4.0 16 4.0 17 9.0 18 12.0 19 6.0 20 6.0 21 5.0 22 9.0 23 9.0 24 13.0 25 12.0 26 20.0 27 32.0 28 27.0 29 36.0 30 40.0 31 68.0 32 72.0 33 99.0 34 150.0 35 291.0 36 821.0 37 2244.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.587042401896234 12.694232288648932 9.770871740848037 33.947853568606796 2 26.025 15.1 31.6 27.275 3 23.175 19.6 24.425 32.800000000000004 4 25.75 28.525 20.9 24.825 5 25.650000000000002 30.15 23.7 20.5 6 23.599999999999998 32.550000000000004 23.275000000000002 20.575 7 16.275000000000002 27.250000000000004 38.3 18.175 8 19.950000000000003 24.675 28.425 26.950000000000003 9 21.125 23.3 31.825 23.75 10-14 22.125 28.28 25.27 24.325 15-19 22.665 26.150000000000002 25.645 25.540000000000003 20-24 22.765 26.474999999999998 25.069999999999997 25.69 25-29 22.82 26.340000000000003 25.430000000000003 25.41 30-34 22.17 26.334999999999997 25.729999999999997 25.765 35-39 22.99 25.855 25.3 25.855 40-44 22.965 26.035000000000004 25.180000000000003 25.82 45-49 23.02 26.619999999999997 25.355 25.005 50-54 23.235 26.21 25.180000000000003 25.374999999999996 55-59 23.195 25.755 25.15 25.900000000000002 60-64 23.51 25.96 25.005 25.525 65-69 22.695 26.400000000000002 25.105 25.8 70-74 23.16 25.995 24.85 25.995 75-79 23.205000000000002 25.979999999999997 24.740000000000002 26.075 80-84 23.805 25.424999999999997 24.77 26.0 85-89 23.77 25.3 25.105 25.825 90-94 23.785 25.405 24.425 26.384999999999998 95-99 23.7 25.540000000000003 24.834999999999997 25.924999999999997 100-104 24.169999999999998 25.424999999999997 24.834999999999997 25.569999999999997 105-109 23.549999999999997 26.090000000000003 24.610000000000003 25.75 110-114 23.465 25.835 24.255 26.445 115-119 24.310000000000002 25.729999999999997 24.099999999999998 25.86 120-124 24.21 25.624999999999996 23.73 26.435 125-129 24.145 26.085 23.865 25.905 130-134 24.535 25.835 23.830000000000002 25.8 135-139 24.005000000000003 25.979999999999997 23.79 26.224999999999998 140-144 23.669999999999998 25.979999999999997 23.73 26.619999999999997 145-149 24.325 25.635 23.369999999999997 26.669999999999998 150-151 24.25 25.2875 23.4125 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 3.0 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 3.5 28 4.0 29 4.5 30 10.0 31 16.0 32 19.5 33 32.0 34 35.5 35 39.0 36 58.5 37 73.0 38 93.5 39 119.5 40 131.5 41 146.0 42 165.5 43 172.5 44 182.5 45 197.0 46 200.5 47 192.0 48 168.5 49 158.5 50 154.5 51 141.0 52 144.5 53 133.0 54 111.0 55 106.5 56 104.5 57 91.0 58 75.5 59 69.0 60 68.5 61 67.5 62 58.0 63 50.5 64 47.5 65 45.0 66 42.5 67 38.0 68 39.5 69 39.5 70 33.5 71 25.0 72 23.5 73 20.0 74 11.0 75 6.5 76 4.0 77 5.0 78 3.5 79 1.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0851334180432 97.475 2 0.7115628970775095 1.4000000000000001 3 0.10165184243964422 0.3 4 0.07623888182973317 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025412960609911054 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACCGGATCTCGTATGC 21 0.525 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 0.9624999999999999 0.0 0.0 0.0 0.0 94-95 1.2374999999999998 0.0 0.0 0.0 0.0 96-97 1.5499999999999998 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.1500000000000004 0.0 0.0 0.0 0.0 102-103 2.5375 0.0 0.0 0.0 0.0 104-105 2.9124999999999996 0.0 0.0 0.0 0.0 106-107 3.3375000000000004 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.5125 0.0 0.0 0.0 0.0 112-113 4.8875 0.0 0.0 0.0 0.0 114-115 5.2875 0.0 0.0 0.0 0.0 116-117 5.95 0.0 0.0 0.0 0.0 118-119 6.7 0.0 0.0 0.0 0.0 120-121 7.25 0.0 0.0 0.0 0.0 122-123 8.0125 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.6375 0.0 0.0 0.0 0.0 128-129 10.4875 0.0 0.0 0.0 0.0 130-131 11.325 0.0 0.0 0.0 0.0 132-133 12.287500000000001 0.0 0.0 0.0 0.0 134-135 13.0125 0.0 0.0 0.0 0.0 136-137 13.85 0.0 0.0 0.0 0.0 138-139 14.