Starting /dee2/code/volunteer_pipeline.sh SRR5578456 current disk space = 1522882203648 free memory = 1413374588 SRR5578456 SRAfilesize 6d8ca808591682f9d73ace778a9da8fd SRR5578456.sra SRR5578456.sra file validated SRR5578456 is paired end SRR5578456 is conventional basespace SRR5578456 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.296 34.0 33.0 34.0 33.0 34.0 2 33.4095 34.0 33.0 34.0 33.0 34.0 3 33.4065 34.0 34.0 34.0 33.0 34.0 4 33.3495 34.0 34.0 34.0 33.0 34.0 5 33.38725 34.0 34.0 34.0 33.0 34.0 6 37.06175 38.0 38.0 38.0 36.0 38.0 7 37.29375 38.0 38.0 38.0 37.0 38.0 8 37.41775 38.0 38.0 38.0 37.0 38.0 9 37.44675 38.0 38.0 38.0 37.0 38.0 10-14 37.4237 38.0 38.0 38.0 37.0 38.0 15-19 37.392900000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.431250000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.43785 38.0 38.0 38.0 37.4 38.0 30-34 37.4178 38.0 38.0 38.0 37.0 38.0 35-39 37.38055000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.33045 38.0 38.0 38.0 37.0 38.0 45-49 37.274 38.0 38.0 38.0 37.0 38.0 50-54 37.27295 38.0 38.0 38.0 37.0 38.0 55-59 37.2183 38.0 38.0 38.0 36.8 38.0 60-64 37.15565 38.0 38.0 38.0 36.2 38.0 65-69 37.144999999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.14005 38.0 38.0 38.0 36.0 38.0 75-79 37.10165000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.016 38.0 38.0 38.0 36.0 38.0 85-89 36.9886 38.0 38.0 38.0 35.6 38.0 90-94 36.9264 38.0 38.0 38.0 35.4 38.0 95-99 36.821450000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.7408 38.0 38.0 38.0 35.0 38.0 105-109 36.59505 38.0 38.0 38.0 34.6 38.0 110-114 36.5473 38.0 38.0 38.0 34.0 38.0 115-119 36.464749999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.248549999999994 38.0 38.0 38.0 33.6 38.0 125-129 36.13205000000001 38.0 37.8 38.0 33.2 38.0 130-134 35.925200000000004 38.0 37.8 38.0 33.0 38.0 135-139 35.694900000000004 38.0 36.4 38.0 32.2 38.0 140-144 35.296949999999995 38.0 36.0 38.0 31.0 38.0 145-149 35.03875 38.0 36.0 38.0 30.6 38.0 150-151 31.820125 35.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 0.0 17 0.0 18 4.0 19 3.0 20 4.0 21 2.0 22 4.0 23 4.0 24 8.0 25 9.0 26 15.0 27 19.0 28 23.0 29 28.0 30 29.0 31 40.0 32 69.0 33 83.0 34 113.0 35 181.0 36 487.0 37 2869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.89265111612741 10.885377476799599 7.474291447203411 37.74767995986957 2 24.775 13.675 33.825 27.725 3 22.125 19.825 23.474999999999998 34.575 4 27.150000000000002 26.85 19.950000000000003 26.05 5 25.775 30.375000000000004 23.05 20.8 6 22.15 31.974999999999998 24.3 21.575 7 17.9 21.9 40.150000000000006 20.05 8 20.65 22.05 29.375 27.925 9 19.625 21.875 32.574999999999996 25.924999999999997 10-14 23.885 25.845000000000002 24.985 25.285000000000004 15-19 23.575 24.725 25.965 25.735000000000003 20-24 23.50117505875294 24.89624481224061 25.981299064953244 25.621281064053203 25-29 23.75 25.03 25.0 26.22 30-34 23.599999999999998 24.975 25.355 26.07 35-39 23.57 25.06 25.040000000000003 26.33 40-44 23.65 25.28 25.314999999999998 25.755 45-49 23.54 24.490000000000002 25.540000000000003 26.43 50-54 23.919999999999998 24.505 25.900000000000002 25.674999999999997 55-59 24.09 24.975 25.52 25.415 60-64 24.02 24.33 25.435000000000002 26.215 65-69 24.205 24.905 25.715 25.174999999999997 70-74 24.165 24.625 24.715 26.495 75-79 24.349999999999998 24.610000000000003 25.290000000000003 25.75 80-84 23.97 24.38 25.31 26.340000000000003 85-89 24.68 24.455 24.765 26.1 90-94 24.6 24.490000000000002 24.86 26.05 95-99 24.425 24.709999999999997 25.055 25.81 100-104 23.990000000000002 24.95 25.4 25.66 105-109 