Starting /dee2/code/volunteer_pipeline.sh SRR5578447 current disk space = 1523707346944 free memory = 1573110332 SRR5578447 SRAfilesize 0667fc5ed7b1e532c4b466e503147bce SRR5578447.sra SRR5578447.sra file validated SRR5578447 is paired end SRR5578447 is conventional basespace SRR5578447 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7325 34.0 33.0 34.0 32.0 34.0 2 33.1165 34.0 33.0 34.0 32.0 34.0 3 33.24175 34.0 33.0 34.0 32.0 34.0 4 33.3325 34.0 33.0 34.0 33.0 34.0 5 33.4265 34.0 33.0 34.0 33.0 34.0 6 36.89625 38.0 37.0 38.0 35.0 38.0 7 37.3005 38.0 38.0 38.0 36.0 38.0 8 37.4475 38.0 38.0 38.0 37.0 38.0 9 37.4575 38.0 38.0 38.0 37.0 38.0 10-14 37.504599999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.496249999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.50515 38.0 38.0 38.0 37.8 38.0 25-29 37.468450000000004 38.0 38.0 38.0 37.8 38.0 30-34 37.44625 38.0 38.0 38.0 37.4 38.0 35-39 37.399350000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.28925 38.0 38.0 38.0 37.0 38.0 45-49 37.1785 38.0 38.0 38.0 36.2 38.0 50-54 37.111149999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.0784 38.0 38.0 38.0 36.0 38.0 60-64 37.015299999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.9844 38.0 38.0 38.0 35.6 38.0 70-74 36.88065 38.0 38.0 38.0 35.0 38.0 75-79 36.80775 38.0 38.0 38.0 35.0 38.0 80-84 36.7418 38.0 38.0 38.0 34.8 38.0 85-89 36.60510000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.4478 38.0 38.0 38.0 34.0 38.0 95-99 36.2256 38.0 37.6 38.0 33.4 38.0 100-104 36.202149999999996 38.0 37.2 38.0 33.4 38.0 105-109 35.94255 38.0 36.8 38.0 32.4 38.0 110-114 35.7182 38.0 36.0 38.0 31.4 38.0 115-119 35.60585 38.0 36.0 38.0 31.0 38.0 120-124 35.150400000000005 38.0 35.4 38.0 28.4 38.0 125-129 35.0717 38.0 35.0 38.0 28.4 38.0 130-134 34.730599999999995 38.0 35.0 38.0 27.4 38.0 135-139 34.167899999999996 38.0 34.6 38.0 24.0 38.0 140-144 33.5665 38.0 34.2 38.0 21.8 38.0 145-149 32.650150000000004 38.0 33.6 38.0 15.4 38.0 150-151 27.900875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 2.0 14 2.0 15 0.0 16 4.0 17 1.0 18 2.0 19 3.0 20 5.0 21 5.0 22 6.0 23 10.0 24 11.0 25 16.0 26 18.0 27 27.0 28 32.0 29 34.0 30 48.0 31 60.0 32 59.0 33 115.0 34 193.0 35 338.0 36 848.0 37 2158.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.32806324110672 10.197628458498023 6.851119894598155 33.6231884057971 2 25.1 13.450000000000001 32.375 29.075 3 21.975 19.825 23.875 34.325 4 28.799999999999997 25.624999999999996 21.3 24.275 5 27.35 29.75 20.4 22.5 6 22.6 32.300000000000004 23.125 21.975 7 18.75 22.8 38.2 20.25 8 20.65 23.35 27.3 28.7 9 21.224999999999998 21.525 31.874999999999996 25.374999999999996 10-14 23.94 25.66 24.665 25.735000000000003 15-19 23.365 24.610000000000003 25.575 26.450000000000003 20-24 23.415 24.22 25.695 26.669999999999998 25-29 24.044999999999998 24.595 25.11 26.25 30-34 24.0 24.535 25.46 26.005 35-39 24.185000000000002 24.965 24.935 25.915 40-44 24.16 24.654999999999998 25.46 25.724999999999998 45-49 24.2 25.080000000000002 24.93 25.790000000000003 50-54 24.255 24.515 24.805 26.424999999999997 55-59 24.445 24.349999999999998 25.480000000000004 25.724999999999998 60-64 24.685000000000002 24.145 24.84 26.33 65-69 24.495 