Starting /dee2/code/volunteer_pipeline.sh SRR5578446 current disk space = 1523628380160 free memory = 1575713296 SRR5578446 SRAfilesize e80ef1d7cc6f58d0a1e9b5b5eb98ca36 SRR5578446.sra SRR5578446.sra file validated SRR5578446 is paired end SRR5578446 is conventional basespace SRR5578446 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578446_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9245 34.0 33.0 34.0 32.0 34.0 2 33.137 34.0 33.0 34.0 32.0 34.0 3 33.2975 34.0 33.0 34.0 32.0 34.0 4 33.389 34.0 33.0 34.0 33.0 34.0 5 33.4 34.0 33.0 34.0 33.0 34.0 6 36.96425 38.0 37.0 38.0 35.0 38.0 7 37.33225 38.0 38.0 38.0 37.0 38.0 8 37.44625 38.0 38.0 38.0 37.0 38.0 9 37.4795 38.0 38.0 38.0 37.0 38.0 10-14 37.4664 38.0 38.0 38.0 37.2 38.0 15-19 37.45975 38.0 38.0 38.0 37.8 38.0 20-24 37.40925 38.0 38.0 38.0 37.0 38.0 25-29 37.3952 38.0 38.0 38.0 37.2 38.0 30-34 37.35815 38.0 38.0 38.0 37.0 38.0 35-39 37.29495 38.0 38.0 38.0 37.0 38.0 40-44 37.22595 38.0 38.0 38.0 36.6 38.0 45-49 37.09455 38.0 38.0 38.0 36.0 38.0 50-54 37.07245 38.0 38.0 38.0 36.0 38.0 55-59 36.9775 38.0 38.0 38.0 35.8 38.0 60-64 36.92805 38.0 38.0 38.0 35.2 38.0 65-69 36.84525 38.0 38.0 38.0 35.0 38.0 70-74 36.76885 38.0 38.0 38.0 34.8 38.0 75-79 36.67725 38.0 38.0 38.0 34.6 38.0 80-84 36.6038 38.0 38.0 38.0 34.2 38.0 85-89 36.4856 38.0 38.0 38.0 34.0 38.0 90-94 36.33299999999999 38.0 37.8 38.0 34.0 38.0 95-99 36.14985 38.0 37.4 38.0 33.2 38.0 100-104 36.03615 38.0 37.0 38.0 33.0 38.0 105-109 35.83595 38.0 36.4 38.0 32.4 38.0 110-114 35.605599999999995 38.0 36.0 38.0 31.0 38.0 115-119 35.36559999999999 38.0 36.0 38.0 30.2 38.0 120-124 35.067400000000006 38.0 35.0 38.0 28.4 38.0 125-129 34.9372 38.0 35.0 38.0 28.2 38.0 130-134 34.512950000000004 38.0 35.0 38.0 26.4 38.0 135-139 34.04215 38.0 34.2 38.0 23.8 38.0 140-144 33.56685 38.0 34.0 38.0 22.2 38.0 145-149 32.4553 38.0 33.0 38.0 15.0 38.0 150-151 27.8915 35.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 0.0 16 1.0 17 3.0 18 9.0 19 1.0 20 7.0 21 12.0 22 5.0 23 7.0 24 21.0 25 18.0 26 19.0 27 22.0 28 27.0 29 31.0 30 31.0 31 61.0 32 84.0 33 118.0 34 204.0 35 359.0 36 887.0 37 2066.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.79024646040902 11.064499213424227 5.768222338751967 33.37703198741479 2 24.125 13.950000000000001 35.75 26.174999999999997 3 21.675 18.224999999999998 25.874999999999996 34.225 4 29.225 26.224999999999998 20.225 24.325 5 27.35 29.925 21.825 20.9 6 22.625 31.624999999999996 23.5 22.25 7 19.625 22.3 37.55 20.525 8 20.225 22.6 29.475 27.700000000000003 9 20.125 21.625 31.55 26.700000000000003 10-14 24.099999999999998 25.705 24.79 25.405 15-19 24.33 24.325 25.21 26.135 20-24 24.585 24.755 25.105 25.555 25-29 24.19 24.675 25.805 25.330000000000002 30-34 24.455 25.19 24.865000000000002 25.490000000000002 35-39 24.445 25.03 25.09 25.435000000000002 40-44 24.295 24.654999999999998 25.355 25.695 45-49 23.830000000000002 24.740000000000002 25.035 26.395000000000003 50-54 23.74 24.4 25.165 26.695 55-59 24.375 24.69 24.77 26.165 60-64 24.865000000000002 24.875 24.055 26.205000000000002 65-69 24.224999999999998 