Starting /dee2/code/volunteer_pipeline.sh SRR5578458 current disk space = 1522830647296 free memory = 1568281256 SRR5578458 SRAfilesize 2ec956a467b207b66df708dd3597b821 SRR5578458.sra SRR5578458.sra file validated SRR5578458 is paired end SRR5578458 is conventional basespace SRR5578458 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15125 34.0 33.0 34.0 33.0 34.0 2 33.35225 34.0 33.0 34.0 33.0 34.0 3 33.342 34.0 33.0 34.0 33.0 34.0 4 33.391 34.0 34.0 34.0 33.0 34.0 5 33.359 34.0 33.0 34.0 33.0 34.0 6 37.02325 38.0 38.0 38.0 36.0 38.0 7 37.31475 38.0 38.0 38.0 36.0 38.0 8 37.305 38.0 38.0 38.0 37.0 38.0 9 37.389 38.0 38.0 38.0 37.0 38.0 10-14 37.39495 38.0 38.0 38.0 37.0 38.0 15-19 37.4276 38.0 38.0 38.0 37.2 38.0 20-24 37.458549999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.38590000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.415350000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.34295 38.0 38.0 38.0 37.0 38.0 40-44 37.32555000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.24634999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.20665 38.0 38.0 38.0 36.6 38.0 55-59 37.176050000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.15675 38.0 38.0 38.0 36.0 38.0 65-69 37.1368 38.0 38.0 38.0 36.0 38.0 70-74 37.01235 38.0 38.0 38.0 35.8 38.0 75-79 37.068599999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.939949999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.8844 38.0 38.0 38.0 35.0 38.0 90-94 36.81675 38.0 38.0 38.0 35.0 38.0 95-99 36.6835 38.0 38.0 38.0 35.0 38.0 100-104 36.5479 38.0 38.0 38.0 34.2 38.0 105-109 36.519600000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.379599999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.236349999999995 38.0 38.0 38.0 33.8 38.0 120-124 36.1241 38.0 38.0 38.0 33.6 38.0 125-129 35.93560000000001 38.0 37.2 38.0 33.0 38.0 130-134 35.687349999999995 38.0 36.4 38.0 31.8 38.0 135-139 35.49035 38.0 36.0 38.0 31.0 38.0 140-144 35.27485 38.0 36.0 38.0 31.0 38.0 145-149 34.60164999999999 38.0 35.2 38.0 27.8 38.0 150-151 31.195625 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 2.0 17 2.0 18 2.0 19 3.0 20 5.0 21 3.0 22 6.0 23 2.0 24 6.0 25 12.0 26 12.0 27 17.0 28 27.0 29 38.0 30 47.0 31 43.0 32 69.0 33 63.0 34 116.0 35 206.0 36 500.0 37 2811.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.75226586102719 10.246727089627392 9.013091641490432 33.987915407854985 2 25.650000000000002 13.950000000000001 32.25 28.15 3 22.375 20.0 23.05 34.575 4 28.525 26.275 20.75 24.45 5 27.525 29.7 22.275 20.5 6 24.349999999999998 32.1 21.8 21.75 7 17.925 22.7 39.675 19.7 8 21.65 21.925 29.25 27.175 9 20.875 21.375 31.974999999999998 25.775 10-14 24.21 26.055 24.44 25.295 15-19 24.654999999999998 24.915000000000003 25.395 25.035 20-24 24.240000000000002 25.435000000000002 24.86 25.465 25-29 24.305 24.555 25.105 26.035000000000004 30-34 24.115000000000002 25.14 24.575 26.169999999999998 35-39 24.025 24.959999999999997 25.25 25.765 40-44 24.66 24.759999999999998 24.63 25.95 45-49 24.115000000000002 24.95 24.73 26.205000000000002 50-54 24.285 24.4 24.865000000000002 26.450000000000003 55-59 24.565 24.560000000000002 25.040000000000003 25.835 60-64 24.38 24.13 24.965 26.525 65-69 25.085 24.335 24.265 26.314999999999998 