Starting /dee2/code/volunteer_pipeline.sh SRR5578448 current disk space = 1523731226624 free memory = 1580394864 SRR5578448 SRAfilesize 2dd76c96d3a3ac839bdfaf8e7bf52399 SRR5578448.sra SRR5578448.sra file validated SRR5578448 is paired end SRR5578448 is conventional basespace SRR5578448 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.79825 34.0 33.0 34.0 32.0 34.0 2 33.084 34.0 33.0 34.0 32.0 34.0 3 33.22275 34.0 33.0 34.0 32.0 34.0 4 33.2605 34.0 33.0 34.0 32.0 34.0 5 33.376 34.0 33.0 34.0 33.0 34.0 6 36.98725 38.0 37.0 38.0 36.0 38.0 7 37.26 38.0 38.0 38.0 36.0 38.0 8 37.3895 38.0 38.0 38.0 37.0 38.0 9 37.5035 38.0 38.0 38.0 37.0 38.0 10-14 37.4988 38.0 38.0 38.0 37.6 38.0 15-19 37.5523 38.0 38.0 38.0 38.0 38.0 20-24 37.50315 38.0 38.0 38.0 38.0 38.0 25-29 37.452450000000006 38.0 38.0 38.0 37.6 38.0 30-34 37.4202 38.0 38.0 38.0 37.2 38.0 35-39 37.44305 38.0 38.0 38.0 37.4 38.0 40-44 37.29875 38.0 38.0 38.0 36.8 38.0 45-49 37.26535 38.0 38.0 38.0 37.0 38.0 50-54 37.24055 38.0 38.0 38.0 36.4 38.0 55-59 37.1656 38.0 38.0 38.0 36.0 38.0 60-64 37.098400000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.0283 38.0 38.0 38.0 36.0 38.0 70-74 36.898199999999996 38.0 38.0 38.0 35.2 38.0 75-79 36.7511 38.0 38.0 38.0 35.0 38.0 80-84 36.68205 38.0 38.0 38.0 34.6 38.0 85-89 36.52915 38.0 38.0 38.0 34.0 38.0 90-94 36.44995 38.0 38.0 38.0 34.0 38.0 95-99 36.38885 38.0 38.0 38.0 34.0 38.0 100-104 36.167950000000005 38.0 38.0 38.0 33.2 38.0 105-109 36.02745 38.0 37.0 38.0 33.0 38.0 110-114 35.838049999999996 38.0 36.8 38.0 32.6 38.0 115-119 35.6269 38.0 36.4 38.0 31.6 38.0 120-124 35.15915 38.0 35.8 38.0 29.6 38.0 125-129 35.171299999999995 38.0 35.6 38.0 30.0 38.0 130-134 34.6845 38.0 35.0 38.0 27.4 38.0 135-139 34.460100000000004 38.0 35.0 38.0 26.0 38.0 140-144 33.922399999999996 38.0 34.8 38.0 23.2 38.0 145-149 33.080650000000006 38.0 34.0 38.0 18.2 38.0 150-151 28.990875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 4.0 16 6.0 17 4.0 18 4.0 19 5.0 20 5.0 21 9.0 22 3.0 23 7.0 24 9.0 25 19.0 26 19.0 27 23.0 28 26.0 29 29.0 30 49.0 31 50.0 32 74.0 33 100.0 34 167.0 35 300.0 36 755.0 37 2329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.64896134630555 9.992111490928215 5.8112016828819355 39.5477254798843 2 22.5 14.274999999999999 35.5 27.725 3 22.05551387846962 17.95448862215554 22.18054513628407 37.80945236309077 4 28.499999999999996 25.45 19.400000000000002 26.650000000000002 5 25.674999999999997 31.45 21.8 21.075 6 22.0 32.05 24.8 21.15 7 18.75 20.424999999999997 39.95 20.875 8 20.9 20.325 31.125000000000004 27.650000000000002 9 20.549999999999997 19.475 32.7 27.275 10-14 23.925 25.629999999999995 24.585 25.86 15-19 23.24 23.995 25.735000000000003 27.029999999999998 20-24 23.849999999999998 24.995 25.215 25.94 25-29 23.575 24.11 25.455 26.86 30-34 23.895 24.44 25.430000000000003 26.235000000000003 35-39 23.165 23.965 26.064999999999998 26.805 40-44 23.925 23.36 26.229999999999997 26.484999999999996 45-49 22.475 23.84 26.345000000000002 27.339999999999996 50-54 23.369999999999997 23.84 25.650000000000002 27.139999999999997 55-59 23.39 