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 45 0.008969499 48.316666 145 >>END_MODULE SRR5578444 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578444_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73975 33.0 33.0 34.0 32.0 34.0 2 32.83025 33.0 33.0 34.0 32.0 34.0 3 32.75175 33.0 33.0 34.0 32.0 34.0 4 32.6825 34.0 33.0 34.0 32.0 34.0 5 32.723 34.0 33.0 34.0 32.0 34.0 6 36.7215 38.0 38.0 38.0 36.0 38.0 7 36.88425 38.0 38.0 38.0 36.0 38.0 8 36.832 38.0 38.0 38.0 36.0 38.0 9 36.68625 38.0 38.0 38.0 36.0 38.0 10-14 36.75215 38.0 38.0 38.0 36.0 38.0 15-19 36.73455 38.0 38.0 38.0 36.0 38.0 20-24 36.65915 38.0 38.0 38.0 36.0 38.0 25-29 36.62445 38.0 38.0 38.0 36.0 38.0 30-34 36.63565 38.0 38.0 38.0 35.8 38.0 35-39 36.6382 38.0 38.0 38.0 35.8 38.0 40-44 36.65165 38.0 38.0 38.0 36.0 38.0 45-49 36.608349999999994 38.0 38.0 38.0 35.8 38.0 50-54 36.522149999999996 38.0 38.0 38.0 35.4 38.0 55-59 36.537 38.0 38.0 38.0 35.4 38.0 60-64 36.45565 38.0 38.0 38.0 35.0 38.0 65-69 36.29475 38.0 38.0 38.0 34.6 38.0 70-74 36.116350000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.048700000000004 38.0 38.0 38.0 34.0 38.0 80-84 35.9462 38.0 38.0 38.0 34.0 38.0 85-89 35.774950000000004 38.0 38.0 38.0 33.0 38.0 90-94 35.70775 38.0 38.0 38.0 32.8 38.0 95-99 35.54605 38.0 38.0 38.0 32.2 38.0 100-104 35.387600000000006 38.0 37.6 38.0 31.6 38.0 105-109 35.168549999999996 38.0 37.0 38.0 29.8 38.0 110-114 35.0005 38.0 36.4 38.0 29.4 38.0 115-119 34.7596 38.0 36.0 38.0 27.4 38.0 120-124 34.2825 38.0 35.0 38.0 24.6 38.0 125-129 34.0079 38.0 35.0 38.0 23.0 38.0 130-134 33.54975 38.0 34.2 38.0 21.0 38.0 135-139 33.13244999999999 38.0 33.0 38.0 15.8 38.0 140-144 32.2841 38.0 33.0 38.0 13.0 38.0 145-149 30.987149999999996 38.0 31.4 38.0 4.2 38.0 150-151 25.51125 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 15.0 4 3.0 5 1.0 6 6.0 7 1.0 8 3.0 9 2.0 10 2.0 11 2.0 12 3.0 13 9.0 14 8.0 15 7.0 16 7.0 17 19.0 18 11.0 19 7.0 20 15.0 21 11.0 22 13.0 23 16.0 24 21.0 25 16.0 26 27.0 27 28.0 28 20.0 29 47.0 30 48.0 31 66.0 32 79.0 33 115.0 34 178.0 35 300.0 36 694.0 37 2184.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.075 18.65 12.85 28.425 2 29.425 23.075000000000003 26.125 21.375 3 24.775 24.675 27.975 22.575 4 27.6 29.575000000000003 19.925 22.900000000000002 5 27.025 33.75 18.325 20.9 6 23.95 34.0 20.525 21.525 7 21.9 19.675 33.75 24.675 8 24.25 23.150000000000002 23.775 28.825 9 25.3 22.900000000000002 25.75 26.05 10-14 26.674671069087996 25.358947421081595 22.53739556756216 25.428985942268245 15-19 26.533573501451013 24.887421194836385 23.661563094165917 24.917442209546685 20-24 26.829146231608448 25.527975177659894 23.53117806025423 24.111700530477428 25-29 26.564220642706974 25.392932225447996 23.10541595755331 24.93743117429172 30-34 27.102944121770477 25.025035049068695 23.47286200680953 24.399158822351293 35-39 26.140289390677413 24.47303860211285 24.578180543734042 24.808491463475693 40-44 26.37241655407096 24.941200020017014 