70-74 25.355 24.055 24.85 25.740000000000002 75-79 24.715 24.51 24.63 26.145000000000003 80-84 24.785 24.785 24.275 26.155 85-89 24.610000000000003 24.235 24.65 26.505000000000003 90-94 25.169999999999998 24.43 24.275 26.125 95-99 24.990000000000002 24.990000000000002 24.224999999999998 25.795 100-104 24.834999999999997 25.06 24.29 25.814999999999998 105-109 25.119999999999997 24.5 24.310000000000002 26.07 110-114 24.68 25.240000000000002 24.515 25.564999999999998 115-119 25.130000000000003 24.45 23.799999999999997 26.619999999999997 120-124 24.529999999999998 25.724999999999998 23.44 26.305 125-129 25.035 25.174999999999997 23.169999999999998 26.619999999999997 130-134 25.25 25.230000000000004 22.85 26.669999999999998 135-139 24.435000000000002 25.540000000000003 23.225 26.8 140-144 24.38 25.040000000000003 23.255 27.325 145-149 24.099999999999998 25.2 23.51 27.189999999999998 150-151 23.724999999999998 25.887500000000003 23.0375 27.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 1.5 26 1.5 27 2.0 28 2.0 29 4.5 30 8.5 31 11.0 32 15.0 33 26.5 34 29.0 35 29.5 36 45.5 37 68.0 38 83.5 39 95.5 40 107.0 41 119.0 42 138.5 43 160.5 44 177.5 45 179.0 46 175.0 47 171.0 48 165.5 49 165.5 50 161.5 51 152.5 52 138.0 53 111.5 54 93.5 55 93.5 56 97.0 57 93.5 58 85.5 59 85.0 60 91.0 61 85.5 62 78.5 63 72.5 64 68.5 65 65.0 66 59.5 67 62.0 68 46.5 69 46.5 70 55.5 71 36.0 72 26.0 73 25.0 74 20.5 75 20.0 76 15.5 77 8.5 78 7.0 79 4.5 80 2.5 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.55403348554034 97.125 2 1.4205986808726534 2.8000000000000003 3 0.025367833587011668 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.44999999999999996 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.5874999999999999 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.9125 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88-89 1.1875 0.0 0.0 0.0 0.0 90-91 1.4 0.0 0.0 0.0 0.0 92-93 1.65 0.0 0.0 0.0 0.0 94-95 1.8624999999999998 0.0 0.0 0.0 0.0 96-97 2.2750000000000004 0.0 0.0 0.0 0.0 98-99 2.55 0.0 0.0 0.0 0.0 100-101 3.0625 0.0 0.0 0.0 0.0 102-103 3.45 0.0 0.0 0.0 0.0 104-105 4.15 0.0 0.0 0.0 0.0 106-107 4.737500000000001 0.0 0.0 0.0 0.0 108-109 5.4625 0.0 0.0 0.0 0.0 110-111 6.0625 0.0 0.0 0.0 0.0 112-113 6.825 0.0 0.0 0.0 0.0 114-115 7.4 0.0 0.0 0.0 0.0 116-117 8.2375 0.0 0.0 0.0 0.0 118-119 9.337499999999999 0.0 0.0 0.0 0.0 120-121 10.2875 0.0 0.0 0.0 0.0 122-123 10.95 0.0 0.0 0.0 0.0 124-125 11.75 0.0 0.0 0.0 0.0 126-127 12.7125 0.0 0.0 0.0 0.0 128-129 13.6125 0.0 0.0 0.0 0.0 130-131 14.4625 0.0 0.0 0.0 0.0 132-133 15.2875 0.0 0.0 0.0 0.0 134-135 16.0 0.0 0.0 0.0 0.0 136-137 16.825 0.0 0.0 0.0 0.0 138-139 17.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTCG 10 0.006830828 145.0 9 AAGAGCA 65 0.0076375785 13.384615 130-134 >>END_MODULE SRR5578458 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5578458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28475 33.0 32.0 33.0 27.0 34.0 2 31.54975 33.0 32.0 34.0 27.0 34.0 3 31.5015 33.0 31.0 34.0 28.0 34.0 4 31.5365 33.0 32.0 34.0 28.0 34.0 5 31.4295 33.0 32.0 34.0 28.0 34.0 6 35.51575 38.0 37.0 38.0 29.0 38.0 7 35.3655 38.0 37.0 38.0 29.0 38.0 8 35.4505 38.0 37.0 38.0 29.0 38.0 9 35.491 38.0 37.0 38.0 29.0 38.0 10-14 35.29375 38.0 36.8 38.0 