23.990000000000002 25.165 26.35 70-74 24.58 24.51 25.06 25.85 75-79 24.58 24.68 25.085 25.655 80-84 24.64 24.625 24.765 25.97 85-89 24.995 24.310000000000002 24.615000000000002 26.08 90-94 24.84 24.82 24.335 26.005 95-99 25.335 24.8 24.205 25.66 100-104 24.95 25.045 24.04 25.965 105-109 25.35 24.975 23.93 25.745 110-114 24.865000000000002 24.88 24.33 25.924999999999997 115-119 24.68 24.975 23.799999999999997 26.545 120-124 24.435000000000002 24.915000000000003 23.76 26.889999999999997 125-129 25.115 25.259999999999998 23.28 26.345000000000002 130-134 25.040000000000003 25.03 23.455000000000002 26.474999999999998 135-139 24.75 24.905 23.715 26.63 140-144 24.725 25.275 23.105 26.895000000000003 145-149 24.610000000000003 24.955 23.565 26.87 150-151 24.85 26.1 23.200000000000003 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 3.5 28 4.0 29 3.5 30 6.0 31 6.5 32 11.5 33 20.5 34 24.5 35 32.0 36 48.0 37 63.5 38 77.0 39 97.0 40 110.0 41 138.5 42 163.5 43 167.5 44 180.0 45 182.5 46 186.0 47 176.0 48 170.5 49 174.0 50 151.5 51 135.5 52 124.5 53 125.0 54 121.5 55 92.5 56 90.5 57 97.5 58 84.5 59 86.5 60 96.5 61 78.0 62 51.5 63 50.0 64 60.5 65 63.0 66 54.0 67 48.0 68 50.5 69 47.0 70 43.0 71 41.5 72 38.0 73 30.0 74 22.5 75 23.5 76 18.5 77 10.5 78 7.0 79 4.0 80 2.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.2125 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.675 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 1.0125 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.475 0.0 0.0 0.0 0.0 90-91 1.9249999999999998 0.0 0.0 0.0 0.0 92-93 2.2875 0.0 0.0 0.0 0.0 94-95 2.6375 0.0 0.0 0.0 0.0 96-97 3.2375 0.0 0.0 0.0 0.0 98-99 3.7249999999999996 0.0 0.0 0.0 0.0 100-101 4.15 0.0 0.0 0.0 0.0 102-103 4.75 0.0 0.0 0.0 0.0 104-105 5.525 0.0 0.0 0.0 0.0 106-107 6.2625 0.0 0.0 0.0 0.0 108-109 6.7875 0.0 0.0 0.0 0.0 110-111 7.275 0.0 0.0 0.0 0.0 112-113 7.8625 0.0 0.0 0.0 0.0 114-115 8.6625 0.0 0.0 0.0 0.0 116-117 9.475000000000001 0.0 0.0 0.0 0.0 118-119 10.3125 0.0 0.0 0.0 0.0 120-121 11.0 0.0 0.0 0.0 0.0 122-123 11.8875 0.0 0.0 0.0 0.0 124-125 12.7625 0.0 0.0 0.0 0.0 126-127 13.675 0.0 0.0 0.0 0.0 128-129 14.5375 0.0 0.0 0.0 0.0 130-131 15.375 0.0 0.0 0.0 0.0 132-133 16.375 0.0 0.0 0.0 0.0 134-135 17.1875 0.0 0.0 0.0 0.0 136-137 18.1875 0.0 0.0 0.0 0.0 138-139 18.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAACAC 10 0.0060887975 150.61038 1 AAAAAAA 40 0.007666461 18.120312 95-99 >>END_MODULE SRR5578447 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578447_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.767 33.0 33.0 34.0 32.0 34.0 2 32.866 33.0 33.0 34.0 32.0 34.0 3 32.9695 34.0 33.0 34.0 32.0 34.0 4 32.9025 34.0 33.0 34.0 32.0 34.0 5 32.88325 34.0 33.0 34.0 32.0 34.0 6 36.955 38.0 38.0 38.0 36.0 38.0 7 37.1255 38.0 38.0 38.0 36.0 38.0 8 37.13275 38.0 38.0 38.0 37.0 38.0 9 37.05175 38.0 38.0 38.0 36.0 38.0 10-14 37.00285 38.0 38.0 38.0 36.4 38.0 15-19 36.95615 38.0 38.0 38.0 36.2 38.0 20-24 36.8717 38.0 38.0 38.0 36.0 38.0 25-29 36.885450000000006 38.0 38.0 38.0 36.2 38.0 30-34 36.856950000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.842400000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.819849999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.83645 