24.345 24.665 25.069999999999997 25.919999999999998 110-114 24.55 25.165 24.485 25.8 115-119 24.57 25.535000000000004 24.32 25.575 120-124 24.996249812490625 25.241262063103154 23.941197059852993 25.821291064553225 125-129 24.57 25.215 24.104999999999997 26.11 130-134 25.255 24.89 23.96 25.895000000000003 135-139 24.265 25.75 23.62 26.365 140-144 24.12 25.44 23.395 27.045 145-149 24.15 26.200000000000003 23.330000000000002 26.32 150-151 24.575 24.837500000000002 24.0625 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.5 26 2.0 27 1.0 28 4.0 29 6.0 30 9.0 31 11.5 32 14.0 33 19.5 34 28.0 35 38.5 36 43.0 37 58.0 38 72.5 39 94.5 40 126.0 41 148.0 42 153.0 43 145.5 44 156.0 45 181.0 46 197.5 47 200.0 48 184.0 49 149.0 50 144.5 51 154.5 52 135.0 53 126.5 54 113.0 55 101.5 56 113.0 57 102.5 58 89.5 59 88.0 60 87.0 61 82.0 62 77.0 63 70.5 64 68.5 65 66.5 66 60.5 67 53.5 68 50.0 69 44.0 70 34.5 71 27.5 72 20.0 73 17.0 74 10.0 75 5.5 76 3.5 77 3.0 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 1.05 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.5374999999999996 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.3375000000000004 0.0 0.0 0.0 0.0 110-111 3.6875 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.825 0.0 0.0 0.0 0.0 116-117 5.4125 0.0 0.0 0.0 0.0 118-119 6.0125 0.0 0.0 0.0 0.0 120-121 6.6125 0.0 0.0 0.0 0.0 122-123 7.2875 0.0 0.0 0.0 0.0 124-125 7.9875 0.0 0.0 0.0 0.0 126-127 8.6625 0.0 0.0 0.0 0.0 128-129 9.55 0.0 0.0 0.0 0.0 130-131 10.2 0.0 0.0 0.0 0.0 132-133 10.8375 0.0 0.0 0.0 0.0 134-135 11.75 0.0 0.0 0.0 0.0 136-137 12.6625 0.0 0.0 0.0 0.0 138-139 13.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGCCA 10 0.006577216 146.82278 1 >>END_MODULE SRR5578456 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.81725 33.0 32.0 33.0 28.0 34.0 2 31.88725 33.0 32.0 34.0 28.0 34.0 3 31.97825 33.0 33.0 34.0 30.0 34.0 4 31.864 33.0 33.0 34.0 29.0 34.0 5 31.775 33.0 33.0 34.0 29.0 34.0 6 35.79825 38.0 37.0 38.0 31.0 38.0 7 35.63975 38.0 37.0 38.0 29.0 38.0 8 35.72275 38.0 37.0 38.0 31.0 38.0 9 35.679 38.0 37.0 38.0 31.0 38.0 10-14 35.7128 38.0 37.0 38.0 30.6 38.0 15-19 35.4785 38.0 37.0 38.0 29.0 38.0 20-24 35.3262 38.0 37.0 38.0 28.8 38.0 25-29 35.1414 38.0 36.8 38.0 28.0 38.0 30-34 34.950649999999996 38.0 36.0 38.0 27.4 38.0 35-39 34.7447 38.0 36.0 38.0 27.0 38.0 40-44 34.5923 38.0 36.0 38.0 26.2 38.0 45-49 34.343900000000005 38.0 35.2 38.0 24.8 38.0 50-54 34.1048 38.0 35.0 38.0 22.6 38.0 55-59 33.809 38.0 34.0 38.0 16.0 38.0 60-64 33.5058 38.0 34.0 38.0 16.0 38.0 65-69 33.2118 38.0 33.8 38.0 16.0 38.0 70-74 32.7275 37.8 32.6 38.0 15.8 38.0 75-79 32.25725 37.0 31.0 38.0 15.0 38.0 80-84 31.625999999999998 37.0 29.0 38.0 15.0 38.0 85-89 31.045949999999998 36.8 28.4 38.0 14.6 38.0 90-94 30.596749999999997 36.4 27.4 38.0 13.8 38.0 95-99 29.5559 35.4 24.4 38.0 13.0 38.0 100-104 28.7649 34.8 22.6 38.0 8.6 38.0 105-109 27.9584 34.0 17.4 38.0 2.0 38.0 110-114 26.8748 34.0 15.0 38.0 2.0 38.0 115-119 25.99665 33.8 14.8 38.0 2.0 38.0 120-124 24.96145 32.2 13.6 37.6 2.0 38.0 125-129 23.515700000000002 29.4 13.0 36.6 2.0 38.0 130-134 21.96215 25.8 2.0 35.4 2.0 38.0 135-139 20.4456 22.6 2.0 35.0 2.0 38.0 140-144 18.29345 15.4 2.0 34.2 2.0 38.0 145-149 16.16935 8.8 2.0 34.0 2.0 38.0 150-151 12.409875 2.0 2.0 28.5 2.0 36.