23.865285492668768 24.82109793324326 45-49 26.29655586704045 24.57949539447337 24.389267120544652 24.73468161794153 50-54 26.14637565078094 24.649579495394473 25.200240288346016 24.003804565478575 55-59 26.316316316316318 25.055055055055053 24.56956956956957 24.05905905905906 60-64 26.219084810253328 25.398017422649446 23.966156002803647 24.416741764293583 65-69 25.882706465668353 25.76250813842841 24.565533129663947 23.789252266239295 70-74 26.532451923076923 24.929887820512818 24.278846153846153 24.258814102564102 75-79 25.86414186955215 25.13776174731991 24.67688608355876 24.32121029956918 80-84 25.955230607441532 25.214081826831592 24.7483599579348 24.082327607792077 85-89 26.197747183979974 25.12640801001251 24.360450563204004 24.315394242803503 90-94 26.024723487312944 25.439167208848406 24.71347780391372 23.822631499924928 95-99 26.174026234104335 25.227796134975467 24.556924001201562 24.041253629718636 100-104 26.65832290362954 25.792240300375468 24.565707133917396 22.983729662077597 105-109 26.498122653316646 26.16770963704631 24.405506883604506 22.92866082603254 110-114 26.279675448262047 25.593508965240908 24.732044475608532 23.39477111088851 115-119 26.618596965600123 26.508437233989284 24.12498122277302 22.747984577637574 120-124 27.158021229721612 25.721009413178447 24.454235930302424 22.666733426797517 125-129 27.540803043957148 25.828577150295384 24.056273155101632 22.57434665064584 130-134 27.823388065678817 26.261513816579896 24.08390068081698 21.83119743692431 135-139 27.98598949211909 25.939454590943207 24.008006004503375 22.066549912434326 140-144 28.084042021010507 26.21310655327664 24.287143571785894 21.415707853926964 145-149 28.49637227920941 25.854390793094822 23.802852139104328 21.846384788591443 150-151 29.27347755408278 26.04726772539702 23.608853319995 21.070401400525196 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 2.0 29 4.0 30 5.0 31 7.0 32 7.0 33 10.5 34 16.5 35 25.0 36 38.0 37 49.5 38 73.0 39 92.0 40 116.5 41 126.5 42 135.5 43 159.5 44 170.0 45 179.0 46 175.5 47 176.5 48 181.5 49 187.0 50 163.5 51 145.5 52 152.0 53 139.5 54 134.5 55 119.5 56 105.0 57 107.5 58 104.0 59 86.0 60 70.5 61 75.0 62 74.0 63 72.0 64 71.0 65 56.0 66 45.0 67 52.0 68 55.0 69 47.5 70 46.5 71 38.0 72 29.0 73 24.5 74 13.5 75 7.5 76 8.0 77 5.5 78 1.5 79 1.5 80 1.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.055 15-19 0.06999999999999999 20-24 0.09 25-29 0.11 30-34 0.13999999999999999 35-39 0.135 40-44 0.08499999999999999 45-49 0.12 50-54 0.12 55-59 0.1 60-64 0.13 65-69 0.165 70-74 0.16 75-79 0.19 80-84 0.155 85-89 0.125 90-94 0.095 95-99 0.13 100-104 0.125 105-109 0.125 110-114 0.16999999999999998 115-119 0.145 120-124 0.13999999999999999 125-129 0.13 130-134 0.12 135-139 0.075 140-144 0.05 145-149 0.075 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82141942095824 96.42500000000001 2 0.6917755572636434 1.35 3 0.25621316935690497 0.75 4 0.07686395080707148 0.3 5 0.10248526774276198 0.5 6 0.025621316935690495 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025621316935690495 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 21 0.525 Illumina Single End PCR Primer 1 (100% over 50bp) CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 6 0.15 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 5 0.125 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.3250000000000002 