38.0 38.0 38.0 36.0 38.0 50-54 36.763099999999994 38.0 38.0 38.0 35.8 38.0 55-59 36.75565 38.0 38.0 38.0 35.8 38.0 60-64 36.6222 38.0 38.0 38.0 35.0 38.0 65-69 36.574400000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.5079 38.0 38.0 38.0 34.8 38.0 75-79 36.37885 38.0 38.0 38.0 34.2 38.0 80-84 36.3249 38.0 38.0 38.0 34.0 38.0 85-89 36.15555 38.0 38.0 38.0 33.8 38.0 90-94 36.070949999999996 38.0 38.0 38.0 33.6 38.0 95-99 35.940599999999996 38.0 38.0 38.0 33.2 38.0 100-104 35.7463 38.0 37.4 38.0 32.6 38.0 105-109 35.5083 38.0 37.0 38.0 31.2 38.0 110-114 35.21395 38.0 36.6 38.0 29.8 38.0 115-119 34.94539999999999 38.0 35.8 38.0 28.4 38.0 120-124 34.531800000000004 38.0 35.2 38.0 25.4 38.0 125-129 34.1749 38.0 35.0 38.0 23.6 38.0 130-134 33.59435 38.0 33.8 38.0 21.0 38.0 135-139 33.037850000000006 38.0 33.0 38.0 17.8 38.0 140-144 32.1674 38.0 32.2 38.0 13.0 38.0 145-149 30.7771 38.0 30.8 38.0 4.2 38.0 150-151 25.3485 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 6.0 5 2.0 6 2.0 7 1.0 8 3.0 9 5.0 10 0.0 11 3.0 12 5.0 13 5.0 14 4.0 15 5.0 16 2.0 17 5.0 18 8.0 19 6.0 20 8.0 21 10.0 22 11.0 23 15.0 24 16.0 25 30.0 26 23.0 27 40.0 28 39.0 29 43.0 30 53.0 31 61.0 32 92.0 33 114.0 34 200.0 35 323.0 36 725.0 37 2121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.95 18.224999999999998 10.075000000000001 26.75 2 29.299999999999997 22.400000000000002 25.8 22.5 3 24.224999999999998 24.099999999999998 25.874999999999996 25.8 4 27.025 28.849999999999998 21.025 23.1 5 26.8 33.25 18.8 21.15 6 22.786393196598297 33.616808404202104 19.15957978989495 24.437218609304654 7 22.45 18.675 34.475 24.4 8 23.549999999999997 21.9 24.175 30.375000000000004 9 23.961980990495245 21.785892946473236 26.713356678339167 27.538769384692348 10-14 26.50445579253029 24.84229498347852 22.724541904475817 25.92870731951537 15-19 26.3163168177947 24.076950052602577 23.916637443013876 25.690095686588847 20-24 25.820514105326453 24.88851029713885 23.580698501778823 25.710277095755874 25-29 26.581136614212692 24.646687380976246 23.519093916006817 25.253082088804252 30-34 25.919799498746865 24.67669172932331 23.644110275689222 25.759398496240603 35-39 26.08129103392973 24.53265173156919 23.916203077231494 25.469854157269584 40-44 26.27411676271611 24.53520420947131 23.663242295164117 25.527436732648457 45-49 25.91330493610624 24.5652718616888 23.25231771485843 26.26910548734653 50-54 26.43447757454272 24.31470809320972 23.92883988975194 25.321974442495616 55-59 25.81307942871461 25.086444500125282 23.868704585316962 25.231771485843147 60-64 26.770233024304684 24.38486594838386 23.52292658481584 25.321974442495616 65-69 25.738354309782878 24.916010630296345 23.58220929649501 25.76342576342576 70-74 26.519558676028083 24.433299899699097 23.535606820461386 25.511534603811437 75-79 25.67703109327984 24.704112337011033 24.102306920762288 25.51654964894684 80-84 25.697091273821464 24.90471414242728 23.976930792377132 25.42126379137412 85-89 26.14775461106656 24.779470729751406 23.842221331194867 25.23055332798717 90-94 26.59984966173891 25.091455775494865 23.643197193685793 24.66549736908043 95-99 26.55474818341268 24.800801804059134 24.34477574542721 