29.0 38.0 15-19 35.0056 38.0 36.0 38.0 28.0 38.0 20-24 34.833749999999995 38.0 36.0 38.0 27.6 38.0 25-29 34.65070000000001 38.0 36.0 38.0 26.6 38.0 30-34 34.4414 38.0 36.0 38.0 25.8 38.0 35-39 34.2761 38.0 35.0 38.0 25.0 38.0 40-44 34.1528 38.0 35.0 38.0 25.0 38.0 45-49 33.833800000000004 38.0 34.4 38.0 17.8 38.0 50-54 33.5407 38.0 34.0 38.0 16.0 38.0 55-59 33.22425 38.0 33.6 38.0 16.0 38.0 60-64 32.8845 38.0 33.0 38.0 16.0 38.0 65-69 32.435300000000005 37.4 31.6 38.0 15.6 38.0 70-74 31.976799999999997 37.0 30.4 38.0 15.0 38.0 75-79 31.34855 37.0 28.6 38.0 15.0 38.0 80-84 30.755949999999995 36.4 27.8 38.0 14.0 38.0 85-89 30.089949999999998 36.0 26.0 38.0 13.2 38.0 90-94 29.24875 35.2 23.4 38.0 13.0 38.0 95-99 28.457100000000004 34.6 19.2 38.0 4.2 38.0 100-104 27.643549999999998 34.0 15.0 38.0 2.0 38.0 105-109 26.57785 34.0 15.0 38.0 2.0 38.0 110-114 25.6002 32.8 14.4 37.6 2.0 38.0 115-119 24.43475 30.8 13.4 37.0 2.0 38.0 120-124 23.067600000000002 27.8 10.8 36.2 2.0 38.0 125-129 21.89675 25.4 2.0 36.0 2.0 38.0 130-134 20.3137 22.4 2.0 34.6 2.0 38.0 135-139 18.7481 18.4 2.0 34.8 2.0 38.0 140-144 16.7806 13.2 2.0 33.8 2.0 38.0 145-149 14.211500000000001 2.0 2.0 32.0 2.0 38.0 150-151 10.45175 2.0 2.0 16.5 2.0 34.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 55.0 3 11.0 4 14.0 5 11.0 6 12.0 7 12.0 8 10.0 9 15.0 10 14.0 11 17.0 12 19.0 13 28.0 14 32.0 15 33.0 16 40.0 17 56.0 18 59.0 19 59.0 20 63.0 21 75.0 22 77.0 23 87.0 24 112.0 25 116.0 26 135.0 27 174.0 28 177.0 29 207.0 30 231.0 31 278.0 32 300.0 33 301.0 34 362.0 35 376.0 36 319.0 37 113.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.849999999999994 17.95 12.15 29.049999999999997 2 31.1639549436796 22.02753441802253 24.63078848560701 22.177722152690862 3 24.705587572037082 24.17940365823102 26.158857429215736 24.95615134051616 4 27.851591877663573 31.110554023564802 18.42567059413387 22.612183504637752 5 26.89897217347706 33.79293055903735 18.47580847330158 20.832288794184006 6 23.54854854854855 34.88488488488489 19.794794794794797 21.77177177177177 7 23.9549436795995 18.39799749687109 33.81727158948686 23.829787234042556 8 23.153942428035045 21.802252816020026 24.130162703379224 30.91364205256571 9 23.466065614825947 23.09040821437516 26.3961933383421 27.0473328324568 10-14 25.980858846520015 25.379566067044145 23.024502680763643 25.615072405672194 15-19 25.62431050045131 25.072710861498344 23.879249824491026 25.423728813559322 20-24 26.396549994985456 25.12787082539364 23.00671948651088 25.46885969311002 25-29 25.71715145436309 25.35606820461384 23.029087261785357 25.897693079237715 30-34 25.852557673019056 24.85456369107322 23.74122367101304 25.55165496489468 35-39 26.068204613841523 24.9197592778335 23.82146439317954 25.19057171514544 40-44 25.97754160818127 25.711850812111493 23.24042510527371 25.070182474433526 45-49 26.139497568068997 24.805696234267664 23.537080679937823 25.51772551772552 50-54 25.701965503409546 25.035098275170476 23.95707982350582 25.305856397914162 55-59 26.518228774885916 24.607592397572837 23.66982598666065 25.204352840880595 60-64 26.238716148445334 25.531594784353057 23.094282848545635 25.13540621865597 65-69 26.434302908726178 25.401203610832496 23.365095285857574 24.799398194583752 70-74 25.87261785356068 