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 2.025 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.6125 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.4875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 4.6125 0.0 0.0 0.0 0.0 112-113 4.975 0.0 0.0 0.0 0.0 114-115 5.3875 0.0 0.0 0.0 0.0 116-117 6.050000000000001 0.0 0.0 0.0 0.0 118-119 6.8375 0.0 0.0 0.0 0.0 120-121 7.3875 0.0 0.0 0.0 0.0 122-123 8.15 0.0 0.0 0.0 0.0 124-125 9.0 0.0 0.0 0.0 0.0 126-127 9.7625 0.0 0.0 0.0 0.0 128-129 10.6875 0.0 0.0 0.0 0.0 130-131 11.55 0.0 0.0 0.0 0.0 132-133 12.425 0.0 0.0 0.0 0.0 134-135 13.175 0.0 0.0 0.0 0.0 136-137 13.975 0.0 0.0 0.0 0.0 138-139 14.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120503 spots for SRR5578444.sra Written 1120503 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra Read 1120499 spots for SRR5578444.sra Written 1120499 spots for SRR5578444.sra SRR ids: ['SRR5578444.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__sdm92r8 SRR5578444.sra spots: 22409984 blocks: [[1, 1120499], [1120500, 2240998], [2240999, 3361497], [3361498, 4481996], [4481997, 5602495], [5602496, 6722994], [6722995, 7843493], [7843494, 8963992], [8963993, 10084491], [10084492, 11204990], [11204991, 12325489], [12325490, 13445988], [13445989, 14566487], [14566488, 15686986], [15686987, 16807485], [16807486, 17927984], [17927985, 19048483], [19048484, 20168982], [20168983, 21289481], [21289482, 22409984]] SRR5578444 file size 7572307 SRR5578444 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578444 SRR5578444_1.fastq SRR5578444_2.fastq Input file: SRR5578444_1.fastq Paired file: SRR5578444_2.fastq trimmed: SRR5578444-trimmed-pair1.fastq, SRR5578444-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:45:36 2024 >> started Mon Dec 9 17:46:59 2024 >> done (83.651s) 22409984 read pairs processed; of these: 62737 ( 0.28%) short read pairs filtered out after trimming by size control 188014 ( 0.84%) empty read pairs filtered out after trimming by size control 22159233 (98.88%) read pairs available; of these: 12743907 (57.51%) trimmed read pairs available after processing 9415326 (42.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 16 0.00% 21 22 0.00% 22 9 0.00% 23 22 0.00% 24 23 0.00% 25 20 0.00% 26 19 0.00% 27 22 0.00% 28 26 0.00% 29 26 0.00% 30 32 0.00% 31 42 0.00% 32 36 0.00% 33 42 0.00% 34 43 0.00% 35 45 0.00% 36 43 0.00% 37 62 0.00% 38 72 0.00% 39 80 0.00% 40 85 0.00% 41 90 0.00% 42 107 0.00% 43 113 0.00% 44 121 0.00% 45 179 0.00% 46 181 0.00% 47 211 0.00% 48 205 0.00% 49 259 0.00% 50 299 0.00% 51 363 0.00% 52 383 0.00% 53 405 0.00% 54 427 0.00% 55 532 0.00% 56 593 0.00% 57 669 0.00% 58 735 0.00% 59 816 0.00% 60 909 0.00% 61 1143 0.01% 62 1292 0.01% 63 1514 0.01% 64 1628 0.01% 65 1821 0.01% 66 2078 0.01% 67 2519 0.01% 68 3167 0.01% 69 3887 0.02% 70 3942 0.02% 71 3991 0.02% 72 4676 0.02% 73 5295 0.02% 74 5810 0.03% 75 6716 0.03% 76 7433 0.03% 77 8034 0.04% 78 9220 0.04% 79 10003 0.05% 80 11119 0.05% 81 12830 0.06% 82 14669 0.07% 83 16442 0.07% 84 19851 0.09% 85 22383 0.10% 86 23423 0.11% 87 24923 0.11% 88 26468 0.12% 89 27559 0.12% 90 29272 0.13% 91 31519 0.14% 92 33211 0.15% 93 36221 0.16% 94 38386 0.17% 95 40420 0.18% 96 42575 0.19% 97 44479 0.20% 98 45728 0.21% 99 48599 0.22% 100 50497 0.23% 101 52208 0.24% 102 55846 0.25% 103 58308 0.26% 104 61383 0.28% 105 63975 0.29% 106 66467 0.30% 107 67938 0.31% 108 69802 0.32% 