Starting /dee2/code/volunteer_pipeline.sh SRR5578452 current disk space = 1523240333312 free memory = 1580361788 SRR5578452 SRAfilesize 8511b371252fad3839e29e150028ec4f SRR5578452.sra SRR5578452.sra file validated SRR5578452 is paired end SRR5578452 is conventional basespace SRR5578452 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578452_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.23225 34.0 33.0 34.0 33.0 34.0 2 33.45825 34.0 34.0 34.0 33.0 34.0 3 33.5 34.0 34.0 34.0 33.0 34.0 4 33.47425 34.0 34.0 34.0 33.0 34.0 5 33.48175 34.0 34.0 34.0 33.0 34.0 6 37.17075 38.0 38.0 38.0 36.0 38.0 7 37.3785 38.0 38.0 38.0 37.0 38.0 8 37.46725 38.0 38.0 38.0 37.0 38.0 9 37.465 38.0 38.0 38.0 37.0 38.0 10-14 37.460499999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.522400000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.485400000000006 38.0 38.0 38.0 37.6 38.0 25-29 37.45890000000001 38.0 38.0 38.0 37.4 38.0 30-34 37.470150000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.48355 38.0 38.0 38.0 37.8 38.0 40-44 37.4095 38.0 38.0 38.0 37.0 38.0 45-49 37.337199999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.35305 38.0 38.0 38.0 37.0 38.0 55-59 37.320100000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.2959 38.0 38.0 38.0 37.0 38.0 65-69 37.3092 38.0 38.0 38.0 37.0 38.0 70-74 37.229200000000006 38.0 38.0 38.0 36.6 38.0 75-79 37.200849999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.1212 38.0 38.0 38.0 36.2 38.0 85-89 37.05845 38.0 38.0 38.0 36.0 38.0 90-94 36.9888 38.0 38.0 38.0 36.0 38.0 95-99 36.9442 38.0 38.0 38.0 35.6 38.0 100-104 36.899649999999994 38.0 38.0 38.0 35.4 38.0 105-109 36.81085 38.0 38.0 38.0 35.0 38.0 110-114 36.6992 38.0 38.0 38.0 35.0 38.0 115-119 36.5464 38.0 38.0 38.0 34.4 38.0 120-124 36.47305 38.0 38.0 38.0 34.2 38.0 125-129 36.31785 38.0 38.0 38.0 34.0 38.0 130-134 36.0544 38.0 38.0 38.0 33.4 38.0 135-139 35.921800000000005 38.0 38.0 38.0 33.0 38.0 140-144 35.57505 38.0 36.8 38.0 31.4 38.0 145-149 35.07000000000001 38.0 36.0 38.0 30.6 38.0 150-151 31.327875 35.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 0.0 16 1.0 17 2.0 18 3.0 19 1.0 20 5.0 21 4.0 22 4.0 23 3.0 24 2.0 25 13.0 26 14.0 27 16.0 28 18.0 29 24.0 30 27.0 31 36.0 32 63.0 33 77.0 34 109.0 35 166.0 36 395.0 37 3012.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.24389630002517 10.697206141454819 7.903347596274855 34.15554996224516 2 24.95 14.374999999999998 32.324999999999996 28.349999999999998 3 22.95 19.55 24.85 32.65 4 27.6 27.250000000000004 21.575 23.575 5 25.7 32.625 21.825 19.85 6 20.549999999999997 33.25 24.425 21.775 7 17.75 22.35 39.050000000000004 20.849999999999998 8 19.75 23.849999999999998 28.849999999999998 27.55 9 19.725 21.55 33.300000000000004 25.424999999999997 10-14 22.66 27.279999999999998 25.695 24.365000000000002 15-19 22.99 25.865 26.07 25.074999999999996 20-24 22.505 26.005 26.56 24.93 25-29 23.415 25.89 26.02 24.675 30-34 22.35 25.650000000000002 26.69 25.31 35-39 23.25 25.96 25.435000000000002 25.355 40-44 23.18 26.295 25.759999999999998 24.765 45-49 23.035 26.025 25.455 25.485000000000003 50-54 23.335 25.66 25.869999999999997 25.135 55-59 22.765 26.369999999999997 25.71 25.155 60-64 22.82 26.02 25.705 25.455 65-69 23.095 26.119999999999997 25.465 25.319999999999997 70-74 23.630000000000003 25.505 25.575 25.290000000000003 75-79 22.805 25.75 26.265 25.180000000000003 80-84 23.46 26.290000000000003 25.255 24.995 85-89 23.885 25.485000000000003 25.805 24.825 90-94 23.605 25.91 25.025 25.46 95-99 23.294999999999998 25.89 25.47 25.345000000000002 100-104 