24.859578736208626 23.736208625877634 25.531594784353057 75-79 25.341023069207623 24.398194583751255 24.187562688064194 26.07321965897693 80-84 26.238716148445334 25.125376128385156 23.350050150451356 25.285857572718157 85-89 26.334002006018054 24.49849548645938 23.400200601805416 25.76730190571715 90-94 26.66232073011734 24.781867415504966 23.437970113328653 25.11784174104904 95-99 26.54964894684052 24.90471414242728 23.51554663991976 25.030090270812437 100-104 26.737538862701836 24.897201885467858 22.921472269581788 25.443786982248522 105-109 26.72016048144433 25.401203610832496 22.883650952858574 24.994984954864595 110-114 26.7753259779338 25.837512537612838 22.58776328986961 24.799398194583752 115-119 27.442326980942827 25.862587763289866 21.68505516549649 25.010030090270813 120-124 27.29689067201605 25.837512537612838 22.552657973921768 24.312938816449346 125-129 28.26980942828485 26.19358074222668 21.76529588766299 23.771313941825476 130-134 28.19458375125376 25.842527582748243 21.73520561685055 24.22768304914744 135-139 28.5456369107322 26.344032096288867 21.424272818455368 23.686058174523573 140-144 28.615847542627883 27.04112337011033 20.53159478435306 23.811434302908726 145-149 29.351313414878682 27.100461199117703 20.257669941848807 23.290555444154805 150-151 29.512714518351498 28.07215332581736 19.140673932105727 23.274458223725418 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.5 2 1.0 3 1.5 4 1.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 0.0 26 1.5 27 2.0 28 3.0 29 5.5 30 9.0 31 14.5 32 18.5 33 18.5 34 24.0 35 32.0 36 40.5 37 60.5 38 80.5 39 84.5 40 103.0 41 119.5 42 125.0 43 138.0 44 160.0 45 167.5 46 151.0 47 154.5 48 161.5 49 160.5 50 147.0 51 146.0 52 135.0 53 105.5 54 99.0 55 106.5 56 110.0 57 101.5 58 91.5 59 86.0 60 88.5 61 92.0 62 94.0 63 85.0 64 77.5 65 74.0 66 67.5 67 65.5 68 56.5 69 51.0 70 45.5 71 43.0 72 40.5 73 30.5 74 31.5 75 28.5 76 17.5 77 9.0 78 5.0 79 4.5 80 4.0 81 3.5 82 1.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.22499999999999998 4 0.27499999999999997 5 0.27499999999999997 6 0.1 7 0.125 8 0.125 9 0.17500000000000002 10-14 0.215 15-19 0.29 20-24 0.29 25-29 0.3 30-34 0.3 35-39 0.3 40-44 0.26 45-49 0.28500000000000003 50-54 0.27999999999999997 55-59 0.295 60-64 0.3 65-69 0.3 70-74 0.3 75-79 0.3 80-84 0.3 85-89 0.3 90-94 0.29 95-99 0.3 100-104 0.29 105-109 0.3 110-114 0.3 115-119 0.3 120-124 0.3 125-129 0.3 130-134 0.3 135-139 0.3 140-144 0.3 145-149 0.26 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70459740919482 97.15 2 1.1176022352044706 2.1999999999999997 3 0.12700025400050802 0.375 4 0.0 0.0 5 0.025400050800101596 0.125 6 0.025400050800101596 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit GCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.1875 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3375 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.65 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.9125000000000001 0.0 0.0 0.0 0.0 88-89 1.0125 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.4874999999999998 0.0 0.0 0.0 0.0 96-97 1.7 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.45 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.5374999999999996 0.0 0.0 0.0 0.0 110-111 3.7625 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.5 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.4875 0.0 0.0 0.0 0.0 120-121 5.9875 0.0 0.0 0.0 0.0 122-123 6.387499999999999 0.0 0.0 0.0 0.0 124-125 6.8125 0.0 0.0 0.0 0.0 126-127 7.3 0.0 0.0 0.0 0.0 128-129 7.775 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.5 0.0 0.0 0.0 0.0 134-135 8.8875 0.0 0.0 0.0 0.0 136-137 9.4 0.0 0.0 0.0 0.0 138-139 9.