24.560000000000002 25.095 26.119999999999997 70-74 24.465 24.415 24.94 26.179999999999996 75-79 24.595 24.525 24.6 26.279999999999998 80-84 24.21 24.555 24.895 26.340000000000003 85-89 25.1 23.919999999999998 24.765 26.215 90-94 24.91 24.245 25.03 25.814999999999998 95-99 25.035 23.830000000000002 24.985 26.150000000000002 100-104 25.11 24.64 24.29 25.96 105-109 24.725 24.485 24.58 26.21 110-114 24.685000000000002 24.695 24.98 25.64 115-119 25.34 24.685000000000002 23.974999999999998 26.0 120-124 25.240000000000002 24.725 24.36 25.674999999999997 125-129 24.585 24.64 24.395 26.38 130-134 25.174999999999997 24.665 24.325 25.835 135-139 25.290000000000003 24.455 24.07 26.185000000000002 140-144 24.52 25.16 24.104999999999997 26.215 145-149 24.675 24.895 23.91 26.52 150-151 25.86573321665208 25.59069883735467 22.765345668208525 25.778222277784725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 3.0 26 3.0 27 1.5 28 3.5 29 4.5 30 5.5 31 13.5 32 19.5 33 24.0 34 33.0 35 37.5 36 46.5 37 62.5 38 79.5 39 88.5 40 109.0 41 144.0 42 166.5 43 170.5 44 161.0 45 157.5 46 166.5 47 179.0 48 172.0 49 151.0 50 141.5 51 133.5 52 119.5 53 114.5 54 97.5 55 85.5 56 96.5 57 108.5 58 101.5 59 95.0 60 97.5 61 89.0 62 89.0 63 78.0 64 75.0 65 74.0 66 60.5 67 53.5 68 49.5 69 52.5 70 49.0 71 36.0 72 23.5 73 20.5 74 19.5 75 16.0 76 10.5 77 4.0 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5510930350788 96.925 2 1.2455516014234875 2.45 3 0.1779359430604982 0.525 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.6624999999999996 0.0 0.0 0.0 0.0 114-115 3.025 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.7875 0.0 0.0 0.0 0.0 120-121 4.137499999999999 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.15 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 6.025 0.0 0.0 0.0 0.0 130-131 6.449999999999999 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.5625 0.0 0.0 0.0 0.0 136-137 8.1625 0.0 0.0 0.0 0.0 138-139 8.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578446 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578446_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.809 33.0 33.0 34.0 32.0 34.0 2 32.906 33.0 33.0 34.0 32.0 34.0 3 32.9765 34.0 33.0 34.0 32.0 34.0 4 32.8895 34.0 33.0 34.0 32.0 34.0 5 32.97625 34.0 33.0 34.0 32.0 34.0 6 36.9815 38.0 38.0 38.0 36.0 38.0 7 37.093 38.0 38.0 38.0 36.0 38.0 8 37.0855 38.0 38.0 38.0 37.0 38.0 9 37.03925 38.0 38.0 38.0 37.0 38.0 10-14 37.01235 38.0 38.0 38.0 36.8 38.0 15-19 36.95585 38.0 38.0 38.0 36.8 38.0 20-24 36.929 38.0 38.0 38.0 36.4 38.0 25-29 36.87865 38.0 38.0 38.0 36.2 38.0 30-34 36.9034 38.0 38.0 38.0 36.4 38.0 35-39 36.848 38.0 38.0 38.0 36.0 38.0 40-44 36.83239999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.842650000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.81125 38.0 38.0 38.0 36.0 38.0 55-59 36.812400000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.66225 38.0 38.0 38.0 35.2 38.0 65-69 36.64785 38.0 38.0 38.0 35.2 38.0 70-74 36.48415 38.0 38.0 38.0 34.8 38.0 75-79 36.3722 38.0 38.0 38.0 34.2 38.0 80-84 36.32955 38.0 38.0 38.0 34.0 38.0 85-89 