Starting /dee2/code/volunteer_pipeline.sh SRR5578455 current disk space = 1515246235648 free memory = 1590264800 SRR5578455 SRAfilesize bbb412db75241eb195916163c9b5e4aa SRR5578455.sra SRR5578455.sra file validated SRR5578455 is paired end SRR5578455 is conventional basespace SRR5578455 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.352 34.0 34.0 34.0 33.0 34.0 2 33.36325 34.0 34.0 34.0 33.0 34.0 3 33.41725 34.0 34.0 34.0 33.0 34.0 4 33.57175 34.0 34.0 34.0 33.0 34.0 5 33.5715 34.0 34.0 34.0 33.0 34.0 6 37.30025 38.0 38.0 38.0 36.0 38.0 7 37.56975 38.0 38.0 38.0 37.0 38.0 8 37.62675 38.0 38.0 38.0 38.0 38.0 9 37.6865 38.0 38.0 38.0 38.0 38.0 10-14 37.65845 38.0 38.0 38.0 38.0 38.0 15-19 37.683949999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6765 38.0 38.0 38.0 38.0 38.0 25-29 37.59845 38.0 38.0 38.0 38.0 38.0 30-34 37.60615 38.0 38.0 38.0 38.0 38.0 35-39 37.5512 38.0 38.0 38.0 38.0 38.0 40-44 37.50305000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.4352 38.0 38.0 38.0 37.2 38.0 50-54 37.4237 38.0 38.0 38.0 37.0 38.0 55-59 37.39865 38.0 38.0 38.0 37.0 38.0 60-64 37.302949999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.280899999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.237049999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.209950000000006 38.0 38.0 38.0 36.2 38.0 80-84 37.0927 38.0 38.0 38.0 36.0 38.0 85-89 37.01950000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.9799 38.0 38.0 38.0 35.6 38.0 95-99 36.83365 38.0 38.0 38.0 35.0 38.0 100-104 36.76135 38.0 38.0 38.0 35.0 38.0 105-109 36.57105 38.0 38.0 38.0 34.0 38.0 110-114 36.447 38.0 38.0 38.0 34.2 38.0 115-119 36.3315 38.0 38.0 38.0 34.0 38.0 120-124 35.98765 38.0 37.0 38.0 32.8 38.0 125-129 35.886849999999995 38.0 36.6 38.0 32.8 38.0 130-134 35.57395 38.0 36.0 38.0 31.2 38.0 135-139 35.398250000000004 38.0 36.0 38.0 30.8 38.0 140-144 34.980000000000004 38.0 35.4 38.0 29.6 38.0 145-149 34.30675 38.0 35.0 38.0 27.0 38.0 150-151 30.3065 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 3.0 15 3.0 16 3.0 17 1.0 18 2.0 19 1.0 20 5.0 21 2.0 22 6.0 23 10.0 24 5.0 25 7.0 26 8.0 27 12.0 28 19.0 29 24.0 30 17.0 31 37.0 32 47.0 33 58.0 34 107.0 35 226.0 36 637.0 37 2756.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.943866943866944 10.576923076923077 9.277546777546778 38.2016632016632 2 26.674999999999997 13.725000000000001 32.1 27.500000000000004 3 23.275000000000002 17.549999999999997 24.075 35.099999999999994 4 28.799999999999997 25.75 19.625 25.825 5 28.225 29.575000000000003 22.075 20.125 6 22.825 32.425 22.025 22.725 7 18.425 22.85 39.1 19.625 8 20.424999999999997 22.85 29.475 27.250000000000004 9 21.099999999999998 22.475 31.424999999999997 25.0 10-14 23.78 26.240000000000002 24.945 25.035 15-19 23.845 25.185000000000002 25.36 25.61 20-24 23.565 25.31 25.395 25.729999999999997 25-29 23.745 25.119999999999997 25.22 25.915 30-34 23.669999999999998 25.255 25.27 25.805 35-39 24.195 24.175 25.845000000000002 25.785000000000004 40-44 23.71 25.014999999999997 25.290000000000003 