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 13.0 4 9.0 5 6.0 6 8.0 7 16.0 8 10.0 9 10.0 10 19.0 11 13.0 12 18.0 13 20.0 14 36.0 15 32.0 16 36.0 17 33.0 18 42.0 19 44.0 20 59.0 21 74.0 22 80.0 23 86.0 24 94.0 25 97.0 26 110.0 27 111.0 28 148.0 29 183.0 30 226.0 31 241.0 32 329.0 33 336.0 34 432.0 35 395.0 36 417.0 37 182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.375 15.75 10.0 32.875 2 30.099999999999998 23.7 26.724999999999998 19.475 3 21.46073036518259 25.887943971985994 26.813406703351678 25.83791895947974 4 26.988494247123562 31.465732866433214 19.28464232116058 22.26113056528264 5 28.714357178589296 32.491245622811405 18.509254627313656 20.28514257128564 6 22.972972972972975 35.48548548548548 19.144144144144143 22.3973973973974 7 21.746746746746748 18.393393393393392 35.16016016016016 24.6996996996997 8 24.061091637456183 22.55883825738608 23.25988983475213 30.120180270405612 9 23.309964947421133 23.38507761642464 26.114171256885328 27.190786179268905 10-14 26.53480220330496 25.34802203304957 23.029544316474713 25.087631447170754 15-19 26.19560318493665 24.723321147779057 24.082327607792077 24.99874805949221 20-24 25.34802203304957 25.172759138708063 23.905858788182275 25.573360040060088 25-29 26.199058776409334 24.982477220386503 23.73085010513668 25.08761389806749 30-34 25.732605319841706 25.22666933827581 23.884185743625707 25.156539598256778 35-39 26.153846153846157 25.041343021799044 23.75845652718617 25.046354297168627 40-44 26.163402294244353 25.487151229775083 23.73891699644342 24.610529479537142 45-49 26.296815541758463 25.5357500500701 23.598037252153013 24.56939715601843 50-54 25.76137046684031 25.7964335804448 23.81787216990583 24.624323782809057 55-59 25.942616794351807 24.946171949326523 24.25016273596715 24.861048520354515 60-64 25.904971711810944 25.04380914234216 23.92229509838282 25.128924047464075 65-69 26.02513393080659 25.58453912782256 23.77709908376308 24.613227857607768 70-74 26.040779520064124 25.49471469365262 23.81644206202094 24.64806372426231 75-79 25.333199719410764 25.44844172762802 23.885158833550456 25.333199719410764 80-84 25.57370478003808 25.12275779136186 24.060527106924543 25.24301032167552 85-89 26.491359879789634 25.384422739794644 23.84673178061608 24.27748559979965 90-94 26.331612967880947 25.36453374755725 23.79616174775768 24.50769153680413 95-99 26.120935824858478 25.99068182956766 23.2553479284605 24.633034417113368 100-104 26.48340093135046 25.852486104852034 23.263732411997395 24.40038055180011 105-109 26.28783323311285 25.55622369212267 23.42653838444578 24.729404690318702 110-114 26.457915831663325 26.092184368737474 23.00100200400802 24.448897795591183 115-119 26.61690296077351 26.23616051300035 22.899654325935575 24.247282200290567 120-124 27.05829326923077 26.607572115384613 22.821514423076923 23.512620192307693 125-129 27.180720476977804 26.419159276516858 22.596322461045144 23.803797785460194 130-134 27.704564814350853 26.17627899984968 22.2678759332565 23.851280252542967 135-139 27.319613439487256 26.984126984126984 22.327374693305295 23.36888488308047 140-144 27.249974972469715 27.285013514866353 22.179397337070778 23.285614175593153 145-149 27.514022435897434 27.478966346153843 21.599559294871796 23.407451923076923 150-151 27.228342513770652 28.905858788182275 21.30696044066099 22.55883825738608 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 4.0 27 4.0 28 4.5 29 6.0 30 8.0 31 10.5 32 12.5 33 18.5 34 27.0 35 35.5 36 47.0 37 56.5 38 57.0 39 73.5 40 104.0 41 125.5 42 132.5 43 138.0 44 160.0 45 168.0 46 179.0 47 180.5 48 160.0 49 166.5 50 164.5 51 144.0 52 143.0 53 131.0 54 112.5 55 106.5 56 98.5 57 88.5 58 88.5 59 101.5 60 100.0 61 98.0 62 96.0 63 86.0 64 77.0 65 73.0 66 67.5 67 55.5 68 54.5 69 50.5 70 41.5 71 38.0 72 31.0 73 21.5 74 16.0 75 10.0 76 4.5 77 3.5 78 2.0 79 1.0 80 1.0 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.05 