36.2116 38.0 38.0 38.0 34.0 38.0 90-94 36.09685 38.0 38.0 38.0 33.8 38.0 95-99 35.9511 38.0 38.0 38.0 33.4 38.0 100-104 35.838150000000006 38.0 38.0 38.0 33.2 38.0 105-109 35.71625 38.0 37.8 38.0 32.6 38.0 110-114 35.46495 38.0 37.0 38.0 31.0 38.0 115-119 35.1328 38.0 36.0 38.0 30.0 38.0 120-124 34.8387 38.0 35.6 38.0 28.0 38.0 125-129 34.527300000000004 38.0 35.0 38.0 26.0 38.0 130-134 34.223800000000004 38.0 34.8 38.0 24.2 38.0 135-139 33.86495 38.0 33.2 38.0 23.6 38.0 140-144 33.330149999999996 38.0 33.0 38.0 20.0 38.0 145-149 32.2685 38.0 33.0 38.0 10.2 38.0 150-151 26.859 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 9.0 4 4.0 5 2.0 6 0.0 7 0.0 8 2.0 9 4.0 10 2.0 11 0.0 12 7.0 13 2.0 14 4.0 15 6.0 16 6.0 17 4.0 18 9.0 19 13.0 20 10.0 21 7.0 22 10.0 23 17.0 24 17.0 25 21.0 26 19.0 27 31.0 28 28.0 29 32.0 30 55.0 31 58.0 32 74.0 33 85.0 34 153.0 35 259.0 36 665.0 37 2376.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.7 18.9 8.175 29.225 2 27.3 23.150000000000002 28.999999999999996 20.549999999999997 3 23.075000000000003 24.675 27.700000000000003 24.55 4 28.1 30.0 18.15 23.75 5 28.7 32.1 19.025 20.175 6 22.436218109054526 33.81690845422711 20.485242621310658 23.261630815407706 7 22.8 18.5 32.675 26.025 8 22.225 22.075 24.25 31.45 9 23.861930965482742 22.136068034017008 26.96348174087044 27.03851925962982 10-14 26.16770963704631 24.690863579474343 23.038798498122652 26.102628285356694 15-19 26.809235238142936 24.350177793359045 23.523814293584415 25.316772674913608 20-24 25.91034310042574 25.013774104683193 23.335837716003006 25.740045078888052 25-29 26.823281907433383 24.679422961330395 23.362051693047487 25.13524343818874 30-34 25.94318352622877 24.870985520316648 23.65348965379027 25.532341299664314 35-39 25.819056206792908 25.197875964332233 23.2591924656848 25.723875363190064 40-44 26.771850738792885 24.34259954921112 23.080390683696468 25.805159028299524 45-49 25.740045078888052 24.527923866766844 23.971950914099676 25.760080140245428 50-54 26.431254695717506 24.64312546957175 23.611319809666917 25.314300025043828 55-59 26.155772602053595 24.74830954169797 23.596293513648884 25.499624342599546 60-64 26.10568494866016 24.34259954921112 24.142248935637365 25.40946656649136 65-69 26.493884098656505 24.669139763384802 23.79687186685382 25.040104271104873 70-74 26.29282239053017 23.8902543010483 24.37177107889853 25.445152229523 75-79 26.103531300160515 24.056982343499197 23.550361155698234 26.289125200642054 80-84 26.3429803882229 24.366755279129258 24.28148668305161 25.008777649596226 85-89 25.79530083663143 24.532839036120436 24.522819498021143 25.14904062922699 90-94 26.57150012521913 24.247433007763586 23.771600300525918 25.40946656649136 95-99 25.815176558978216 24.9686952166291 24.022038567493112 25.19408965689958 100-104 26.9671925870273 24.47282744803406 23.886801903330827 24.673178061607814 105-109 26.02053593789131 24.883546205860256 24.352617079889807 24.74330077635863 110-114 26.289926289926292 25.256982399839544 23.21616607330893 25.236925236925238 115-119 26.712775021300057 25.489901267979754 23.059189094371774 