25.985000000000003 45-49 23.97 25.374999999999996 24.84 25.814999999999998 50-54 23.955000000000002 25.045 25.174999999999997 25.825 55-59 24.695 24.925 24.975 25.405 60-64 24.035 24.59 24.88 26.495 65-69 23.76 25.045 25.240000000000002 25.955000000000002 70-74 24.36 24.529999999999998 24.82 26.290000000000003 75-79 24.93 24.62 24.21 26.240000000000002 80-84 24.66 24.349999999999998 24.884999999999998 26.105 85-89 24.855 24.495 24.875 25.775 90-94 24.315 24.224999999999998 25.119999999999997 26.340000000000003 95-99 24.404999999999998 24.605 25.345000000000002 25.645 100-104 25.074999999999996 25.28 24.169999999999998 25.474999999999998 105-109 25.085 24.765 24.315 25.835 110-114 24.365000000000002 24.815 24.315 26.505000000000003 115-119 24.68 25.669999999999998 23.865 25.785000000000004 120-124 25.314999999999998 25.19 23.745 25.75 125-129 24.765 25.590000000000003 23.315 26.33 130-134 24.98 25.61 23.235 26.174999999999997 135-139 24.605 26.095000000000002 23.93 25.369999999999997 140-144 24.46 25.46 23.715 26.365 145-149 24.585 25.82 23.525 26.07 150-151 24.474474474474476 25.600600600600597 23.873873873873876 26.05105105105105 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 0.5 28 4.0 29 8.0 30 9.5 31 10.0 32 13.5 33 21.5 34 24.5 35 34.5 36 52.5 37 70.0 38 93.5 39 114.0 40 125.0 41 130.5 42 146.0 43 166.0 44 169.5 45 162.0 46 177.0 47 191.0 48 174.0 49 163.0 50 154.5 51 141.0 52 125.5 53 105.5 54 100.0 55 105.0 56 111.5 57 100.0 58 84.0 59 81.0 60 78.0 61 71.5 62 64.5 63 69.0 64 73.0 65 67.5 66 57.5 67 54.0 68 46.0 69 39.5 70 41.5 71 38.0 72 30.5 73 25.5 74 22.5 75 17.0 76 11.5 77 8.0 78 4.5 79 2.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.39653855942989 96.65 2 1.4507508271824892 2.85 3 0.10180707559175363 0.3 4 0.050903537795876815 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.55 0.0 0.0 0.0 0.0 94-95 1.8 0.0 0.0 0.0 0.0 96-97 2.225 0.0 0.0 0.0 0.0 98-99 2.7625 0.0 0.0 0.0 0.0 100-101 3.35 0.0 0.0 0.0 0.0 102-103 3.95 0.0 0.0 0.0 0.0 104-105 4.35 0.0 0.0 0.0 0.0 106-107 4.8875 0.0 0.0 0.0 0.0 108-109 5.3875 0.0 0.0 0.0 0.0 110-111 6.0375 0.0 0.0 0.0 0.0 112-113 6.7375 0.0 0.0 0.0 0.0 114-115 7.75 0.0 0.0 0.0 0.0 116-117 8.8 0.0 0.0 0.0 0.0 118-119 9.462499999999999 0.0 0.0 0.0 0.0 120-121 10.3375 0.0 0.0 0.0 0.0 122-123 11.3625 0.0 0.0 0.0 0.0 124-125 12.2625 0.0 0.0 0.0 0.0 126-127 13.3 0.0 0.0 0.0 0.0 128-129 14.2375 0.0 0.0 0.0 0.0 130-131 15.275 0.0 0.0 0.0 0.0 132-133 16.225 0.0 0.0 0.0 0.0 134-135 17.2125 0.0 0.0 0.0 0.0 136-137 18.200000000000003 0.0 0.0 0.0 0.0 138-139 18.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5578455 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98125 33.0 33.0 34.0 32.0 34.0 2 33.1265 34.0 33.0 34.0 33.0 34.0 3 33.18275 34.0 33.0 34.0 33.0 34.0 4 33.0525 34.0 33.0 34.0 33.0 34.0 5 33.151 34.0 33.0 34.0 33.0 34.0 6 37.3025 38.0 38.0 38.0 37.0 38.0 7 37.32975 38.0 38.0 38.0 37.0 38.0 8 37.3885 38.0 38.0 38.0 38.0 38.0 9 37.368 38.0 38.0 38.0 38.0 38.0 10-14 37.3281 38.0 38.0 38.0 37.4 38.0 15-19 37.32845 