23.080000000000002 25.645 25.669999999999998 25.605 105-109 24.63 25.61 25.259999999999998 24.5 110-114 23.455000000000002 25.835 24.935 25.775 115-119 23.385 25.455 25.955000000000002 25.205 120-124 23.425 25.624999999999996 25.124999999999996 25.825 125-129 23.895 25.735000000000003 24.945 25.424999999999997 130-134 23.965 25.919999999999998 24.845 25.27 135-139 23.74 25.740000000000002 24.9 25.619999999999997 140-144 23.785 25.729999999999997 24.745 25.740000000000002 145-149 23.505000000000003 26.240000000000002 24.67 25.585 150-151 23.4875 24.65 25.087500000000002 26.775 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.0 27 1.0 28 4.5 29 6.0 30 9.0 31 13.5 32 14.5 33 20.5 34 31.0 35 46.0 36 60.5 37 77.0 38 94.0 39 111.5 40 137.5 41 159.0 42 182.5 43 192.5 44 196.0 45 196.5 46 191.0 47 197.5 48 182.5 49 180.0 50 182.0 51 159.0 52 138.0 53 128.0 54 121.0 55 98.5 56 88.5 57 84.0 58 71.5 59 62.0 60 62.5 61 71.0 62 59.0 63 45.5 64 49.5 65 46.0 66 40.5 67 34.5 68 30.5 69 27.5 70 22.0 71 20.0 72 16.5 73 12.0 74 7.0 75 5.0 76 4.5 77 3.0 78 1.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70656860258687 97.3 2 1.1919857976160284 2.35 3 0.050722799898554397 0.15 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.875 0.0 0.0 0.0 0.0 102-103 2.0250000000000004 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.6125 0.0 0.0 0.0 0.0 114-115 4.112500000000001 0.0 0.0 0.0 0.0 116-117 4.5125 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.45 0.0 0.0 0.0 0.0 122-123 6.075 0.0 0.0 0.0 0.0 124-125 6.6875 0.0 0.0 0.0 0.0 126-127 7.375 0.0 0.0 0.0 0.0 128-129 7.949999999999999 0.0 0.0 0.0 0.0 130-131 8.712499999999999 0.0 0.0 0.0 0.0 132-133 9.6625 0.0 0.0 0.0 0.0 134-135 10.475000000000001 0.0 0.0 0.0 0.0 136-137 11.2875 0.0 0.0 0.0 0.0 138-139 12.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578452 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578452_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0825 33.0 33.0 33.0 31.0 34.0 2 32.14675 33.0 33.0 34.0 31.0 34.0 3 32.07975 33.0 33.0 34.0 29.0 34.0 4 32.151 33.0 33.0 34.0 31.0 34.0 5 31.93 33.0 33.0 34.0 29.0 34.0 6 36.0125 38.0 38.0 38.0 32.0 38.0 7 35.956 38.0 37.0 38.0 31.0 38.0 8 36.0255 38.0 37.0 38.0 33.0 38.0 9 35.9765 38.0 38.0 38.0 32.0 38.0 10-14 36.0144 38.0 37.8 38.0 33.0 38.0 15-19 35.8412 38.0 37.0 38.0 31.2 38.0 20-24 35.7331 38.0 37.0 38.0 30.4 38.0 25-29 35.59105 38.0 37.0 38.0 29.4 38.0 30-34 35.4464 38.0 37.0 38.0 29.0 38.0 35-39 35.302499999999995 38.0 37.0 38.0 28.8 38.0 40-44 35.15625 38.0 36.0 38.0 28.4 38.0 45-49 34.8765 38.0 36.0 38.0 27.2 38.0 50-54 34.6539 38.0 35.6 38.0 27.0 38.0 55-59 34.25935 38.0 34.8 38.0 24.8 38.0 60-64 34.0939 38.0 34.4 38.0 24.4 38.0 65-69 33.70795 38.0 34.0 38.0 16.0 38.0 70-74 33.267 38.0 33.4 38.0 16.0 38.0 75-79 32.845099999999995 37.6 32.4 38.0 16.0 38.0 80-84 32.29725 37.0 31.0 38.0 15.0 38.0 85-89 31.83005 37.0 29.8 38.0 15.0 38.0 90-94 31.296250000000004 36.6 28.4 38.0 14.8 38.0 95-99 30.39705 36.0 26.4 38.0 14.2 38.0 100-104 29.591450000000002 35.0 24.2 38.0 13.2 38.0 105-109 28.959799999999994 35.0 22.6 38.0 10.8 38.0 110-114 27.79465 34.0 16.2 38.0 2.0 38.0 115-119 26.7454 34.0 15.0 38.0 2.0 38.0 120-124 25.585699999999996 33.0 14.6 37.6 2.0 38.0 125-129 24.191300000000002 30.2 13.4 36.6 2.0 38.0 130-134 22.72555 27.2 8.6 36.0 2.0 38.0 135-139 21.204700000000003 24.0 2.0 35.0 2.0 38.0 140-144 19.10875 19.8 2.0 34.6 2.0 38.0 145-149 16.1935 8.8 2.0 33.6 2.0 38.0 150-151 12.267875 2.0 2.0 28.5 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 10.0 4 9.0 5 7.0 6 3.0 7 5.0 8 9.0 9 14.0 10 11.0 11 9.0 12 14.0 13 20.0 14 26.0 15 19.0 16 24.0 17 22.0 18 32.0 19 58.0 20 43.0 21 64.0 22 76.0 23 82.0 24 97.0 25 101.0 26 98.0 27 126.0 28 163.0 29 173.0 30 226.0 31 240.0 32 310.0 33 418.0 34 448.0 35 459.0 36 401.0 37 162.