24.365000000000002 25.275 26.97 60-64 23.474999999999998 23.18 26.055 27.29 65-69 23.995 24.34 25.035 26.63 70-74 23.995 24.295 24.86 26.85 75-79 24.22 24.215 25.355 26.21 80-84 23.715 24.38 25.34 26.565 85-89 24.195 24.104999999999997 24.915000000000003 26.784999999999997 90-94 24.38 24.654999999999998 24.58 26.384999999999998 95-99 24.585 23.56 25.174999999999997 26.68 100-104 24.83 24.310000000000002 24.235 26.625 105-109 24.315 24.365000000000002 24.505 26.815 110-114 24.745 24.575 24.545 26.135 115-119 24.88 24.51 24.01 26.6 120-124 24.19 24.945 24.240000000000002 26.625 125-129 24.915000000000003 25.074999999999996 23.35 26.66 130-134 23.825 24.205 24.75 27.22 135-139 24.165 24.779999999999998 23.735 27.32 140-144 24.38 24.695 23.97 26.955000000000002 145-149 23.935000000000002 25.369999999999997 23.810000000000002 26.884999999999998 150-151 23.7125 25.25 23.9875 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.0 28 4.0 29 6.5 30 10.0 31 11.5 32 10.5 33 17.0 34 27.0 35 28.0 36 36.5 37 53.0 38 63.0 39 89.0 40 120.0 41 140.5 42 142.5 43 137.5 44 148.5 45 170.5 46 184.0 47 174.5 48 165.0 49 170.5 50 176.0 51 167.0 52 157.0 53 142.5 54 123.0 55 127.5 56 129.0 57 111.5 58 103.5 59 90.5 60 83.0 61 70.5 62 59.0 63 57.0 64 51.0 65 55.0 66 47.5 67 42.0 68 46.0 69 39.5 70 41.0 71 40.5 72 31.5 73 22.5 74 15.5 75 16.5 76 15.5 77 8.5 78 4.5 79 5.0 80 3.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.925 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.55 #Duplication Level Percentage of deduplicated Percentage of total 1 96.53622421998942 91.27499999999999 2 2.538339502908514 4.8 3 0.4494976203067161 1.275 4 0.23796932839767318 0.8999999999999999 5 0.07932310946589106 0.375 6 0.0 0.0 7 0.026441036488630353 0.17500000000000002 8 0.052882072977260705 0.4 9 0.026441036488630353 0.22499999999999998 >10 0.052882072977260705 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 13 0.325 No Hit GTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTGAC 10 0.25 No Hit GTCGTCTGCAAAGGATTCAGCCCGCCGCCCGTGGGGAAGGGAGCTTCGAG 9 0.22499999999999998 No Hit GGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGC 8 0.2 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 8 0.2 No Hit CGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTT 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACTTGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) CCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCT 5 0.125 No Hit CATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.8 0.0 0.0 0.0 0.0 100-101 2.0125 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.725 0.0 0.0 0.0 0.0 106-107 3.0250000000000004 0.0 0.0 0.0 0.0 108-109 3.5375 0.0 0.0 0.0 0.0 110-111 3.9625 0.0 0.0 0.0 0.0 112-113 4.550000000000001 0.0 0.0 0.0 0.0 114-115 5.0375 0.0 0.0 0.0 0.0 116-117 5.475 0.0 0.0 0.0 0.0 118-119 6.0125 0.0 0.0 0.0 0.0 120-121 6.6625 0.0 0.0 0.0 0.0 122-123 7.4 0.0 0.0 0.0 0.0 124-125 8.0625 0.0 0.0 0.0 0.0 126-127 8.8 0.0 0.0 0.0 0.0 128-129 9.4875 0.0 0.0 0.0 0.0 130-131 10.1 0.0 0.0 0.0 0.0 132-133 10.6125 0.0 0.0 0.0 0.0 134-135 11.4875 0.0 0.0 0.0 0.0 136-137 12.25 0.0 0.0 0.0 0.0 138-139 13.