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTCCA 10 0.006824188 145.0 9 AAAAACA 10 0.006824188 145.0 145 >>END_MODULE Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239185 spots for SRR5578458.sra Written 1239185 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra Read 1239169 spots for SRR5578458.sra Written 1239169 spots for SRR5578458.sra SRR ids: ['SRR5578458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pod4varq SRR5578458.sra spots: 24783396 blocks: [[1, 1239169], [1239170, 2478338], [2478339, 3717507], [3717508, 4956676], [4956677, 6195845], [6195846, 7435014], [7435015, 8674183], [8674184, 9913352], [9913353, 11152521], [11152522, 12391690], [12391691, 13630859], [13630860, 14870028], [14870029, 16109197], [16109198, 17348366], [17348367, 18587535], [18587536, 19826704], [19826705, 21065873], [21065874, 22305042], [22305043, 23544211], [23544212, 24783396]] SRR5578458 file size 8376579 SRR5578458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5578458 SRR5578458_1.fastq SRR5578458_2.fastq Input file: SRR5578458_1.fastq Paired file: SRR5578458_2.fastq trimmed: SRR5578458-trimmed-pair1.fastq, SRR5578458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 18:33:02 2024 >> started Mon Dec 9 18:33:35 2024 >> done (32.177s) 24783396 read pairs processed; of these: 85772 ( 0.35%) short read pairs filtered out after trimming by size control 116441 ( 0.47%) empty read pairs filtered out after trimming by size control 24581183 (99.18%) read pairs available; of these: 14743460 (59.98%) trimmed read pairs available after processing 9837723 (40.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 16 0.00% 20 19 0.00% 21 17 0.00% 22 19 0.00% 23 29 0.00% 24 24 0.00% 25 27 0.00% 26 26 0.00% 27 32 0.00% 28 36 0.00% 29 34 0.00% 30 53 0.00% 31 43 0.00% 32 55 0.00% 33 56 0.00% 34 48 0.00% 35 68 0.00% 36 61 0.00% 37 63 0.00% 38 87 0.00% 39 102 0.00% 40 114 0.00% 41 122 0.00% 42 121 0.00% 43 169 0.00% 44 199 0.00% 45 191 0.00% 46 206 0.00% 47 244 0.00% 48 291 0.00% 49 345 0.00% 50 430 0.00% 51 473 0.00% 52 545 0.00% 53 622 0.00% 54 667 0.00% 55 659 0.00% 56 882 0.00% 57 983 0.00% 58 1121 0.00% 59 1351 0.01% 60 1523 0.01% 61 1827 0.01% 62 1892 0.01% 63 2289 0.01% 64 2537 0.01% 65 2747 0.01% 66 3141 0.01% 67 3819 0.02% 68 4248 0.02% 69 5015 0.02% 70 5450 0.02% 71 6347 0.03% 72 6808 0.03% 73 7795 0.03% 74 8602 0.03% 75 9649 0.04% 76 10578 0.04% 77 11949 0.05% 78 13291 0.05% 79 15058 0.06% 80 16669 0.07% 81 18910 0.08% 82 21307 0.09% 83 23670 0.10% 84 29300 0.12% 85 32069 0.13% 86 33543 0.14% 87 35584 0.14% 88 37405 0.15% 89 39644 0.16% 90 42030 0.17% 91 45432 0.18% 92 48585 0.20% 93 51337 0.21% 94 54958 0.22% 95 57362 0.23% 96 59823 0.24% 97 62956 0.26% 98 65131 0.26% 99 68555 0.28% 100 71643 0.29% 101 74703 0.30% 102 78474 0.32% 103 81719 0.33% 104 84580 0.34% 105 87886 