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.050000000000004 18.775 10.2 25.974999999999998 2 28.83941970985493 23.71185592796398 27.388694347173587 20.060030015007506 3 24.06805103827871 25.969477107830873 25.869402051538653 24.093069802351764 4 26.619964973730298 30.97322992244183 20.340255191393545 22.066549912434326 5 26.019514635976982 35.851888916687514 18.088566424818612 20.040030022516888 6 23.05 33.6 21.9 21.45 7 22.405601400350086 19.10477619404851 35.90897724431108 22.58064516129032 8 21.925 22.7 25.55 29.825000000000003 9 22.825 23.575 27.025 26.575 10-14 25.5251050210042 26.14022804560912 23.6997399479896 24.63492698539708 15-19 24.976244061015255 25.851462865716428 25.081270317579396 24.091022755688922 20-24 25.516379094773693 26.081520380095025 24.29107276819205 24.111027756939237 25-29 25.316329082270567 26.226556639159792 24.10602650662666 24.351087771942986 30-34 25.756439109777446 25.6514128532133 24.82120530132533 23.77094273568392 35-39 25.081270317579396 26.046511627906977 24.36109027256814 24.511127781945486 40-44 25.15128782195549 26.281570392598148 24.271067766941734 24.296074018504626 45-49 25.04376531786125 26.359225729005153 24.598609513329666 23.99839943980393 50-54 25.926481620405102 26.001500375093773 24.406101525381345 23.66591647911978 55-59 25.30632658164541 25.941485371342836 24.59114778694674 24.16104026006502 60-64 25.21756526958087 25.14754426327898 25.677703310993298 23.957187156146844 65-69 25.44263278983695 25.642692807842355 25.227568270481143 23.687106131839553 70-74 25.336334083520878 26.076519129782444 24.44611152788197 24.141035258814703 75-79 25.21756526958087 26.407922376713017 24.802440732219665 23.572071621486444 80-84 25.371342835708926 25.971492873218306 25.23630907726932 23.420855213803453 85-89 25.14128532133033 25.756439109777446 24.956239059764943 24.14603650912728 90-94 24.871217804451113 26.046511627906977 25.08627156789197 23.995998999749936 95-99 25.363877357074976 26.19916970939829 25.25884059420797 23.178112339318762 100-104 25.72271681504451 25.807742322696807 24.902470741222366 23.56707012103631 105-109 25.63640910227557 25.23130782695674 25.45136284071018 23.680920230057513 110-114 26.051723275473964 26.206793056875593 24.405982692211495 23.335500975438947 115-119 25.805322128851543 26.180472188875548 24.419767907162864 23.594437775110045 120-124 25.852755826748027 27.073121936580975 24.40232069620886 22.671801540462138 125-129 26.507952385715715 27.123136941082326 23.39701910573172 22.97189156747024 130-134 26.395558223289317 27.450980392156865 23.12424969987995 23.02921168467387 135-139 27.261815453863463 27.561890472618156 22.77569392348087 22.40060015003751 140-144 27.461865466366593 27.266816704176044 23.265816454113526 22.005501375343837 145-149 27.38684671167792 27.906976744186046 22.405601400350086 22.30057514378595 150-151 27.53188297074269 28.75718929732433 21.167791947987 22.543135783945985 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 1.0 26 2.0 27 2.0 28 3.5 29 6.0 30 7.5 31 12.5 32 16.5 33 15.5 34 27.0 35 40.0 36 50.0 37 63.5 38 85.0 39 100.5 40 112.0 41 143.0 42 176.0 43 187.5 44 193.0 45 214.0 46 205.0 47 179.0 48 178.0 49 188.0 50 168.0 51 138.0 52 129.0 53 109.5 54 103.5 55 102.5 56 96.0 57 95.5 58 86.5 59 82.0 60 74.5 61 64.5 62 65.5 63 69.5 64 60.0 65 49.0 66 44.5 67 37.0 68 37.0 69 35.0 70 30.5 71 30.5 72 26.5 73 18.5 74 11.0 75 7.0 76 5.0 77 4.0 78 3.