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATTCT 10 0.0060887975 150.61038 1 GGCGTCG 10 0.006836113 144.9625 9 GATGCTG 10 0.006836113 144.9625 6 ATGCTGC 10 0.006836113 144.9625 7 AAAAAAA 55 0.002520421 26.356817 145 >>END_MODULE SRR5578448 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.887 33.0 33.0 34.0 32.0 34.0 2 33.02525 33.0 33.0 34.0 32.0 34.0 3 32.945 34.0 33.0 34.0 32.0 34.0 4 32.9195 34.0 33.0 34.0 32.0 34.0 5 32.96025 34.0 33.0 34.0 32.0 34.0 6 37.049 38.0 38.0 38.0 36.0 38.0 7 37.10075 38.0 38.0 38.0 37.0 38.0 8 37.08725 38.0 38.0 38.0 37.0 38.0 9 37.0355 38.0 38.0 38.0 36.0 38.0 10-14 37.09395 38.0 38.0 38.0 36.4 38.0 15-19 37.04745 38.0 38.0 38.0 36.2 38.0 20-24 37.054700000000004 38.0 38.0 38.0 36.6 38.0 25-29 37.055600000000005 38.0 38.0 38.0 36.4 38.0 30-34 37.07170000000001 38.0 38.0 38.0 36.4 38.0 35-39 37.07340000000001 38.0 38.0 38.0 36.6 38.0 40-44 37.08015 38.0 38.0 38.0 36.4 38.0 45-49 37.020500000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.94205 38.0 38.0 38.0 36.0 38.0 55-59 36.8859 38.0 38.0 38.0 36.0 38.0 60-64 36.811899999999994 38.0 38.0 38.0 35.2 38.0 65-69 36.72815 38.0 38.0 38.0 35.0 38.0 70-74 36.569050000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.55200000000001 38.0 38.0 38.0 34.6 38.0 80-84 36.54065 38.0 38.0 38.0 34.2 38.0 85-89 36.3692 38.0 38.0 38.0 34.0 38.0 90-94 36.269 38.0 38.0 38.0 34.0 38.0 95-99 36.0883 38.0 38.0 38.0 33.6 38.0 100-104 35.8414 38.0 37.4 38.0 32.6 38.0 105-109 35.649350000000005 38.0 37.2 38.0 31.6 38.0 110-114 35.53845 38.0 36.8 38.0 31.6 38.0 115-119 35.371300000000005 38.0 36.4 38.0 31.0 38.0 120-124 34.9267 38.0 35.6 38.0 28.4 38.0 125-129 34.63935 38.0 35.2 38.0 26.4 38.0 130-134 34.161950000000004 38.0 34.2 38.0 24.2 38.0 135-139 33.4651 38.0 33.4 38.0 20.6 38.0 140-144 32.77755 38.0 33.0 38.0 13.0 38.0 145-149 31.598399999999998 38.0 31.4 38.0 8.0 38.0 150-151 26.294625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 2.0 6 1.0 7 0.0 8 1.0 9 1.0 10 3.0 11 1.0 12 4.0 13 2.0 14 6.0 15 2.0 16 4.0 17 8.0 18 9.0 19 13.0 20 11.0 21 5.0 22 12.0 23 11.0 24 17.0 25 18.0 26 15.0 27 34.0 28 43.0 29 28.0 30 52.0 31 76.0 32 78.0 33 129.0 34 185.0 35 288.0 36 719.0 37 2216.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.050000000000004 14.625 8.225 32.1 2 28.925 22.900000000000002 28.1 20.075000000000003 3 24.55 25.2 23.95 26.3 4 28.4 30.625000000000004 17.875 23.1 5 27.775 34.0 19.15 19.075 6 24.075 36.025 19.3 20.599999999999998 7 23.724999999999998 18.45 34.25 23.575 8 24.4 21.3 23.849999999999998 30.45 9 25.275 21.6 27.800000000000004 25.324999999999996 10-14 26.919999999999998 25.695 22.375 25.009999999999998 15-19 27.650000000000002 25.055 23.400000000000002 23.895 20-24 26.375 25.715 23.580000000000002 24.33 25-29 26.775 25.465 23.385 24.375 30-34 26.465 25.945 23.25 24.34 35-39 25.979999999999997 25.645 23.04 25.335 40-44 27.13 24.93 23.294999999999998 24.645 45-49 26.834999999999997 24.725 23.97 24.47 50-54 26.365 25.465 23.56 24.610000000000003 55-59 26.795 25.5 23.11 24.595 60-64 27.195000000000004 24.605 23.635 