5 0.05 6 0.1 7 0.1 8 0.15 9 0.15 10-14 0.15 15-19 0.155 20-24 0.15 25-29 0.13 30-34 0.185 35-39 0.22499999999999998 40-44 0.185 45-49 0.13999999999999999 50-54 0.18 55-59 0.145 60-64 0.135 65-69 0.135 70-74 0.19499999999999998 75-79 0.21 80-84 0.21 85-89 0.17500000000000002 90-94 0.215 95-99 0.19499999999999998 100-104 0.145 105-109 0.22 110-114 0.2 115-119 0.19499999999999998 120-124 0.16 125-129 0.20500000000000002 130-134 0.215 135-139 0.145 140-144 0.11 145-149 0.16 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6559031281533804 1.3 3 0.12613521695257315 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.3250000000000002 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.2249999999999996 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 4.9375 0.0 0.0 0.0 0.0 126-127 5.175 0.0 0.0 0.0 0.0 128-129 5.7625 0.0 0.0 0.0 0.0 130-131 6.175 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 7.012499999999999 0.0 0.0 0.0 0.0 136-137 7.3875 0.0 0.0 0.0 0.0 138-139 7.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCACAC 10 0.006830828 145.0 2 CACGAGA 10 0.006830828 145.0 2 CACCACA 10 0.006830828 145.0 1 >>END_MODULE Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230336 spots for SRR5578456.sra Written 1230336 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra Read 1230320 spots for SRR5578456.sra Written 1230320 spots for SRR5578456.sra SRR ids: ['SRR5578456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ksbm2bdt SRR5578456.sra spots: 24606416 blocks: [[1, 1230320], [1230321, 2460640], [2460641, 3690960], [3690961, 4921280], [4921281, 6151600], [6151601, 7381920], [7381921, 8612240], [8612241, 9842560], [9842561, 11072880], [11072881, 12303200], [12303201, 13533520], [13533521, 14763840], [14763841, 15994160], [15994161, 17224480], [17224481, 18454800], [18454801, 19685120], [19685121, 20915440], [20915441, 22145760], [22145761, 23376080], [23376081, 24606416]] SRR5578456 file size 8316606 SRR5578456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578456 SRR5578456_1.fastq SRR5578456_2.fastq Input file: SRR5578456_1.fastq Paired file: SRR5578456_2.fastq trimmed: SRR5578456-trimmed-pair1.fastq, SRR5578456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:30:04 2024 >> started Mon Dec 9 18:32:20 2024 >> done (135.514s) 24606416 read pairs processed; of these: 72646 ( 0.30%) short read pairs filtered out after trimming by size control 67916 ( 0.28%) empty read pairs filtered out after trimming by size control 24465854 (99.43%) read pairs available; of these: 13032351 (53.27%) trimmed read pairs available after processing 11433503 (46.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 16 0.00% 21 15 0.00% 22 20 0.00% 23 12 0.00% 24 17 0.00% 25 26 0.00% 26 17 0.00% 27 23 0.00% 28 24 0.00% 29 25 0.00% 30 30 0.00% 31 20 0.00% 32 35 0.00% 33 32 0.00% 34 43 0.00% 35 52 0.00% 36 46 0.00% 37 41 0.00% 38 64 0.00% 39 69 0.00% 40 82 0.00% 41 84 0.00% 42 98 0.00% 43 116 0.00% 44 90 0.00% 45 126 0.00% 46 131 0.00% 47 154 0.00% 48 169 0.00% 49 222 0.00% 50 246 0.00% 51 286 0.00% 52 330 0.00% 53 359 0.00% 54 386 0.00% 55 424 0.00% 56 486 0.00% 57 550 0.00% 58 677 0.00% 59 737 0.00% 60 882 0.00% 61 1047 0.00% 62 1194 0.00% 63 1312 0.01% 64 1494 0.01% 65 1692 0.01% 66 1868 0.01% 67 2173 0.01% 68 2385 0.01% 69 2876 0.01% 70 3348 0.01% 71 3676 0.02% 72 4290 0.02% 73 4824 0.02% 74 5223 0.02% 75 6110 0.02% 76 6596 0.03% 77 7417 0.03% 78 8195 0.03% 79 9469 0.04% 80 10354 0.04% 81 11507 0.05% 82 13378 0.05% 83 14759 0.06% 84 18168 0.07% 85 20864 0.09% 86 21792 0.09% 87 23122 0.09% 