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.075 4 0.075 5 0.075 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.02 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.034999999999999996 50-54 0.025 55-59 0.025 60-64 0.03 65-69 0.03 70-74 0.025 75-79 0.03 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.034999999999999996 100-104 0.03 105-109 0.025 110-114 0.045 115-119 0.04 120-124 0.03 125-129 0.03 130-134 0.04 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03943377148636 97.95 2 0.8341759352881698 1.6500000000000001 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.5125000000000002 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.3625 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.2875 0.0 0.0 0.0 0.0 120-121 3.5999999999999996 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.65 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.4 0.0 0.0 0.0 0.0 136-137 6.7875 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAGGA 10 0.00682755 145.0 7 ATTGCTG 10 0.00682755 145.0 8 AAAAAAA 95 5.155878E-4 12.210526 135-139 >>END_MODULE Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021816 spots for SRR5578452.sra Written 1021816 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra Read 1021808 spots for SRR5578452.sra Written 1021808 spots for SRR5578452.sra SRR ids: ['SRR5578452.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pd_mrcke SRR5578452.sra spots: 20436168 blocks: [[1, 1021808], [1021809, 2043616], [2043617, 3065424], [3065425, 4087232], [4087233, 5109040], [5109041, 6130848], [6130849, 7152656], [7152657, 8174464], [8174465, 9196272], [9196273, 10218080], [10218081, 11239888], [11239889, 12261696], [12261697, 13283504], [13283505, 14305312], [14305313, 15327120], [15327121, 16348928], [16348929, 17370736], [17370737, 18392544], [18392545, 19414352], [19414353, 20436168]] SRR5578452 file size 6903446 SRR5578452 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578452 SRR5578452_1.fastq SRR5578452_2.fastq Input file: SRR5578452_1.fastq Paired file: SRR5578452_2.fastq trimmed: SRR5578452-trimmed-pair1.fastq, SRR5578452-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:06:50 2024 >> started Mon Dec 9 18:07:13 2024 >> done (22.746s) 20436168 read pairs processed; of these: 48829 ( 0.24%) short read pairs filtered out after trimming by size control 72483 ( 0.35%) empty read pairs filtered out after trimming by size control 20314856 (99.41%) read pairs available; of these: 11201163 (55.14%) trimmed read pairs available after processing 9113693 (44.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 10 0.00% 20 8 0.00% 21 17 0.00% 22 16 0.00% 23 17 0.00% 24 27 0.00% 25 20 0.00% 26 21 0.00% 27 34 0.00% 28 22 0.00% 29 22 0.00% 30 34 0.00% 31 28 0.00% 32 26 0.00% 33 33 0.00% 34 34 0.00% 35 29 0.00% 36 48 0.00% 37 33 0.00% 38 66 0.00% 39 54 0.00% 40 65 0.00% 41 60 0.00% 42 66 0.00% 43 87 0.00% 44 91 0.00% 45 111 0.00% 46 102 0.00% 47 118 0.00% 48 155 0.00% 49 153 0.00% 50 177 0.00% 51 254 0.00% 52 204 0.00% 53 240 0.00% 54 317 0.00% 55 357 0.00% 56 406 0.00% 57 414 0.00% 58 520 0.00% 59 614 0.00% 60 747 0.00% 61 791 0.00% 62 918 0.00% 63 1001 0.00% 64 1193 0.01% 65 1335 0.01% 66 1401 0.01% 67 1682 0.01% 68 1980 0.01% 69 2381 0.01% 70 2771 0.01% 71 2940 0.01% 72 3331 0.02% 73 3871 0.02% 74 4148 0.02% 75 4666 0.02% 76 5167 0.03% 77 5647 0.03% 78 6402 0.03% 79 7357 0.04% 80 8007 0.04% 81 9244 0.05% 82 10459 0.05% 83 11636 0.06% 84 14762 0.07% 85 16902 0.08% 86 17379 0.09% 87 18682 