38.0 38.0 38.0 37.4 38.0 20-24 37.2918 38.0 38.0 38.0 37.0 38.0 25-29 37.31635 38.0 38.0 38.0 37.4 38.0 30-34 37.32885 38.0 38.0 38.0 38.0 38.0 35-39 37.3161 38.0 38.0 38.0 37.8 38.0 40-44 37.3205 38.0 38.0 38.0 37.6 38.0 45-49 37.30115 38.0 38.0 38.0 37.4 38.0 50-54 37.2654 38.0 38.0 38.0 37.2 38.0 55-59 37.215050000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.161649999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.098349999999996 38.0 38.0 38.0 36.8 38.0 70-74 37.031400000000005 38.0 38.0 38.0 36.4 38.0 75-79 36.93435000000001 38.0 38.0 38.0 36.2 38.0 80-84 36.948449999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.812349999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.7635 38.0 38.0 38.0 35.4 38.0 95-99 36.6691 38.0 38.0 38.0 35.0 38.0 100-104 36.53105 38.0 38.0 38.0 34.6 38.0 105-109 36.3018 38.0 38.0 38.0 34.0 38.0 110-114 36.05985 38.0 38.0 38.0 33.6 38.0 115-119 35.84445 38.0 38.0 38.0 33.0 38.0 120-124 35.577749999999995 38.0 37.2 38.0 31.6 38.0 125-129 35.3433 38.0 36.4 38.0 31.0 38.0 130-134 34.9413 38.0 36.0 38.0 29.0 38.0 135-139 34.16930000000001 38.0 34.4 38.0 25.0 38.0 140-144 33.49375 38.0 33.0 38.0 21.8 38.0 145-149 31.96705 38.0 33.0 38.0 8.2 38.0 150-151 26.300625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 4.0 13 0.0 14 0.0 15 3.0 16 3.0 17 2.0 18 5.0 19 6.0 20 8.0 21 11.0 22 9.0 23 14.0 24 10.0 25 27.0 26 15.0 27 12.0 28 25.0 29 38.0 30 38.0 31 42.0 32 59.0 33 98.0 34 142.0 35 247.0 36 587.0 37 2581.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.66366366366366 18.56856856856857 12.762762762762764 30.005005005005003 2 29.014507253626814 23.28664332166083 26.413206603301653 21.285642821410704 3 24.024024024024023 25.350350350350347 25.525525525525527 25.100100100100097 4 26.326326326326328 30.155155155155157 18.993993993993993 24.524524524524523 5 27.52752752752753 33.408408408408405 19.21921921921922 19.844844844844843 6 23.724999999999998 34.300000000000004 20.4 21.575 7 23.075000000000003 17.95 33.425 25.55 8 24.25 22.175 23.925 29.65 9 23.974999999999998 22.925 26.25 26.85 10-14 26.035000000000004 25.345000000000002 22.785 25.835 15-19 26.0 25.025 23.705000000000002 25.27 20-24 26.22 25.11 23.505000000000003 25.165 25-29 26.22 24.86 23.24 25.679999999999996 30-34 26.090000000000003 25.155 23.97 24.785 35-39 26.051302565128253 24.616230811540575 23.43617180859043 25.896294814740738 40-44 26.025 24.865000000000002 23.64 25.47 45-49 26.36 25.16 23.635 24.845 50-54 26.375 24.535 24.185000000000002 24.905 55-59 26.695 24.69 23.51 25.105 60-64 26.21762176217622 24.122412241224122 24.412441244124413 25.247524752475247 65-69 26.173926088913333 24.51867780167025 24.513677051557732 24.79371905785868 70-74 26.401600400100023 23.730932733183295 24.486121530382597 25.381345336334082 75-79 26.229180213074578 24.90371630070525 24.118441454509078 24.7486620317111 80-84 26.068910336550484 24.55368305245787 24.32864929739461 25.048757313597044 85-89 26.75 24.67 24.205 24.375 90-94 27.22 24.67 24.04 24.07 95-99 26.21 24.88 24.65 24.26 