24.73813461634842 120-124 26.747156956064327 25.43960723410651 23.606031761935775 24.20720404789339 125-129 27.75495892606692 24.79463033460228 23.226808254858746 24.22360248447205 130-134 27.514526147064718 24.53917050691244 24.003205770386696 23.943097575636145 135-139 26.636614074630604 25.494615577260205 23.801652892561982 24.06711745554721 140-144 27.71295508037458 25.30422154339226 23.220992538434572 23.761830837798588 145-149 27.122464312546956 25.96543951915853 23.516153268219384 23.39594290007513 150-151 27.749280620542976 26.01025897660453 23.445514825472287 22.794945577380208 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 1.0 7 1.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.5 26 2.5 27 1.0 28 0.5 29 3.0 30 4.5 31 5.5 32 9.0 33 13.5 34 20.0 35 31.5 36 40.0 37 53.5 38 73.5 39 88.0 40 109.0 41 122.0 42 125.5 43 138.5 44 147.0 45 165.5 46 173.0 47 162.0 48 154.0 49 146.5 50 139.5 51 140.0 52 132.5 53 108.5 54 101.0 55 97.5 56 86.0 57 91.0 58 108.5 59 111.5 60 103.5 61 105.0 62 118.0 63 110.0 64 100.0 65 88.5 66 69.5 67 64.5 68 67.5 69 69.5 70 55.5 71 38.0 72 27.5 73 20.5 74 15.5 75 12.0 76 8.0 77 3.5 78 2.5 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.05 10-14 0.125 15-19 0.165 20-24 0.17500000000000002 25-29 0.18 30-34 0.20500000000000002 35-39 0.19 40-44 0.17500000000000002 45-49 0.17500000000000002 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.26 70-74 0.315 75-79 0.32 80-84 0.315 85-89 0.19499999999999998 90-94 0.17500000000000002 95-99 0.17500000000000002 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.28500000000000003 115-119 0.23500000000000001 120-124 0.19499999999999998 125-129 0.18 130-134 0.18 135-139 0.17500000000000002 140-144 0.155 145-149 0.17500000000000002 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23529411764706 96.025 2 1.3554987212276215 2.65 3 0.3069053708439898 0.8999999999999999 4 0.07672634271099744 0.3 5 0.025575447570332477 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0125 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0125 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.075 0.025 0.0 0.0 0.0 74-75 0.0875 0.025 0.0 0.0 0.0 76-77 0.1375 0.025 0.0 0.0 0.0 78-79 0.175 0.025 0.0 0.0 0.0 80-81 0.1875 0.025 0.0 0.0 0.0 82-83 0.225 0.025 0.0 0.0 0.0 84-85 0.275 0.025 0.0 0.0 0.0 86-87 0.3375 0.025 0.0 0.0 0.0 88-89 0.35 0.025 0.0 0.0 0.0 90-91 0.48750000000000004 0.025 0.0 0.0 0.0 92-93 0.5874999999999999 0.025 0.0 0.0 0.0 94-95 0.7124999999999999 0.025 0.0 0.0 0.0 96-97 0.75 0.025 0.0 0.0 0.0 98-99 0.8999999999999999 0.025 0.0 0.0 0.0 100-101 0.9874999999999999 0.025 0.0 0.0 0.0 102-103 1.2 0.025 0.0 0.0 0.0 104-105 1.3875 0.025 0.0 0.0 0.0 106-107 1.575 0.025 0.0 0.0 0.0 108-109 1.775 0.025 0.0 0.0 0.0 110-111 2.15 0.025 0.0 0.0 0.0 112-113 2.65 0.025 0.0 0.0 0.0 114-115 2.9875 0.025 0.0 0.0 0.0 116-117 3.375 0.025 0.0 0.0 0.0 118-119 3.7249999999999996 0.025 0.0 0.0 0.0 120-121 4.0625 0.025 0.0 0.0 0.0 122-123 4.575 0.025 0.0 0.0 0.0 124-125 5.05 0.025 0.0 0.0 0.0 126-127 5.4 0.025 0.0 0.0 0.0 128-129 5.8875 0.025 0.0 0.0 0.0 130-131 6.300000000000001 