0.09% 88 19657 0.10% 89 20417 0.10% 90 21962 0.11% 91 23528 0.12% 92 25165 0.12% 93 27368 0.13% 94 29245 0.14% 95 29809 0.15% 96 31745 0.16% 97 33045 0.16% 98 34612 0.17% 99 36194 0.18% 100 38312 0.19% 101 40598 0.20% 102 42902 0.21% 103 44874 0.22% 104 47772 0.24% 105 49323 0.24% 106 51926 0.26% 107 53138 0.26% 108 55052 0.27% 109 56741 0.28% 110 58536 0.29% 111 61674 0.30% 112 64733 0.32% 113 67139 0.33% 114 70467 0.35% 115 73333 0.36% 116 74539 0.37% 117 77366 0.38% 118 78962 0.39% 119 80711 0.40% 120 83986 0.41% 121 87209 0.43% 122 89956 0.44% 123 93624 0.46% 124 97384 0.48% 125 100452 0.49% 126 104596 0.51% 127 106590 0.52% 128 109365 0.54% 129 112946 0.56% 130 116782 0.57% 131 120295 0.59% 132 124567 0.61% 133 129734 0.64% 134 135010 0.66% 135 141025 0.69% 136 148146 0.73% 137 153693 0.76% 138 160896 0.79% 139 169766 0.84% 140 179211 0.88% 141 189437 0.93% 142 208505 1.03% 143 222069 1.09% 144 244779 1.20% 145 275446 1.36% 146 322048 1.59% 147 405645 2.00% 148 558994 2.75% 149 928089 4.57% 150 3588147 17.66% 151 9113693 44.86% 20314856 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=15 prefix-density=0.68 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=29.38 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.0 sequence=GTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.16 fanout-score-rank=12 prefix-density=0.46 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=42.71 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5578452 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:08:05 Started mapping on | Dec 09 18:08:05 Finished on | Dec 09 18:12:36 Mapping speed, Million of reads per hour | 269.87 Number of input reads | 20314856 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 18890864 Uniquely mapped reads % | 92.99% Average mapped length | 287.01 Number of splices: Total | 20202193 Number of splices: Annotated (sjdb) | 19022972 Number of splices: GT/AG | 19945747 Number of splices: GC/AG | 232150 Number of splices: AT/AC | 10456 Number of splices: Non-canonical | 13840 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248973 % of reads mapped to multiple loci | 1.23% Number of reads mapped to too many loci | 29671 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.88% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1207510 1207510 1207510 N_multimapping 248973 248973 248973 N_noFeature 808974 18336666 1018611 N_ambiguous 410260 2768 66558 UnstrandedReadsAssigned:17671630 PositiveStrandReadsAssigned:551430 NegativeStrandReadsAssigned:17805695 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5578452 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578452-trimmed-pair1.fastq SRR5578452-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,314,856 reads, 17,944,273 reads pseudoaligned [quant] estimated average fragment length: 237.111 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR5578452.ke.tsv 35125 SRR5578452.se.tsv 88098 total ==> SRR5578452.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.364 0 0 PNS24247 1044 807.889 42.7162 4.56145 PNS24249 1928 1691.89 59.7551 3.04695 PNS24246 1044 807.889 42.7162 4.56145 PNS24248 1044 807.889 42.7162 4.56145 PNS24244 1471 1234.89 119.096 8.32016 PNS24243 293 108.878 0 0 KQK14069 1603 1366.89 648.527 40.9314 KQK14071 474 255.696 30.4399 10.2702 ==> SRR5578452.se.tsv <== BRADI_1g14170v3 814 BRADI_1g53295v3 153 BRADI_1g59795v3 302 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 2122 BRADI_1g74790v3 79 BRADI_1g09890v3 2 BRADI_1g77505v3 282 BRADI_1g48960v3 0 SRR5578452 completed mapping pipeline successfully