24.565 65-69 27.35 25.03 23.195 24.425 70-74 27.48 24.605 23.29 24.625 75-79 26.974999999999998 24.89 23.235 24.9 80-84 26.784999999999997 25.040000000000003 23.544999999999998 24.63 85-89 26.965 24.665 23.93 24.44 90-94 26.6 24.9 23.82 24.68 95-99 27.24 24.765 23.655 24.34 100-104 26.674999999999997 25.27 23.865 24.19 105-109 27.615000000000002 24.490000000000002 24.12 23.775 110-114 27.99 25.924999999999997 22.745 23.34 115-119 27.810000000000002 25.019999999999996 23.305 23.865 120-124 27.79 25.740000000000002 23.115 23.355 125-129 27.905 25.135 23.715 23.244999999999997 130-134 28.144999999999996 25.535000000000004 22.855 23.465 135-139 28.804999999999996 24.815 23.585 22.795 140-144 28.785 25.595000000000002 23.285 22.335 145-149 29.134999999999998 25.95 22.400000000000002 22.515 150-151 28.9125 26.375 22.6125 22.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 3.0 28 4.5 29 3.5 30 4.0 31 8.5 32 11.5 33 14.5 34 16.5 35 28.0 36 37.5 37 44.0 38 70.5 39 100.5 40 101.5 41 111.0 42 135.0 43 144.5 44 152.5 45 157.0 46 158.5 47 157.5 48 157.0 49 158.0 50 165.0 51 163.0 52 141.5 53 132.0 54 136.0 55 131.5 56 123.0 57 116.5 58 107.5 59 96.0 60 78.5 61 79.0 62 79.5 63 65.5 64 60.5 65 62.5 66 62.0 67 59.0 68 62.5 69 47.0 70 39.5 71 50.0 72 47.0 73 32.5 74 23.0 75 17.5 76 9.5 77 8.5 78 10.5 79 6.5 80 3.0 81 1.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.2381448671183 93.30000000000001 2 2.1625846795205836 4.15 3 0.3126628452318916 0.8999999999999999 4 0.1563314226159458 0.6 5 0.02605523710265763 0.125 6 0.02605523710265763 0.15 7 0.0 0.0 8 0.02605523710265763 0.2 9 0.0 0.0 >10 0.05211047420531526 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGA 12 0.3 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 11 0.27499999999999997 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 8 0.2 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit GGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAAACT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.75 0.0 0.0 0.0 0.0 106-107 3.05 0.0 0.0 0.0 0.0 108-109 3.5375 0.0 0.0 0.0 0.0 110-111 3.9625 0.0 0.0 0.0 0.0 112-113 4.550000000000001 0.0 0.0 0.0 0.0 114-115 5.0375 0.0 0.0 0.0 0.0 116-117 5.475 0.0 0.0 0.0 0.0 118-119 6.0125 0.0 0.0 0.0 0.0 120-121 6.612500000000001 0.0 0.0 0.0 0.0 122-123 7.35 0.0 0.0 0.0 0.0 124-125 8.0125 0.0 0.0 0.0 0.0 126-127 8.7125 0.0 0.0 0.0 0.0 128-129 9.3875 0.0 0.0 0.0 0.0 130-131 10.037500000000001 0.0 0.0 0.0 0.0 132-133 10.575 0.0 0.0 0.0 0.0 134-135 11.4375 0.0 0.0 0.0 0.0 136-137 12.2 0.0 0.0 0.0 0.0 138-139 13.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGCAC 10 0.006830828 145.0 8 GAGATCG 30 0.0014437955 24.166668 135-139 AAAAAAA 35 0.0035366106 20.714287 140-144 >>END_MODULE Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306773 spots for SRR5578448.sra Written 1306773 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra Read 1306763 spots for SRR5578448.sra Written 1306763 spots for SRR5578448.sra SRR ids: ['SRR5578448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i9m1nuc6 SRR5578448.sra spots: 26135270 blocks: [[1, 1306763], [1306764, 