100-104 27.12 24.645 24.245 23.990000000000002 105-109 26.88 25.41 23.445 24.265 110-114 27.22816845053516 25.0925277583275 23.632089626888067 24.047214164249276 115-119 27.525 25.455 23.724999999999998 23.294999999999998 120-124 27.950000000000003 26.25 23.23 22.57 125-129 28.376418820941048 25.6262813140657 22.786139306965346 23.211160558027903 130-134 28.531426571328566 25.931296564828244 22.90114505725286 22.636131806590328 135-139 28.725 26.145000000000003 23.119999999999997 22.009999999999998 140-144 29.115000000000002 26.155 23.205000000000002 21.525 145-149 28.505000000000003 26.32 23.119999999999997 22.055 150-151 29.812499999999996 26.9125 21.7375 21.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.5 28 4.0 29 4.5 30 5.5 31 8.5 32 11.5 33 15.5 34 23.0 35 36.5 36 49.0 37 55.0 38 75.5 39 98.5 40 107.5 41 121.0 42 129.5 43 138.5 44 157.5 45 160.0 46 156.0 47 161.5 48 159.5 49 164.0 50 163.5 51 142.5 52 131.5 53 126.0 54 125.0 55 111.0 56 94.0 57 99.5 58 93.5 59 94.5 60 98.5 61 82.0 62 80.5 63 82.0 64 76.5 65 71.0 66 62.0 67 66.5 68 68.5 69 63.0 70 49.5 71 39.0 72 36.5 73 27.0 74 20.0 75 14.0 76 9.5 77 8.5 78 6.0 79 4.0 80 3.0 81 2.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.05 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.015 70-74 0.025 75-79 0.034999999999999996 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.03 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.997432605905 95.42500000000001 2 1.514762516046213 2.9499999999999997 3 0.3337612323491656 0.975 4 0.10269576379974327 0.4 5 0.051347881899871634 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7375 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.1625 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.625 0.0 0.0 0.0 0.0 94-95 1.8624999999999998 0.0 0.0 0.0 0.0 96-97 2.275 0.0 0.0 0.0 0.0 98-99 2.8 0.0 0.0 0.0 0.0 100-101 3.375 0.0 0.0 0.0 0.0 102-103 4.0 0.0 0.0 0.0 0.0 104-105 4.4 0.0 0.0 0.0 0.0 106-107 4.9375 0.0 0.0 0.0 0.0 108-109 5.4625 0.0 0.0 0.0 0.0 110-111 6.1125 0.0 0.0 0.0 0.0 112-113 6.7625 0.0 0.0 0.0 0.0 114-115 7.75 0.0 0.0 0.0 0.0 116-117 8.7875 0.0 0.0 0.0 0.0 118-119 9.462499999999999 0.0 0.0 0.0 0.0 120-121 10.35 0.0 0.0 0.0 0.0 122-123 11.475 0.0 0.0 0.0 0.0 124-125 12.3875 0.0 0.0 0.0 0.0 126-127 13.425 0.0 0.0 0.0 0.0 128-129 14.3625 0.0 0.0 0.0 0.0 130-131 15.4 0.0 0.0 0.0 0.0 132-133 16.375 0.0 0.0 0.0 0.0 134-135 17.375 0.0 0.0 0.0 0.0 136-137 18.325000000000003 0.0 0.0 0.0 0.0 138-139 19.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTGTG 10 0.006830828 145.0 4 >>END_MODULE Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905412 spots for SRR5578455.sra Written 905412 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra Read 905401 spots for SRR5578455.sra Written 905401 spots for SRR5578455.sra SRR ids: ['SRR5578455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m5kc6mz_ SRR5578455.sra spots: 18108031 blocks: [[1, 905401], [905402, 1810802], [1810803, 2716203], [2716204, 3621604], [3621605, 4527005], [4527006, 5432406], [5432407, 