0.36% 106 91821 0.37% 107 93514 0.38% 108 96569 0.39% 109 98750 0.40% 110 101848 0.41% 111 105874 0.43% 112 108697 0.44% 113 112272 0.46% 114 116368 0.47% 115 120192 0.49% 116 121852 0.50% 117 124555 0.51% 118 126254 0.51% 119 127732 0.52% 120 130546 0.53% 121 134343 0.55% 122 137944 0.56% 123 140850 0.57% 124 145139 0.59% 125 148746 0.61% 126 152733 0.62% 127 154903 0.63% 128 157086 0.64% 129 161502 0.66% 130 164718 0.67% 131 168456 0.69% 132 172534 0.70% 133 175855 0.72% 134 180517 0.73% 135 186395 0.76% 136 190996 0.78% 137 197653 0.80% 138 202639 0.82% 139 212098 0.86% 140 223592 0.91% 141 235139 0.96% 142 251115 1.02% 143 269218 1.10% 144 296631 1.21% 145 336911 1.37% 146 385974 1.57% 147 487224 1.98% 148 655720 2.67% 149 1110571 4.52% 150 4170908 16.97% 151 9837723 40.02% 24581183 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=14 prefix-density=0.91 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=32 fanout-score=29.56 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=8.2 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.26 fanout-score-rank=18 prefix-density=0.53 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=33.89 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCC SRR5578458 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 18:34:24 Started mapping on | Dec 09 18:34:25 Finished on | Dec 09 18:38:06 Mapping speed, Million of reads per hour | 400.42 Number of input reads | 24581183 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 23207822 Uniquely mapped reads % | 94.41% Average mapped length | 282.41 Number of splices: Total | 22996740 Number of splices: Annotated (sjdb) | 21738382 Number of splices: GT/AG | 22697569 Number of splices: GC/AG | 274652 Number of splices: AT/AC | 7168 Number of splices: Non-canonical | 17351 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255084 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 21222 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1166314 1166314 1166314 N_multimapping 255084 255084 255084 N_noFeature 776648 22511733 1000983 N_ambiguous 564490 2750 94717 UnstrandedReadsAssigned:21866684 PositiveStrandReadsAssigned:693339 NegativeStrandReadsAssigned:22112122 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR5578458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5578458-trimmed-pair1.fastq SRR5578458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,581,183 reads, 22,174,130 reads pseudoaligned [quant] estimated average fragment length: 227.743 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR5578458.ke.tsv 35125 SRR5578458.se.tsv 88098 total ==> SRR5578458.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.589 0 0 PNS24247 1044 817.257 42.6781 3.33307 PNS24249 1928 1701.26 69.3087 2.60026 PNS24246 1044 817.257 42.6781 3.33307 PNS24248 1044 817.257 42.6781 3.33307 PNS24244 1471 1244.26 47.6569 2.44464 PNS24243 293 115.092 1 0.554565 KQK14069 1603 1376.26 2373.01 110.052 KQK14071 474 262.914 89.4266 21.7096 ==> SRR5578458.se.tsv <== BRADI_1g14170v3 2775 BRADI_1g53295v3 116 BRADI_1g59795v3 656 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 233 BRADI_1g74790v3 57 BRADI_1g09890v3 0 BRADI_1g77505v3 344 BRADI_1g48960v3 0 SRR5578458 completed mapping pipeline successfully