2613526], [2613527, 3920289], [3920290, 5227052], [5227053, 6533815], [6533816, 7840578], [7840579, 9147341], [9147342, 10454104], [10454105, 11760867], [11760868, 13067630], [13067631, 14374393], [14374394, 15681156], [15681157, 16987919], [16987920, 18294682], [18294683, 19601445], [19601446, 20908208], [20908209, 22214971], [22214972, 23521734], [23521735, 24828497], [24828498, 26135270]] SRR5578448 file size 8834685 SRR5578448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578448 SRR5578448_1.fastq SRR5578448_2.fastq Input file: SRR5578448_1.fastq Paired file: SRR5578448_2.fastq trimmed: SRR5578448-trimmed-pair1.fastq, SRR5578448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 17:58:11 2024 >> started Mon Dec 9 17:58:41 2024 >> done (29.178s) 26135270 read pairs processed; of these: 22176 ( 0.08%) short read pairs filtered out after trimming by size control 36166 ( 0.14%) empty read pairs filtered out after trimming by size control 26076928 (99.78%) read pairs available; of these: 14287507 (54.79%) trimmed read pairs available after processing 11789421 (45.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 26 0.00% 20 25 0.00% 21 14 0.00% 22 13 0.00% 23 25 0.00% 24 24 0.00% 25 30 0.00% 26 23 0.00% 27 38 0.00% 28 37 0.00% 29 29 0.00% 30 32 0.00% 31 31 0.00% 32 44 0.00% 33 51 0.00% 34 48 0.00% 35 66 0.00% 36 61 0.00% 37 64 0.00% 38 84 0.00% 39 99 0.00% 40 97 0.00% 41 113 0.00% 42 129 0.00% 43 133 0.00% 44 153 0.00% 45 157 0.00% 46 182 0.00% 47 196 0.00% 48 232 0.00% 49 280 0.00% 50 283 0.00% 51 351 0.00% 52 379 0.00% 53 387 0.00% 54 469 0.00% 55 495 0.00% 56 582 0.00% 57 623 0.00% 58 689 0.00% 59 858 0.00% 60 848 0.00% 61 1047 0.00% 62 1192 0.00% 63 1315 0.01% 64 1549 0.01% 65 1668 0.01% 66 1890 0.01% 67 2227 0.01% 68 2492 0.01% 69 2922 0.01% 70 3226 0.01% 71 3466 0.01% 72 4056 0.02% 73 4563 0.02% 74 5071 0.02% 75 5633 0.02% 76 6440 0.02% 77 7095 0.03% 78 7851 0.03% 79 8913 0.03% 80 9995 0.04% 81 11027 0.04% 82 12491 0.05% 83 13829 0.05% 84 15868 0.06% 85 18091 0.07% 86 18876 0.07% 87 20359 0.08% 88 22141 0.08% 89 23640 0.09% 90 25027 0.10% 91 27767 0.11% 92 29618 0.11% 93 31872 0.12% 94 33417 0.13% 95 36805 0.14% 96 38003 0.15% 97 40572 0.16% 98 42220 0.16% 99 44819 0.17% 100 47363 0.18% 101 49577 0.19% 102 51431 0.20% 103 54560 0.21% 104 56691 0.22% 105 57687 0.22% 106 61447 0.24% 107 63942 0.25% 108 65700 0.25% 109 69117 0.27% 110 70530 0.27% 111 74396 0.29% 112 78005 0.30% 113 78856 0.30% 114 81736 0.31% 115 86028 0.33% 116 88212 0.34% 117 90207 0.35% 118 91249 0.35% 119 94393 0.36% 120 98328 0.38% 121 100839 0.39% 122 104244 0.40% 123 108177 0.41% 124 110648 0.42% 125 113513 0.44% 126 117235 0.45% 127 119383 0.46% 128 120101 0.46% 129 125846 0.48% 130 126446 0.48% 131 130166 0.50% 132 133689 0.51% 133 138337 0.53% 134 142369 0.55% 135 146673 0.56% 136 153365 0.59% 137 156399 0.60% 138 163751 0.63% 139 171377 0.66% 140 178520 0.68% 141 193418 0.74% 142 207141 0.79% 143 222676 0.85% 144 251216 0.96% 145 284853 1.09% 146 341242 1.31% 147 444223 1.70% 148 640041 2.45% 149 1223744 4.69% 150 5710849 21.90% 151 11789421 45.21% 26076928 