6337807], [6337808, 7243208], [7243209, 8148609], [8148610, 9054010], [9054011, 9959411], [9959412, 10864812], [10864813, 11770213], [11770214, 12675614], [12675615, 13581015], [13581016, 14486416], [14486417, 15391817], [15391818, 16297218], [16297219, 17202619], [17202620, 18108031]] SRR5578455 file size 6114517 SRR5578455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578455 SRR5578455_1.fastq SRR5578455_2.fastq Input file: SRR5578455_1.fastq Paired file: SRR5578455_2.fastq trimmed: SRR5578455-trimmed-pair1.fastq, SRR5578455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:14:47 2024 >> started Thu Dec 12 03:15:07 2024 >> done (19.916s) 18108031 read pairs processed; of these: 14572 ( 0.08%) short read pairs filtered out after trimming by size control 19757 ( 0.11%) empty read pairs filtered out after trimming by size control 18073702 (99.81%) read pairs available; of these: 10206292 (56.47%) trimmed read pairs available after processing 7867410 (43.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 18 0.00% 20 13 0.00% 21 12 0.00% 22 12 0.00% 23 17 0.00% 24 20 0.00% 25 18 0.00% 26 27 0.00% 27 21 0.00% 28 21 0.00% 29 26 0.00% 30 27 0.00% 31 35 0.00% 32 33 0.00% 33 35 0.00% 34 41 0.00% 35 38 0.00% 36 55 0.00% 37 53 0.00% 38 52 0.00% 39 75 0.00% 40 75 0.00% 41 83 0.00% 42 92 0.00% 43 91 0.00% 44 110 0.00% 45 123 0.00% 46 164 0.00% 47 163 0.00% 48 210 0.00% 49 233 0.00% 50 244 0.00% 51 308 0.00% 52 362 0.00% 53 400 0.00% 54 392 0.00% 55 466 0.00% 56 525 0.00% 57 591 0.00% 58 721 0.00% 59 767 0.00% 60 883 0.00% 61 1037 0.01% 62 1143 0.01% 63 1347 0.01% 64 1464 0.01% 65 1677 0.01% 66 1908 0.01% 67 2227 0.01% 68 2618 0.01% 69 3084 0.02% 70 4099 0.02% 71 4572 0.03% 72 4784 0.03% 73 4961 0.03% 74 5549 0.03% 75 6153 0.03% 76 6795 0.04% 77 7660 0.04% 78 8474 0.05% 79 9683 0.05% 80 10739 0.06% 81 12170 0.07% 82 13522 0.07% 83 15361 0.08% 84 17328 0.10% 85 18874 0.10% 86 20592 0.11% 87 22139 0.12% 88 24138 0.13% 89 25285 0.14% 90 27338 0.15% 91 29826 0.17% 92 31702 0.18% 93 34294 0.19% 94 37087 0.21% 95 38583 0.21% 96 40882 0.23% 97 43119 0.24% 98 45012 0.25% 99 47072 0.26% 100 49780 0.28% 101 51278 0.28% 102 54137 0.30% 103 56488 0.31% 104 59209 0.33% 105 60919 0.34% 106 63406 0.35% 107 64658 0.36% 108 66720 0.37% 109 68633 0.38% 110 70105 0.39% 111 71945 0.40% 112 74868 0.41% 113 76543 0.42% 114 79430 0.44% 115 82122 0.45% 116 83013 0.46% 117 83957 0.46% 118 85390 0.47% 119 86287 0.48% 120 87850 0.49% 121 88809 0.49% 122 91039 0.50% 123 92557 0.51% 124 95528 0.53% 125 96838 0.54% 126 98615 0.55% 127 99682 0.55% 128 100287 0.55% 129 101973 0.56% 130 102682 0.57% 131 104321 0.58% 132 106328 0.59% 133 108285 0.60% 134 109998 0.61% 135 111257 0.62% 136 114092 0.63% 137 115272 0.64% 138 117331 0.65% 139 121677 0.67% 140 125137 0.69% 141 130564 0.72% 142 138899 0.77% 143 146313 0.81% 144 159280 0.88% 145 177136 0.98% 146 205809 1.14% 147 259701 1.44% 148 368924 2.04% 149 710922 3.93% 150 3688339 20.41% 151 7867410 43.53% 18073702 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=31 