24.299674267100976 100-104 27.36156351791531 24.896016036081186 23.317464294662994 24.424956151340517 105-109 27.15108995239288 24.911049862189927 23.823603106990728 24.11425707842646 110-114 27.379400260756192 25.65439775348511 23.553304583291546 23.412897402467156 115-119 28.084423722865594 25.728179676141778 23.181430791597734 23.005965809394898 120-124 28.569996491403938 26.013733647436222 22.765776151571348 22.650493709588492 125-129 28.101037437979254 25.44479526888187 23.36991931037939 23.084247982759486 130-134 28.376685210244073 26.472209692778026 22.593093770360348 22.558011326617553 135-139 28.953698135898975 25.55622369212267 23.035678492683907 22.454399679294447 140-144 29.054223201321783 25.61457968257147 22.96600410554248 22.365193010564262 145-149 29.290044591412396 26.148604639510996 23.2025652587805 21.35878551029611 150-151 29.483168564635214 26.742585408584656 22.73808034038293 21.036165686397197 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 1.0 6 2.0 7 2.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 3.0 29 4.0 30 6.0 31 7.5 32 7.5 33 12.0 34 19.5 35 26.5 36 43.5 37 48.0 38 61.0 39 96.5 40 118.0 41 143.0 42 153.0 43 149.5 44 166.0 45 166.5 46 152.0 47 153.5 48 158.5 49 158.0 50 143.5 51 135.5 52 129.5 53 115.5 54 113.5 55 115.0 56 95.5 57 81.5 58 84.0 59 92.0 60 95.5 61 81.5 62 75.0 63 76.0 64 80.0 65 73.5 66 70.5 67 73.0 68 66.0 69 58.5 70 53.5 71 52.5 72 46.0 73 39.5 74 28.0 75 16.0 76 14.5 77 11.0 78 7.5 79 5.0 80 2.0 81 0.5 82 0.5 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.05 10-14 0.13 15-19 0.19499999999999998 20-24 0.215 25-29 0.22999999999999998 30-34 0.25 35-39 0.23500000000000001 40-44 0.22499999999999998 45-49 0.22499999999999998 50-54 0.22499999999999998 55-59 0.22499999999999998 60-64 0.22499999999999998 65-69 0.28500000000000003 70-74 0.3 75-79 0.3 80-84 0.3 85-89 0.24 90-94 0.22499999999999998 95-99 0.22499999999999998 100-104 0.22499999999999998 105-109 0.22499999999999998 110-114 0.29 115-119 0.265 120-124 0.245 125-129 0.23500000000000001 130-134 0.23500000000000001 135-139 0.22 140-144 0.135 145-149 0.20500000000000002 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19212320121181 98.225 2 0.7321383489017925 1.4500000000000002 3 0.025246149962130777 0.075 4 0.0 0.0 5 0.050492299924261554 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.2125 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.55 0.0 0.0 0.0 0.0 80-81 0.6625000000000001 0.0 0.0 0.0 0.0 82-83 0.7875 0.0 0.0 0.0 0.0 84-85 1.0125 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.4874999999999998 0.0 0.0 0.0 0.0 90-91 1.9500000000000002 0.0 0.0 0.0 0.0 92-93 2.325 0.0 0.0 0.0 0.0 94-95 2.7125000000000004 0.0 0.0 0.0 0.0 96-97 3.2875 0.0 0.0 0.0 0.0 98-99 3.7750000000000004 0.0 0.0 0.0 0.0 100-101 4.199999999999999 0.0 0.0 0.0 0.0 102-103 4.7875 0.0 0.0 0.0 0.0 104-105 5.5375 0.0 0.0 0.0 0.0 106-107 6.275 0.0 0.0 0.0 0.0 108-109 6.8375 0.0 0.0 0.0 0.0 110-111 7.3875 0.0 0.0 0.0 0.0 112-113 7.9375 0.0 0.0 0.0 0.0 114-115 8.725000000000001 0.0 0.0 0.0 0.0 116-117 9.55 0.0 0.0 0.0 0.0 118-119 10.337499999999999 0.0 0.0 0.0 0.0 120-121 11.0375 0.0 0.0 0.0 0.0 122-123 11.875 0.0 0.0 0.0 0.0 124-125 12.7125 0.0 0.0 0.0 0.0 126-127 13.537500000000001 0.0 0.0 0.0 0.0 128-129 14.4375 0.0 0.0 0.0 0.0 130-131 15.287500000000001 0.0 0.0 0.0 0.0 132-133 16.275 0.0 0.0 0.0 0.0 134-135 17.075000000000003 0.0 0.0 0.0 0.0 136-137 18.1 0.0 0.0 0.0 0.0 138-139 18.