0.025 0.0 0.0 0.0 132-133 6.8875 0.025 0.0 0.0 0.0 134-135 7.4125 0.025 0.0 0.0 0.0 136-137 8.05 0.025 0.0 0.0 0.0 138-139 8.525 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACGCCG 10 0.006830828 145.0 5 GGAGATC 35 0.0033124194 62.14286 2 >>END_MODULE Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1152992 spots for SRR5578446.sra Written 1152992 spots for SRR5578446.sra Read 1153002 spots for SRR5578446.sra Written 1153002 spots for SRR5578446.sra SRR ids: ['SRR5578446.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5mc157wv SRR5578446.sra spots: 23059850 blocks: [[1, 1152992], [1152993, 2305984], [2305985, 3458976], [3458977, 4611968], [4611969, 5764960], [5764961, 6917952], [6917953, 8070944], [8070945, 9223936], [9223937, 10376928], [10376929, 11529920], [11529921, 12682912], [12682913, 13835904], [13835905, 14988896], [14988897, 16141888], [16141889, 17294880], [17294881, 18447872], [18447873, 19600864], [19600865, 20753856], [20753857, 21906848], [21906849, 23059850]] SRR5578446 file size 7792526 SRR5578446 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578446 SRR5578446_1.fastq SRR5578446_2.fastq Input file: SRR5578446_1.fastq Paired file: SRR5578446_2.fastq trimmed: SRR5578446-trimmed-pair1.fastq, SRR5578446-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:54:52 2024 >> started Mon Dec 9 17:55:21 2024 >> done (29.264s) 23059850 read pairs processed; of these: 41879 ( 0.18%) short read pairs filtered out after trimming by size control 33941 ( 0.15%) empty read pairs filtered out after trimming by size control 22984030 (99.67%) read pairs available; of these: 12215877 (53.15%) trimmed read pairs available after processing 10768153 (46.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 14 0.00% 20 19 0.00% 21 23 0.00% 22 19 0.00% 23 25 0.00% 24 22 0.00% 25 20 0.00% 26 28 0.00% 27 31 0.00% 28 28 0.00% 29 35 0.00% 30 35 0.00% 31 38 0.00% 32 24 0.00% 33 29 0.00% 34 46 0.00% 35 34 0.00% 36 43 0.00% 37 45 0.00% 38 52 0.00% 39 73 0.00% 40 52 0.00% 41 79 0.00% 42 84 0.00% 43 76 0.00% 44 110 0.00% 45 114 0.00% 46 116 0.00% 47 141 0.00% 48 165 0.00% 49 181 0.00% 50 170 0.00% 51 234 0.00% 52 276 0.00% 53 275 0.00% 54 272 0.00% 55 309 0.00% 56 380 0.00% 57 401 0.00% 58 501 0.00% 59 467 0.00% 60 629 0.00% 61 644 0.00% 62 761 0.00% 63 809 0.00% 64 878 0.00% 65 1036 0.00% 66 1192 0.01% 67 1374 0.01% 68 1764 0.01% 69 1854 0.01% 70 2068 0.01% 71 2135 0.01% 72 2544 0.01% 73 2674 0.01% 74 3245 0.01% 75 3473 0.02% 76 3768 0.02% 77 4286 0.02% 78 4738 0.02% 79 5305 0.02% 80 5771 0.03% 81 6547 0.03% 82 7332 0.03% 83 8429 0.04% 84 10342 0.04% 85 11755 0.05% 86 12236 0.05% 87 13477 0.06% 88 14262 0.06% 89 14757 0.06% 90 15062 0.07% 91 16270 0.07% 92 17347 0.08% 93 18496 0.08% 94 19963 0.09% 95 21104 0.09% 96 22772 0.10% 97 23881 0.10% 98 24731 0.11% 99 25857 0.11% 100 27380 0.12% 101 28987 0.13% 102 30205 0.13% 103 32218 0.14% 104 33072 0.14% 105 35214 0.15% 106 37437 0.16% 107 38980 0.17% 108 40350 0.18% 109 42262 0.18% 110 43605 0.19% 111 45060 0.20% 112 47395 0.21% 113 49564 0.22% 114 51659 0.22% 115 54610 0.24% 116 56353 