prefix-density=0.64 prefix-fanout=2.5 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=74.14 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.4 sequence=TTTCCAGAATTCAAGACGTTAACAGTTCTTGGCGCAAATAGCGCTGAATCGCTTCTTTAAAGGCTGCAGCGTCGTCCTCAAATTTCGCACTGACCATAATGTGATCCCTTCCGGCGGTCGGTATAAAATCAGGCAGTTTTTGATCACGTTTATTGTAAGCCGTCAGCATCGGGATATCATCTGCTTCAAGCTCCTCAAGCAGCCGAAGCACTGTTTTTTCATGTCCCGCATAATCCTCATTTGAAGAATCAATTAAATGCAGAATTAAATCCGCTTCTTTTACTTCCTCAAGCGTTGAGCGGAATGCAGCAATCAATGTCGTCGGAAGATCCTGAATAAATCCTACTGTATCTGAAAGAAGAACACTGTAGCCGCTTGGCAGGACCATTTTTCTGGTCATCGGGTCCAGCGTGGCAAACAGGAGGTCTTCTTCATAGCTGTCAGCACTCGTCAGGCGGTTGAACCATGTTGATTTCCCTGCGTTTGTATAGCCGACAAGCGCAATTTGAAG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=34 prefix-density=0.45 prefix-fanout=2.4 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=51.29 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.9 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR5578455 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:16:05 Started mapping on | Dec 12 03:16:07 Finished on | Dec 12 03:19:18 Mapping speed, Million of reads per hour | 340.66 Number of input reads | 18073702 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 16832546 Uniquely mapped reads % | 93.13% Average mapped length | 284.67 Number of splices: Total | 16438296 Number of splices: Annotated (sjdb) | 15451106 Number of splices: GT/AG | 16231204 Number of splices: GC/AG | 189059 Number of splices: AT/AC | 6626 Number of splices: Non-canonical | 11407 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 194333 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 29580 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.85% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1056687 1056687 1056687 N_multimapping 194333 194333 194333 N_noFeature 546306 16313104 700142 N_ambiguous 434037 2168 68599 UnstrandedReadsAssigned:15852203 PositiveStrandReadsAssigned:517274 NegativeStrandReadsAssigned:16063805 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=136 echo kmer=131 SRR5578455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578455-trimmed-pair1.fastq SRR5578455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,073,702 reads, 16,105,143 reads pseudoaligned [quant] estimated average fragment length: 220.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR5578455.ke.tsv 35125 SRR5578455.se.tsv 88098 total ==> SRR5578455.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.245 0 0 PNS24247 1044 824.841 40.9587 4.02027 PNS24249 1928 1708.84 109.465 5.18624 PNS24246 1044 824.841 40.9587 4.02027 PNS24248 1044 824.841 40.9587 4.02027 PNS24244 1471 1251.84 72.6593 4.69917 PNS24243 293 117.393 0 0 KQK14069 1603 1383.84 11515.5 673.717 KQK14071 474 268.27 364.105 109.884 ==> SRR5578455.se.tsv <== BRADI_1g14170v3 12899 BRADI_1g53295v3 98 BRADI_1g59795v3 564 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 227 BRADI_1g74790v3 86 BRADI_1g09890v3 0 BRADI_1g77505v3 388 BRADI_1g48960v3 0 SRR5578455 completed mapping pipeline successfully