109 71676 0.32% 110 73272 0.33% 111 75493 0.34% 112 78648 0.35% 113 83171 0.38% 114 87020 0.39% 115 89848 0.41% 116 91790 0.41% 117 92992 0.42% 118 93651 0.42% 119 95071 0.43% 120 97336 0.44% 121 99449 0.45% 122 101564 0.46% 123 105720 0.48% 124 110060 0.50% 125 112905 0.51% 126 115618 0.52% 127 117519 0.53% 128 117809 0.53% 129 120677 0.54% 130 121222 0.55% 131 123353 0.56% 132 127917 0.58% 133 132322 0.60% 134 135460 0.61% 135 139503 0.63% 136 143610 0.65% 137 147456 0.67% 138 151810 0.69% 139 156622 0.71% 140 162723 0.73% 141 171089 0.77% 142 183848 0.83% 143 196490 0.89% 144 218142 0.98% 145 248852 1.12% 146 294178 1.33% 147 375038 1.69% 148 536382 2.42% 149 1003154 4.53% 150 4714377 21.28% 151 9415326 42.49% 22159233 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=21 prefix-density=0.58 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=41.66 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.1 sequence=TTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGTTAGAG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=5.77 fanout-score-rank=9 prefix-density=0.70 prefix-fanout=4.3 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=13.80 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=TCTTGCTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGT SRR5578444 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:48:04 Started mapping on | Dec 09 17:48:04 Finished on | Dec 09 17:56:46 Mapping speed, Million of reads per hour | 152.82 Number of input reads | 22159233 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 19571696 Uniquely mapped reads % | 88.32% Average mapped length | 285.76 Number of splices: Total | 16240626 Number of splices: Annotated (sjdb) | 15238300 Number of splices: GT/AG | 16036392 Number of splices: GC/AG | 183551 Number of splices: AT/AC | 9655 Number of splices: Non-canonical | 11028 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 171665 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 28385 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.20% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2444911 2444911 2444911 N_multimapping 171665 171665 171665 N_noFeature 446244 18975420 608564 N_ambiguous 488635 2586 55452 UnstrandedReadsAssigned:18636817 PositiveStrandReadsAssigned:593690 NegativeStrandReadsAssigned:18907680 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR5578444 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578444-trimmed-pair1.fastq SRR5578444-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,159,233 reads, 19,023,907 reads pseudoaligned [quant] estimated average fragment length: 214.555 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR5578444.ke.tsv 35125 SRR5578444.se.tsv 88098 total ==> SRR5578444.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.663 6.9649e-06 6.47614e-07 PNS24247 1044 830.445 20.1449 1.63001 PNS24249 1928 1714.45 71.9102 2.81841 PNS24246 1044 830.445 20.1449 1.63001 PNS24248 1044 830.445 20.1449 1.63001 PNS24244 1471 1257.45 253.655 13.5547 PNS24243 293 113.948 0 0 KQK14069 1603 1389.45 4735.09 228.993 KQK14071 474 269.453 56.7174 14.1439 ==> SRR5578444.se.tsv <== BRADI_1g14170v3 4952 BRADI_1g53295v3 46 BRADI_1g59795v3 459 BRADI_1g07683v3 0 BRADI_1g00485v3 60 BRADI_1g20270v3 2042 BRADI_1g74790v3 86 BRADI_1g09890v3 5 BRADI_1g77505v3 350 BRADI_1g48960v3 0 SRR5578444 completed mapping pipeline successfully