0.25% 117 58466 0.25% 118 60390 0.26% 119 61467 0.27% 120 64625 0.28% 121 66404 0.29% 122 68409 0.30% 123 71060 0.31% 124 74214 0.32% 125 77136 0.34% 126 80167 0.35% 127 82976 0.36% 128 85356 0.37% 129 89221 0.39% 130 91816 0.40% 131 92970 0.40% 132 97853 0.43% 133 102200 0.44% 134 104642 0.46% 135 109649 0.48% 136 114108 0.50% 137 119689 0.52% 138 125979 0.55% 139 134336 0.58% 140 143042 0.62% 141 155097 0.67% 142 169410 0.74% 143 186510 0.81% 144 211108 0.92% 145 249264 1.08% 146 305185 1.33% 147 405776 1.77% 148 609292 2.65% 149 1184279 5.15% 150 5508766 23.97% 151 10768153 46.85% 22984030 reads passed initial QC criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=15 prefix-density=1.24 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.27 sequence-density-rank=26 fanout-score=16.49 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=7.4 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=19 prefix-density=0.85 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=47.27 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.3 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5578446 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:56:15 Started mapping on | Dec 09 17:56:15 Finished on | Dec 09 17:59:56 Mapping speed, Million of reads per hour | 374.40 Number of input reads | 22984030 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 21727371 Uniquely mapped reads % | 94.53% Average mapped length | 291.66 Number of splices: Total | 22953378 Number of splices: Annotated (sjdb) | 21738184 Number of splices: GT/AG | 22655003 Number of splices: GC/AG | 276076 Number of splices: AT/AC | 7045 Number of splices: Non-canonical | 15254 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 206319 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 20527 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1070632 1070632 1070632 N_multimapping 206319 206319 206319 N_noFeature 720595 21043318 926427 N_ambiguous 568129 2534 92103 UnstrandedReadsAssigned:20438647 PositiveStrandReadsAssigned:681519 NegativeStrandReadsAssigned:20708841 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5578446 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578446-trimmed-pair1.fastq SRR5578446-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,984,030 reads, 20,724,408 reads pseudoaligned [quant] estimated average fragment length: 243.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR5578446.ke.tsv 35125 SRR5578446.se.tsv 88098 total ==> SRR5578446.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.935 0 0 PNS24247 1044 801.525 41.4831 3.47279 PNS24249 1928 1685.53 30.5948 1.21797 PNS24246 1044 801.525 41.4831 3.47279 PNS24248 1044 801.525 41.4831 3.47279 PNS24244 1471 1228.53 65.9559 3.60242 PNS24243 293 100.355 0 0 KQK14069 1603 1360.53 2829.63 139.556 KQK14071 474 246.653 74.7197 20.327 ==> SRR5578446.se.tsv <== BRADI_1g14170v3 3415 BRADI_1g53295v3 87 BRADI_1g59795v3 752 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 201 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR5578446 completed mapping pipeline successfully