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGACC 10 0.006830828 145.0 1 >>END_MODULE Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286630 spots for SRR5578447.sra Written 1286630 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra Read 1286617 spots for SRR5578447.sra Written 1286617 spots for SRR5578447.sra SRR ids: ['SRR5578447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vsbb5gh7 SRR5578447.sra spots: 25732353 blocks: [[1, 1286617], [1286618, 2573234], [2573235, 3859851], [3859852, 5146468], [5146469, 6433085], [6433086, 7719702], [7719703, 9006319], [9006320, 10292936], [10292937, 11579553], [11579554, 12866170], [12866171, 14152787], [14152788, 15439404], [15439405, 16726021], [16726022, 18012638], [18012639, 19299255], [19299256, 20585872], [20585873, 21872489], [21872490, 23159106], [23159107, 24445723], [24445724, 25732353]] SRR5578447 file size 8698149 SRR5578447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578447 SRR5578447_1.fastq SRR5578447_2.fastq Input file: SRR5578447_1.fastq Paired file: SRR5578447_2.fastq trimmed: SRR5578447-trimmed-pair1.fastq, SRR5578447-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:56:59 2024 >> started Mon Dec 9 17:57:32 2024 >> done (32.229s) 25732353 read pairs processed; of these: 57058 ( 0.22%) short read pairs filtered out after trimming by size control 50227 ( 0.20%) empty read pairs filtered out after trimming by size control 25625068 (99.58%) read pairs available; of these: 15939303 (62.20%) trimmed read pairs available after processing 9685765 (37.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 19 0.00% 20 23 0.00% 21 26 0.00% 22 24 0.00% 23 27 0.00% 24 39 0.00% 25 27 0.00% 26 33 0.00% 27 27 0.00% 28 38 0.00% 29 46 0.00% 30 49 0.00% 31 49 0.00% 32 53 0.00% 33 54 0.00% 34 61 0.00% 35 76 0.00% 36 81 0.00% 37 99 0.00% 38 101 0.00% 39 124 0.00% 40 157 0.00% 41 154 0.00% 42 184 0.00% 43 199 0.00% 44 229 0.00% 45 249 0.00% 46 248 0.00% 47 328 0.00% 48 391 0.00% 49 457 0.00% 50 521 0.00% 51 673 0.00% 52 721 0.00% 53 798 0.00% 54 873 0.00% 55 970 0.00% 56 1093 0.00% 57 1227 0.00% 58 1459 0.01% 59 1641 0.01% 60 1977 0.01% 61 2302 0.01% 62 2569 0.01% 63 3056 0.01% 64 3321 0.01% 65 3753 0.01% 66 4299 0.02% 67 4962 0.02% 68 5856 0.02% 69 7447 0.03% 70 7945 0.03% 71 8526 0.03% 72 9696 0.04% 73 11062 0.04% 74 12235 0.05% 75 13434 0.05% 76 14990 0.06% 77 15957 0.06% 78 17977 0.07% 79 20172 0.08% 80 22080 0.09% 81 25031 0.10% 82 28267 0.11% 83 31091 0.12% 84 35683 0.14% 85 38841 0.15% 86 40577 0.16% 87 42385 0.17% 88 45618 0.18% 89 47625 0.19% 90 50800 0.20% 91 54385 0.21% 92 58383 0.23% 93 62044 0.24% 94 66118 0.26% 95 68081 0.27% 96 70881 0.28% 97 73971 0.29% 98 74716 0.29% 99 78632 0.31% 100 81949 0.32% 101 85078 0.33% 102 88621 0.35% 103 92840 0.36% 104 95678 0.37% 105 98249 0.38% 106 101805 0.40% 107 102348 0.40% 108 104192 0.41% 109 107574 0.42% 110 108375 0.42% 111 111981 0.44% 112 116064 0.45% 113 118381 0.46% 114 122137 0.48% 115 125407 0.49% 