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.82 prefix-fanout=2.0 sequence=CCCACTTGGAGCTCCCGATTCCATGGCGCGGCTCACCGGAGCAGCCGCGCCGTCCTACCTATTTAAAGTTTGAGAATAGGTCGAGGGCGTTGCGCCCCCGATGCCTCTAATCATTGGCTTTACCTGATAGAACTCGTAATGGGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGTCAGTATCGCTTCGAGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGTTCACCATCTTTCGGGTCCCGACAGGCGTGCTCCAACTCGAACCCTTCACAGAAGATCAGGGTCGGCCAGCGGTGCGGCCCGTGAGGGCCTCCCGCTCGTCAGCTTCCTTGCGCATCCCAGGTTTCAGAACCCGTCGACTCGCACGCATGTCAGACTCCTTGGTCCGTGTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=35 fanout-score=14.42 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=2.2 sequence=CCAGCTCACGTACCGCATTAATGGGCGAACAGCCCAACCCTTGGAACCACCTACAGCTCCAGGTGGCGAAGAGCCGAC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=30 prefix-density=0.45 prefix-fanout=1.9 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=75.70 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578448 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 17:59:29 Started mapping on | Dec 09 17:59:29 Finished on | Dec 09 18:02:45 Mapping speed, Million of reads per hour | 478.96 Number of input reads | 26076928 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 20389695 Uniquely mapped reads % | 78.19% Average mapped length | 288.62 Number of splices: Total | 21120951 Number of splices: Annotated (sjdb) | 19839933 Number of splices: GT/AG | 20829672 Number of splices: GC/AG | 259757 Number of splices: AT/AC | 11429 Number of splices: Non-canonical | 20093 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1263938 % of reads mapped to multiple loci | 4.85% Number of reads mapped to too many loci | 547382 % of reads mapped to too many loci | 2.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 11.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4438851 4438851 4438851 N_multimapping 1263938 1263938 1263938 N_noFeature 1517784 19821272 1718241 N_ambiguous 457490 3165 90478 UnstrandedReadsAssigned:18414421 PositiveStrandReadsAssigned:565258 NegativeStrandReadsAssigned:18580976 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR5578448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578448-trimmed-pair1.fastq SRR5578448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,076,928 reads, 19,167,074 reads pseudoaligned [quant] estimated average fragment length: 230.377 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR5578448.ke.tsv 35125 SRR5578448.se.tsv 88098 total ==> SRR5578448.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.035 0 0 PNS24247 1044 814.623 42.995 3.78355 PNS24249 1928 1698.62 119.609 5.04785 PNS24246 1044 814.623 42.995 3.78355 PNS24248 1044 814.623 42.995 3.78355 PNS24244 1471 1241.62 83.4057 4.81553 PNS24243 293 109.403 1 0.655255 KQK14069 1603 1373.62 5990.71 312.643 KQK14071 474 260.853 219.497 60.3214 ==> SRR5578448.se.tsv <== BRADI_1g14170v3 7048 BRADI_1g53295v3 140 BRADI_1g59795v3 457 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 2543 BRADI_1g74790v3 204 BRADI_1g09890v3 0 BRADI_1g77505v3 366 BRADI_1g48960v3 0 SRR5578448 completed mapping pipeline successfully