88 24499 0.10% 89 26121 0.11% 90 27863 0.11% 91 30455 0.12% 92 31617 0.13% 93 33756 0.14% 94 36198 0.15% 95 38396 0.16% 96 40355 0.16% 97 42333 0.17% 98 44177 0.18% 99 45600 0.19% 100 48776 0.20% 101 50801 0.21% 102 53558 0.22% 103 56840 0.23% 104 59717 0.24% 105 61882 0.25% 106 65742 0.27% 107 66867 0.27% 108 69373 0.28% 109 72071 0.29% 110 74154 0.30% 111 76549 0.31% 112 80363 0.33% 113 82699 0.34% 114 86077 0.35% 115 90542 0.37% 116 93400 0.38% 117 96131 0.39% 118 97864 0.40% 119 99760 0.41% 120 102867 0.42% 121 106137 0.43% 122 109008 0.45% 123 112979 0.46% 124 117888 0.48% 125 121596 0.50% 126 126228 0.52% 127 129096 0.53% 128 131017 0.54% 129 135557 0.55% 130 139307 0.57% 131 142021 0.58% 132 146849 0.60% 133 151354 0.62% 134 157117 0.64% 135 164340 0.67% 136 169684 0.69% 137 175749 0.72% 138 180052 0.74% 139 188446 0.77% 140 198761 0.81% 141 209863 0.86% 142 227140 0.93% 143 242524 0.99% 144 266384 1.09% 145 303178 1.24% 146 352936 1.44% 147 434578 1.78% 148 596926 2.44% 149 1003509 4.10% 150 4268315 17.45% 151 11433503 46.73% 24465854 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=13 prefix-density=0.66 prefix-fanout=3.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=10.84 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=3.4 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=8.87 fanout-score-rank=12 prefix-density=0.57 prefix-fanout=5.3 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=105.65 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.3 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCC SRR5578456 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:36:32 Started mapping on | Dec 09 18:36:33 Finished on | Dec 09 18:50:47 Mapping speed, Million of reads per hour | 103.13 Number of input reads | 24465854 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 23081752 Uniquely mapped reads % | 94.34% Average mapped length | 286.99 Number of splices: Total | 23843628 Number of splices: Annotated (sjdb) | 22477473 Number of splices: GT/AG | 23532124 Number of splices: GC/AG | 285111 Number of splices: AT/AC | 8578 Number of splices: Non-canonical | 17815 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294342 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 29669 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1123087 1123087 1123087 N_multimapping 294342 294342 294342 N_noFeature 819193 22351782 1064791 N_ambiguous 572431 2962 89808 UnstrandedReadsAssigned:21690128 PositiveStrandReadsAssigned:727008 NegativeStrandReadsAssigned:21927153 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5578456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578456-trimmed-pair1.fastq SRR5578456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,465,854 reads, 22,047,780 reads pseudoaligned [quant] estimated average fragment length: 232.491 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR5578456.ke.tsv 35125 SRR5578456.se.tsv 88098 total ==> SRR5578456.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.928 0 0 PNS24247 1044 812.509 62.4697 4.97307 PNS24249 1928 1696.51 67.9435 2.59045 PNS24246 1044 812.509 62.4697 4.97307 PNS24248 1044 812.509 62.4697 4.97307 PNS24244 1471 1239.51 155.647 8.12224 PNS24243 293 108.95 0 0 KQK14069 1603 1371.51 1806.57 85.2001 KQK14071 474 257.968 77.3309 19.3897 ==> SRR5578456.se.tsv <== BRADI_1g14170v3 2094 BRADI_1g53295v3 146 BRADI_1g59795v3 736 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 307 BRADI_1g74790v3 171 BRADI_1g09890v3 0 BRADI_1g77505v3 333 BRADI_1g48960v3 0 SRR5578456 completed mapping pipeline successfully