116 126492 0.49% 117 129390 0.50% 118 128993 0.50% 119 130007 0.51% 120 132583 0.52% 121 134119 0.52% 122 135748 0.53% 123 140313 0.55% 124 144037 0.56% 125 145630 0.57% 126 148967 0.58% 127 149596 0.58% 128 149580 0.58% 129 152046 0.59% 130 153592 0.60% 131 154383 0.60% 132 159282 0.62% 133 162614 0.63% 134 165304 0.65% 135 169636 0.66% 136 174256 0.68% 137 177274 0.69% 138 182850 0.71% 139 189665 0.74% 140 195831 0.76% 141 205647 0.80% 142 220952 0.86% 143 237104 0.93% 144 263282 1.03% 145 300393 1.17% 146 355411 1.39% 147 457369 1.78% 148 659245 2.57% 149 1227046 4.79% 150 5319581 20.76% 151 9685765 37.80% 25625068 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=46.43 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.4 sequence=TGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAATCCGGCAAGGCATAAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCAGCTCAGTTTTGTCAACTCTGACATTGCTTTGAGTTTTCTATTTTTCATCCCCAAGATTGTTGTTGTGTGTAGCAACCTGGCTCTCGATCGAGGAGCTAGCTTGCATATGTGAATTCCTAAAAGTTTGAAAGAGTTGAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=129.90 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=19.3 sequence=GCCGCCGCCGCC SRR5578447 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:58:28 Started mapping on | Dec 09 17:58:28 Finished on | Dec 09 18:01:42 Mapping speed, Million of reads per hour | 475.52 Number of input reads | 25625068 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 24070208 Uniquely mapped reads % | 93.93% Average mapped length | 281.85 Number of splices: Total | 24153003 Number of splices: Annotated (sjdb) | 22659882 Number of splices: GT/AG | 23834098 Number of splices: GC/AG | 288765 Number of splices: AT/AC | 12054 Number of splices: Non-canonical | 18086 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355675 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 48655 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1227584 1227584 1227584 N_multimapping 355675 355675 355675 N_noFeature 979881 23373340 1242217 N_ambiguous 525103 3583 90905 UnstrandedReadsAssigned:22565224 PositiveStrandReadsAssigned:693285 NegativeStrandReadsAssigned:22737086 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=133 echo kmer=129 SRR5578447 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578447-trimmed-pair1.fastq SRR5578447-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,625,068 reads, 22,917,575 reads pseudoaligned [quant] estimated average fragment length: 220.195 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52973 SRR5578447.ke.tsv 35125 SRR5578447.se.tsv 88098 total ==> SRR5578447.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.105 0 0 PNS24247 1044 824.805 73.9555 5.71711 PNS24249 1928 1708.81 141.326 5.27337 PNS24246 1044 824.805 73.9555 5.71711 PNS24248 1044 824.805 73.9555 5.71711 PNS24244 1471 1251.81 130.807 6.66272 PNS24243 293 119.341 0 0 KQK14069 1603 1383.81 4852.72 223.598 KQK14071 474 268.996 165.528 39.2359 ==> SRR5578447.se.tsv <== BRADI_1g14170v3 5473 BRADI_1g53295v3 218 BRADI_1g59795v3 516 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 2629 BRADI_1g74790v3 248 BRADI_1g09890v3 5 BRADI_1g77505v3 431 BRADI_1g48960v3 0 SRR5578447 completed mapping pipeline successfully